Skip to main content
NCBI home page
Journal of Virology logoLink to Journal of Virology
. 2024 Feb 1;98(2):e01948-23. doi: 10.1128/jvi.01948-23

Phospho-eIF4E stimulation regulates coronavirus entry by selective expression of cell membrane-residential factors

Xiu-Zhong Zhang 1,#, Jing Wang 1,#, Wen-Jun Tian 1, Jing-Ling You 1, Xiao-Jing Chi 2,✉, Xiao-Jia Wang 1,✉
Editor: Shan-Lu Liu3
PMCID: PMC10878034  PMID: 38299843

ABSTRACT

The eukaryotic translation initiation factor eIF4E can regulate cellular translation via phosphorylation on serine 209. In a recent study, by two rounds of TMT relative quantitative proteomics, we found that phosphorylated eIF4E (p-eIF4E) favors the translation of selected mRNAs, and the encoded proteins are mainly involved in ECM-receptor, focal adhesion, and PI3K-Akt signaling. The current paper is focused on the relationship between p-eIF4E and the downstream host cell proteins, and their presumed effect on efficient entry of PEDV. We found that the depletion of membrane-residential factor TSPAN3, CD63, and ITGB2 significantly inhibited viral invasion of PEDV, and reduced the entry of pseudotyped particles PEDV-pp, SARS-CoV-pp, and SARS-CoV-2-pp. The specific antibodies of TSPAN3, CD63, and ITGB2 blocked the adsorption of PEDV into host cells. Moreover, we detected that eIF4E phosphorylation was increased at 1 h after PEDV infection, in accordance with the expression of TSPAN3, CD63, and ITGB2. Similar trends appeared in the intestines of piglets in the early stage of PEDV challenge. Compared with Vero cells, S209A-Vero cells in which eIF4E cannot be phosphorylated showed a decrease of invading PEDV virions. MNK kinase inhibitor blocked PEDV invasion, as well as reduced the accumulation of TSPAN3, CD63, and ITGB2. Further study showed that the ERK-MNK pathway was responsible for the regulation of PEDV-induced early phosphorylation of eIF4E. This paper demonstrates for the first time the connections among p-eIF4E stimulation and membrane-residential host factors. Our findings also enrich the understanding of the biological function of phosphorylated eIF4E during the viral life cycle.

IMPORTANCE

The eukaryotic translation initiation factor eIF4E can regulate cellular translation via phosphorylation. In our previous study, several host factors susceptible to a high level of p-eIF4E were found to be conducive to viral infection by coronavirus PEDV. The current paper is focused on cell membrane-residential factors, which are involved in signal pathways that are sensitive to phosphorylated eIF4E. We found that the ERK-MNK pathway was activated, which resulted in the stimulation of phosphorylation of eIF4E in early PEDV infection. Phospho-eIF4E promoted the viral invasion of PEDV by upregulating the expression of host factors TSPAN3, CD63, and ITGB2 at the translation level rather than at the transcription level. Moreover, TSPAN3, CD63, or ITGB2 facilitates the efficient entry of coronavirus SARS-CoV, SARS-CoV-2, and HCoV-OC43. Our findings broaden our insights into the dynamic phosphorylation of eIF4E during the viral life cycle, and provide further evidence that phosphorylated eIF4E regulates selective translation of host mRNA.

KEYWORDS: coronavirus, PEDV, eIF4E phosphorylation, TSPAN3, CD63, ITGB2, viral entry

INTRODUCTION

Coronaviruses (CoVs), isolated from chickens in 1937, are a large group of RNA-enveloped viruses with a positive-sense single-stranded genome (1). The genome, ranging from 15 to 32 kilobases (kb) in length, contains a methylation “Cap” 5′ untranslated region (UTR), at least 12 open reading frames (ORFs), a 3′ UTR, and a poly (A) tail, which allows it to translate into the replicase polyproteins as an mRNA. The pp1a and pp1ab proteins, encoded by ORF1a and ORF1b, can be cleaved into 16 nonstructural proteins (NSPs) by viral proteases, named nsp1-16 (2). CoVs usually contain four structural proteins, including membrane glycoprotein (M), spike protein (S), nucleocapsid protein (N), and envelope protein (E), while the hemagglutinin-esterase (HE) present in β-coronaviruses is a fifth structural protein (3). CoVs can be divided into four groups: α-CoVs, β-CoVs, γ-CoVs, and δ-CoVs, and they mainly infect birds and mammals, as well as human beings, causing significant morbidity and mortality in animals and humans worldwide (4). The CoVs include severe acute respiratory syndrome virus (SARS-CoV), Middle East respiratory syndrome virus (MERS-CoV), and especially severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which have caused great threats to public health and seriously affected the global economy (5).

CoVs use a cap-dependent mechanism to accomplish the translation initiation, by using the host translation system to ensure viral protein synthesis and progeny virion production (6). The cap-dependent mechanism initiates translation when the 5′ cap structure is recognized and bound by the eukaryotic initiation factor 4F (eIF4F), which consists of a cap-binding protein eIF4E, an RNA helicase eIF4A, and a scaffold protein eIF4G (7). Among them, eIF4E is a critical effector and is thought to be the rate-limiting determinant of translation (8). The activity of eIF4E can be regulated by phosphorylation at Ser209, which is controlled by mitogen-activated protein kinase–interacting kinases Mnk1 and Mnk2 (9). Mnk1 and Mnk2 are known as the exclusive kinases to phosphorylate eIF4E; Mnk2 is constitutively active, while Mnk1 is regulated by downstream signaling of p38 MAP kinase and Erk1/2 in response to mitogenic activation, growth factors, and hormones (10).

Although the function of eIF4E phosphorylation remains the subject of debate, it has been documented that the phosphorylation of eIF4E at Ser209 is crucial for biogenesis, tumorigenesis, and viral infection (11, 12). The level of phosphorylated eIF4E (p-eIF4E) is upregulated in tumor cells, and inhibitors targeting p-eIF4E have been considered for anticancer therapeutics (13). It reported that mouse embryonic fibroblasts (MEFs) isolated from embryos in which eIF4E serine 209 was mutated to alanine display a marked resistance to oncogene-induced transformation (12). Previous studies have shown that p-eIF4E is involved in the selective translation of mRNAs that are linked to the inflammation, extracellular matrix (ECM), and cell proliferation and survival, but it does not affect global translation (14). Phosphorylation of eIF4E is regulated during infection by several viruses, such as simplex herpesvirus-1 (HSV-1), vesicular stomatitis virus (VSV), encephalomyocarditis virus (EMCV), murine norovirus 1 (MNV1), Newcastle disease virus (NDV), and poxvirus (15–18). Our recent study showed that the phosphorylation of eIF4E was enhanced during the later stage of viral infection of porcine epidemic diarrhea virus (PEDV), with the result that the translation level of ribosomal protein lateral stalk subunit RPLp2 increased, as did the RPLp2 interaction with the mRNA 5′UTR region of PEDV via association with eIF4E, which is essential for translating the viral mRNA of PEDV (19). Inhibitors targeting p-eIF4E are promising antiviral therapeutics, in that p-eIF4E facilitates the replication of a broad range of viruses, including coronaviruses (15–17, 20–22). Recently, Mnk kinase inhibitor eFT508 has been highlighted in treating SARS-CoV-2 infection (23).

PEDV, a member of Coronaviridae, causes high mortality in newborn piglets and has caused significant economic losses in the pig industry. Although our study showed that p-eIF4E regulated the selective translation of viral mRNA of PEDV (19), and small molecule inhibitors HHT and RAF265 reduced viral production by somewhat depressing the p-eIF4E level (21, 22), the detail and function of eIF4E phosphorylation in PEDV infection remain unclear. We saw, however, that in two rounds of tandem mass tag (TMT) relative quantitative proteomics, proteins regulated by p-eIF4E were mainly involved in the ECM-Receptor, focal adhesion, PI3K-Akt, and mTOR signaling pathways, which are associated with cell proliferation, adhesion, and migration (14, 19). Some host cell proteins involved in these pathways are related to efficient viral entry (24–26). In this study, therefore, we have focused on membrane-residential factors, which are involved in signal pathways’ sensitivity to the phosphorylation of eIF4E. We found that TSPAN3, CD63, and ITGB2 knock-down reduced viral entry, and they were significantly upregulated upon PEDV infection at 1 hpi. We also found that the phosphorylation of eIF4E was stimulated in the early stage of PEDV infection, and the entrance of PEDV into the mutant cells Vero-S209A was suppressed. Further studies showed that p-eIF4E regulates the translation of TSPAN3, CD63, and ITGB2 rather than their mRNA level. In addition, the phosphorylation of eIF4E was regulated by the ERK-MNK pathway in early PEDV infection. Here, we first found that p-eIF4E facilitated viral entry by regulating the selective expression of host mRNA. These findings expand our understanding of the dynamic phosphorylation of eIF4E during the viral life cycle of coronavirus.

MATERIALS AND METHODS

Cells, viruses, reagents, and antibodies

Vero E6, HEK293T, HCT-8, Huh7, and PK15 cells were obtained from American Type Culture Collection (ATCC) and Vero-S209A was generated by GenScript (Beijing, China), and they cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco Invitrogen, Carlsbad, CA, USA) supplemented with 5% or 10% fetal bovine serum (FBS) and antibiotics (100 U/mL penicillin and 100 mg/mL streptomycin) at 37°C in a humidified 5% CO2 incubator (all reagents obtained from Invitrogen, Carlsbad, CA, USA). PEDV strain CV777, human coronavirus OC43 (HCoV-OC43), transmissible gastroenteritis virus (TGEV), herpes simplex virus-1 (HSV-1) strain F, and vesicular stomatitis virus (VSV) strain Indiana were reproduced in Vero cells for 48 h. Pseudorabies virus (PRV) was produced in PK15 cells for 48 h. Rabbit monoclonal anti-p-eIF4E and Cell Counting Kit-8 (CCK8) kit were obtained from Abcam (Cambridge, MA, USA). Rabbit monoclonal anti-eIF4E, Mnk1, p-Mnk1, p38 MAPK, p-p38 MAPK, Erk1/2, and p-Erk1/2 were from Cell Signaling Technology (Danvers, MA, USA). Mouse monoclonal anti-GAPDH was from Proteintech (Rosemount, IL, USA). Mouse monoclonal anti-PEDV-N was from Alpha Diagnostic International (San Antonio, TX, USA). Rabbit polyclonal antibody anti-CD63, TSPAN3, CD9, and rabbit monoclonal anti-ITGB2 were from Abclonal (Wuhan, China). Mouse anti-coronavirus monoclonal antibody was from Santa Cruz. The pharmacological inhibitors eFT508, U0126, SB203580, and mouse EGF protein were from MedChemExpress (Monmouth Junction, NJ, USA). Annexin V- FITC/PI, Dead Cell Apoptosis kit was from Solarbio (Beijing, China). Lipofectamine RNAi MAX was from Invitrogen (CA, USA). One-Step gDNA Removal and cDNA Synthesis SuperMix was from TransGen Biotech (Beijing, China). SYBR green supermix was from Toyobo (Osaka, Japan). BCA kit was from Beyotime (Shanghai, China). Luciferase assay kit was from Promega (Madison, WI, USA).

Generation of eIF4E (S209A)-Vero (Vero-S209A) cells

Single-guide RNA (sgRNA) was designed to target the area near a specific site using the online CRISPR design tool (http://crispr.mit.edu/) to generate Vero-S209A cells, and a donor template containing the mutation site was designed. The sgRNA, donor template, and Cas9 plasmids were co-transfected into Vero E6 cells, and the cells were cultured in 96-well plates, 10 times diluted. The clones were picked via screening by a restriction endonuclease and identified by Sanger sequencing. Finally, the Ser was mutated to Ala at amino acid 209 of eIF4E, and pure Vero-S209A cell clone was cultured and cryopreserved. The sequences of sgRNA and the donor template were designed as follows: SgRNA: GCAGACACAGCTACTAAGAG (with 80.3% cleavage efficiency as analyzed using the online tool TIDE).

RNA interference (RNAi) and cell viability assay

Small interfering RNAs (siRNAs) targeting indicated genes and negative control (NC) siRNA were synthesized by GenePharma (Shanghai, China). The siRNA sequences are shown in Table S1 at https://doi.org/10.6084/m9.figshare.24970641. Cells grown to 60–70% confluence were transfected with siRNAs (final concentration of 100 nM) using Lipofectamine RNAi MAX. At 48 h post-transfection, the cells were used for subsequent experiments. Cell viability assay was determined by using CCK8 kit, according to the manufacturer’s protocol.

Total RNA extraction and quantitative real-time PCR

According to the manufacturer’s protocol, total RNA was extracted from cell culture using TRIzol reagent (Invitrogen, CA, USA), and reverse transcription was conducted using One-Step gDNA Removal and cDNA Synthesis SuperMix. From three independent experiments, transcription levels for different genes were calculated using a Bio-Rad PCR instrument (CA, USA) and the SYBR green supermix. The following primers were as shown in Table S2 at https://doi.org/10.6084/m9.figshare.24970641. The RNA levels of viral genes were normalized by GDAPH mRNA, and relative quantities (RQs) of mRNA accumulation were evaluated using the 2−ΔΔCt method.

In-cell western analysis for HCoV-OC43 viability

Twenty-four hours before HCoV-OC43 infection, human colon cancer cells (HCT-8) were inoculated into 96-well plate cells and cultured in RPMI 1640 medium containing 10% serum at 37°C, 5% CO2. After 30–50% growth, the cells were transfected with siRNA targeting genes TSPAN3, CD63, ITGB2, or siNC. After 70% growth, the cells were moved to a 33°C cell incubator until cell growth reached 80%. The supernatant of the culture medium was discarded, and the cells were washed with phosphate-buffered saline (PBS) three times. Then cells were infected with HCoV-OC43 at an MOI of 0.1 at 33°C for 2 h. Double-volume medium containing 4% serum was added to the cells to terminate infection. After 48 h, the supernatant of the culture medium was discarded, and the cells were washed with PBS. The cells were then mixed with paraformaldehyde for 15 min, treated with 0.4% Triton X-100 for 30 min, and incubated with mouse anti-coronavirus monoclonal antibody (1:800) at 4°C overnight. In the final step, the cells were washed with PBS three times, incubated with mouse fluorescence secondary antibody (1:800) for 1 h, and washed again with PBS three times. The Odyssey Infrared Imaging System (800 nm, LI-COR) was used to analyze virus viability.

Antibody blocking analysis

To determine whether antibodies against TSPAN3, CD63, ITGB2, and TNFRSF10B block viral binding to target cells, the cells were grown in six-well plates, and coated with rabbit polyclonal antibody anti-CD63, TSPAN3, TNFRSF10B, CD9, ITGB2 (diluted at 1:100), or rabbit antibody IgG for 1 h. Cells were then infected with viruses at MOI of 1 at 37°C for 2 h to allow viral entry, or at 4°C for 1 h to allow viral attachment. Cells were harvested for total RNA extraction and quantitative real-time PCR (qRT-PCR).

Western blot analysis

Cells were washed with ice-cold PBS, then lysed and harvested in Radio-Immunoprecipitation Assay buffer (RIPA buffer) in the presence of protease inhibitor cocktail. Protein concentrations were measured using a BCA kit (Beyotime, Shanghai, China), and separated by SDS-PAGE on 12.5% gels, then electroblotted onto polyvinylidene fluoride (PVDF) membrane. The membranes were incubated with the primary antibody overnight, and the blots were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 45 min at room temperature. Finally, the blots were exposed using an ECL detection system (Vazyme, China), and Western Blotting bands were quantified according to intensity using ImageJ software.

PEDV entry assay

To investigate the effect of the indicated proteins on the entry of PEDV, the cells were grown in six-well plates, transfected with siRNA targeting genes for 36 h, then infected with viruses at MOI of 0.1, 0.5, or 1 at 37°C for 2 h to allow viral entry, or at 4°C for 1 h to allow viral binding. The cells were harvested for total RNA extraction and quantitative real-time PCR.

Production of spike pseudotyped particles and virus entry assay

To produce PEDV-pp, HEK293T cells were cultured for 24 h in 10 cm plates and then transfected using Lipofectamine 2000. The plasmid DNA transfection mixture (1  mL) was composed of 15 µg of pNL-4.3-Luc-E−R− and 15 µg of pcDNA-PEDV-Spike. A non-enveloped lentivirus particle (Bald virus) was also generated as a negative control. At 16 h post-transfection, the medium was replaced with fresh media supplemented with 2% FBS. Supernatants containing PEDV-pp were typically harvested at 36–48  h after transfection and filtered through a syringe filter (0.22  µm) to remove any cell debris. PEDV-pp was used fresh or allocated and frozen at −80°C. SARS-CoV-2-pp and SARS-CoV-pp were constructed following the same method.

To conduct the virus entry assay, liver cancer cells (Huh7) were seeded in a 96-well plate. After 30–50% growth, the cells were transfected with siTSPAN3, siCD63, siITGB2, or siNC for 24 h, and infected with 100 µL of supernatant containing PEDV-pp, SARS-CoV-pp, or SARS-CoV-2-pp at 37°C for 48 h. After 48 h of transduction, the cells were lysed in 100 µL of passive lysis buffer and 50 µL lysate was incubated with 100 µL of luciferase assay substrate according to the manufacturer’s instructions (Promega, Madison, WI, USA). Two to four duplicated wells were used for each treatment for the coronavirus experiments.

In vivo experiment

Newborn SPF piglets that had not drunk colostrum were obtained and fed special milk to 3 days old. Then piglets were challenged with 105 TCID50 of PEDV or DMEM in 3 mL by adding it to the milk. They were humanely slaughtered at a given time, and the jejunum was obtained. The protein and mRNA levels of indicated genes were surveyed by Western Blot and qRT-PCR. There were three piglets in each group.

Statistical analysis

All assays were repeated three times, and all results were presented as the mean ± SD. Statistical analyses were performed using Prism Version 7.0 (GraphPad Software, La Jolla, CA, USA). Significance was determined by one-way analysis of variance (ANOVA) and two-way ANOVA with Dunnett’s multiple-comparison test. Partial correlation analyses were evaluated using an unpaired Student’s t test. For all analysis, P values of <0.05 were considered statistically significant (*P < 0.05; **P < 0.01; ***P < 0.001; ns P > 0.05).

RESULTS

Screened host factors of TSPAN3, CD63, ITGB2, and so on, were involved in the regulation of viral entry of coronaviruses

Our previous results identified 77 host factors, whose expression was enhanced upon PEDV infection and possibly dependent on the phosphorylation level of eIF4E. Here, through KEGG analysis, we observed that the differentially expressed proteins in the PEDV-infected Vero-S209A cells versus WT-Vero cells were mainly involved in the focal adhesion, PI3K-Akt, ECM-receptor, and mTOR signaling pathways (Fig. 1A). These pathways are associated with cell proliferation, adhesion, and migration, and can promote viral entry and spread (27, 28). We therefore selected 20-odd membrane-residential proteins, related to cell adhesion, migration, and the cytoskeleton, to detect their effects on the life cycle of PEDV. Indicated genes siRNA or negative control siNC were transfected into Vero cells. The expression efficiency was effectively suppressed, and no cytotoxic effects were observed (see Fig. S1A and B at https://doi.org/10.6084/m9.figshare.24970641). The results showed that the knock-down of CD63, TSPAN3, ITGB2, CD44, CFAP46, VAMP8, TNFRSF10B, and IQSEC1 reduced the levels of mRNA of PEDV-M and protein of PEDV-N (Fig. 1B and C).

Fig 1.

Fig 1

Open in a new tab

Host factors were screened and TSPAN3, CD63, and ITGB2 facilitated viral entry of coronavirus (A) . The analysis of differentially expressed proteins in PEDV-infected WT-Vero and S209A-Vero cells by KEGG pathway. (B and C) Vero cells were transfected with siRNAs targeting pointed genes or negative control siRNA (NC) for 36 h, then infected with PEDV at an MOI of 0.1 at 37°C for 24 h; the mRNA level was subjected to RT-qPCR analysis for PEDV-M normalized against GAPDH (B), and PEDV-N protein level was quantified by Western Blot analysis normalized against GAPDH (C). (D) Vero cells were transfected with siRNAs targeting specific genes or siNC for 36 h, and infected with PEDV at an MOI of 1 at 37°C for 2 h. After washing with PBS at least three times, the infected cells were harvested; the mRNA level was subjected to RT-qPCR analysis for PEDV-M normalized against GAPDH. (E) HCT-8 cells were transfected with siRNA targeting indicated genes TSPAN3, CD63, ITGB2, or siNC for 36 h, and the cells were infected with HCoV-OC43 at an MOI of 0.1 at 33°C for 2 h. After 48 h, the cells were incubated with mouse anti-coronavirus monoclonal antibody (diluted at 1:800, Santa Cruz) at 4°C overnight and then with mouse fluorescence secondary antibody (1:800) for 1 h. Finally, the Odyssey Infrared Imaging System (800 nm, LI-COR) was used to analyze virus viability. (F) Huh7 cells transfected with siTSPAN3, siCD63, siITGB2, or siNC for 36 h, then cells were transduced with PEDV-pp, SARS-CoV-pp, or SARS-CoV-2-pp. Forty-eight hours after transduction, the cells were lysed and incubated with luciferase assay substrate. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns showed no significant difference.

These proteins, such as highly rated CD63, TSPAN3, and ITGB2, as membrane proteins, are likely to participate in the stage of viral entry. Further results showed that 20–70% knockdown (see Fig. S1C at https://doi.org/10.6084/m9.figshare.24970641) of TSPAN3, CD63, ITGB2, CD44, and TNFRSF10B impaired the entrance of PEDV (Fig. 1D). Our previous study demonstrated that TNFRSF10B facilitates PEDV production by regulating viral entry and caspase-8-dependent apoptosis (29). CD44 has been reported in PEDV infection (30). To further determine the correlation of proteins TSPAN3, CD63, and ITGB2 with coronavirus invasion, in-cell western analysis and pseudovirus entry analysis were conducted. The result showed that depletion of TSPAN3, CD63, and ITGB2 decreased HCoV-OC43 infection by 30–40% upon gene knockdown efficacy of 20–50% (Fig. 1E; also see Fig. S1D at https://doi.org/10.6084/m9.figshare.24970641), and suppressed PEDV-pp entry efficiently in an siRNA-dose-dependent manner (Fig. 1F). Moreover, depletion of TSPAN3, CD63, and ITGB2 also prevented the entrance of SARS-CoV-pp and SARS-CoV-2-pp (Fig. 1F). TSPAN3 or ITGB2 depletion notably caused up to 80% inhibition of viral entry of coronavirus (Fig. 1F).

Phosphorylated eIF4E and downstream host factors facilitated PEDV early entry

Based on proteomics, the expression of the CD63, TSPAN3, and ITGB2 proteins may depend on phosphorylation levels of the eIF4E protein (19). But, the phosphorylated state of eIF4E was not reported in early infection of coronavirus, so Western Blot, qPCR, and mutant Vero-S209A cells were used to find out the relationship between eIF4E phosphorylation and coronavirus infection. The result showed that the eIF4E was hyperphosphorylated as early as 1 hpi with PEDV, and then the expression of p-eIF4E gradually decreased (Fig. 2A). Along with the stimulation of eIF4E, p-Mnk1 was also activated (Fig. 2A). Pre-treatment with eFT508, which inhibits eIF4E phosphorylation by targeting kinase Mnk1/2, was used to further confirm that the protein level of p-eIF4E was improved at the early stage of PEDV infection. As expected, the phosphorylation of eIF4E was significantly suppressed in mock-infected cells, and the protein level of p-eIF4E recovered to normal at 6 h after removal of eFT508 (Fig. 2B). However, PEDV infection suppressed the effect of eFT508 on MNK-eIF4E axis (Fig. 2B). In addition, we studied on the phosphorylation state of eIF4E in wild Vero cells and Vero-S209A cells after PEDV infection. The result demonstrates that PEDV infection does not stimulate the phosphorylation of eIF4E in Vero-S209A cells (see Fig. S1E at https://doi.org/10.6084/m9.figshare.24970641). These results indicate that early PEDV infection can induce the accumulation of p-eIF4E.

Fig 2.

Fig 2

Open in a new tab

The phosphorylation of eIF4E was stimulated at PEDV early entry. (A) Vero cells were mock-infected or infected with PEDV at MOI of 1, the cells were harvested at the set time, and the protein level was analyzed by Western Blot with the indicated antibodies. (B) Vero cells were pre-treated with eFT508 at a concentration of 10 µM for 1 h and washed by PBS solution for three times at different eFT508 removal times, and then cells were infected with PEDV at 37°C for 1 h, and the protein level was analyzed by Western Blot with the indicated antibodies. (C) PEDV at 1 MOI was treated with UV light for different times, and then were challenged to Vero cells at 37°C for 1 h, and the protein level was analyzed by Western Blot with the indicated antibodies. (D and E) Vero cells and mutant Vero-S209A cells were infected with PEDV at 37°C for 2 h to allow viral entry (D) or at 4°C for 1 h to just allow viral attachment (E), the mRNA level was subjected to RT-qPCR analysis for PEDV-M normalized against GAPDH. (F and G) Vero cells were treated with eFT508 at indicated viral post-infection time (−1 h indicates treatment with eFT508 1 h before viral infection), then eFT508 was removed by PBS washing or was not removed, and the cells were infected with 0.1 MOI of PEDV at 37°C for 24 h (F), or 1 MOI of PEDV at 37°C for 2 h (G), respectively; the protein level was analyzed by Western Blot with the indicated antibodies (F), and the mRNA level was subjected to RT-qPCR analysis for PEDV-M normalized against GAPDH (H). (H and I), Vero cells were grown in six-well plates, coated with rabbit polyclonal antibody anti-CD63, TSPAN3, TNFRSF10B, CD9, and ITGB2 (1:100), treated with rabbit antibody IgG for 1 h, and then infecGted with 1 MOI of PEDV at 37°C for 2 h to allow viral entry (H), or at 4°C for 1 h to allow viral attachment (I). Then the mRNA level was subjected to RT-qPCR analysis for PEDV-M normalized against GAPDH. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns showed no significant difference.

To determine the factors that induce eIF4E phosphorylation, we treated PEDV with UV inactivation. Vero cells were infected with inactivated-PEDV at 1 MOI at 37°C for 1 h, the phosphorylation of eIF4E still had been stimulated (Fig. 2C). These results suggest that the viral protein of PEDV mediated the activation of eIF4E phosphorylation in the early stage of viral infection.

Because the phosphorylation level of eIF4E was significantly enhanced in the early stage of viral infection, we proposed a hypothesis that eIF4E phosphorylation impacts viral entry. According to this hypothesis, Vero cells and mutant cells Vero-S209A were infected with PEDV at 37°C for 2 h to allow viral entry or at 4°C for 1 h to allow only viral binding to hosts. The result of RT-qPCR demonstrated that PEDV entry was significantly reduced in Vero-S209A cells, in which eIF4E cannot be phosphorylated (Fig. 2D). Further study showed the reduced viral attachment of PEDV in Vero-S209A cells (Fig. 2E). In addition, Vero cells were treated with eFT508 at different times (−1 h represents treatment with eFT508 1 h before viral infection), and then infected PEDV. The results indicate that pre-treatment with eFT508 can decrease the protein level of PEDV-N (Fig. 2F) and viral entry (Fig. 2G). The inhibitory effect of eFT508 on PEDV was lost, however, when viral infection and eFT508 treatment occurred at the same time (Fig. 2F and G). These results indicate that the phosphorylation of eIF4E facilitates PEDV early entry (Fig. 2D through G).

To determine whether antibodies against TSPAN3, CD63, and ITGB2 block viral binding to target cells, antibody-coated cells (1:100) were infected with PEDV at 37°Cfor 2 h or 4°C for 1 h. We found that the viral entry of PEDV was obviously blocked (Fig. 2H). We further found that TSPAN3, CD63, and ITGB2 were especially associated with attachment of PEDV (Fig. 2I).

The upregulation of host factors was associated with eIF4E phosphorylation in the early stage of PEDV infection

We saw that eIF4E phosphorylation improved PEDV binding to host cells, and that TSPAN3, CD63, and ITGB2, whose expression levels may be dependent on the phosphorylation level of eIF4E, also facilitate this process (Fig. 1 and 2). We therefore explored the relationship between p-eIF4E and these host factors. Vero cells and mutant cells Vero-S209A were infected with PEDV at 37°C for the indicated time. The result showed that the expression upregulation of proteins TSPAN3, CD63, and ITGB2 was more sensitive in Vero cells than in Vero-S209A cells in response to PEDV infection (Fig. 3A). In addition, we suggest that the depletion of individual protein TSPAN3, CD63, or ITGB2 also inhibited viral infection in mutant cells upon gene knockdown efficacy of 20–50% (see Fig. S1F at https://doi.org/10.6084/m9.figshare.24970641) without observed cytotoxic effects (see Fig. S1G at https://doi.org/10.6084/m9.figshare.24970641). This is consistent with the results in wild-type Vero cells (Fig. 1B, C and 3B).

Fig 3.

Fig 3

Open in a new tab

eIF4E phosphorylation-sensitive host factors whom expression was upregulated upon PEDV entry. (A) Vero cells and mutant Vero-S209A cells were infected with 0.1 MOI of PEDV at 37°C for the indicated time, and the protein level was analyzed by Western Blot with the indicated antibodies. (B) Vero-S209A cells were transfected with siTSPAN3, siCD63, siITGB2, or siNC for 36 h, then infected with PEDV at an MOI of 0.1 at 37°C for 24 h; the mRNA level was subjected to RT-qPCR analysis for PEDV-M normalized against GAPDH. (C and D) Vero cells were mock-infected or infected with PEDV at MOI of 1, the cells were harvested at indicated time; the protein level was analyzed by Western Blot with the indicated antibodies (C), the mRNA level was subjected to RT-qPCR analysis for indicated genes normalized against GAPDH (D). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns showed no significant difference.

Subsequently, we characterized the spatial expression of protein and mRNA levels of these host factors in response to viral infection. Vero cells were infected with PEDV for the indicated time. The results showed that the protein levels of TSPAN3, CD63, and ITGB2 were significantly upregulated at the early step of viral entry and reached peak at 1 hpi, consistent with the state of p-eIF4E (Fig. 3C). The tendencies of the mRNA levels of TSPAN3, CD63, and ITGB2 were similar to their protein levels (Fig. 3D). These results demonstrate that p-eIF4E may regulate the expression of TSPAN3, CD63, and ITGB2 (Fig. 3).

The changes in the phosphorylation state regulated the expression of TSPAN3, CD63, and ITGB2 at translation level but not at transcription level

To further investigate the effect of p-eIF4E on the expression of TSPAN3, CD63, and ITGB2, eIF4E phosphorylation inhibitor eFT508 and activator EGF (epidermal growth factor) were used. Vero cells were treated with eFT508 with or without PEDV challenge. The accumulation of TSPAN3 and CD63 was repressed in cells at 1 h after eFT508 treatment (Fig. 4A). After that, the protein levels of TSPAN3 and CD63 recovered to close to their normal levels, while ITGB2 remained unchanged (Fig. 4A). The mRNA levels of TSPAN3, CD63, and ITGB2 were unaffected by treatment with eFT508 at all indicated times (Fig. 4B). Moreover, removal of eFT508 contributed to the recovery of TSPAN3 and CD63, but did not affect ITGB2 (Fig. 4C). Figure 4A through C indicate together that the upregulated expression of TSPAN3, CD63, and ITGB2 occurs at the translation level.

Fig 4.

Fig 4

Open in a new tab

PEDV infection increased the translation level of host factors in a p-eIF4E-dependent manner. (A and B) Vero cells were treated with eFT508 at a concentration of 10 µM, the cells were harvested at indicated time; the protein level was analyzed by Western Blot with the indicated antibodies (A), the mRNA level was subjected to RT-qPCR analysis for indicated genes normalized against GAPDH (B). (C) Vero cells were treated with eFT508 at a concentration of 10 µM at 37°C for 1 h, then eFT508 was removed by PBS washing, the cells were harvested at the indicated time, and the protein level was analyzed by Western Blot with the indicated antibodies. (D) Vero cells were mock-infected or infected with 1 MOI of PEDV in the presence or absence of 10 µM eFT508 at 37°C for 1 h, the protein level was analyzed by Western Blot with the indicated antibodies. (E) Vero cells were mock-infected or infected with 1 MOI of PEDV in the presence or absence of 10 µg EGF at 37°C for 1 h, and the protein level was analyzed by Western Blot with the indicated antibodies. (F) Vero cells were challenged with PEDV (1 MOI) or UV-inactive PEDV at 37°C for 1 h, and the protein level was analyzed by Western Blot with the indicated antibodies.

Vero cells were infected with PEDV in the presence or absence of eFT508. We found that PEDV infection caused the upregulation of TSPAN3, CD63, and ITGB2, and eFT508 decreased the expression of these host factors; this agrees with the results above. After PEDV infection, the upregulation of expression of these proteins was partly suppressed by treatment with eFT508 (Fig. 4D). At 1 h post-treatment with EGF, moreover, the expression of proteins TSPAN3, CD63, and ITGB2 and the levels of p-eIF4E were effectively increased, while eIF4E remained unaffected (Fig. 4E). However, EGF treatment did not further enhance the upregulation of these factors upon viral infection (Fig. 4E). In addition, UV-inactivated PEDV also caused the upregulation of expression of these proteins (Fig. 4F). These results demonstrate that upregulation of TSPAN3, CD63, and ITGB2 by PEDV infection is to some extent dependent on eIF4E phosphorylation.

Spatial expression of host factors during PEDV infection in piglets

We surveyed these host factors' protein and mRNA levels in PEDV-infected piglets. In this study, porcine aminopeptidase N (pAPN) was used as a control, although we note that it is a controversial functional PEDV receptor. Three-day-old piglets were challenged with PEDV at different times, and then humanely killed. We found that the expression of TSPAN3, CD63, and ITGB2 was significantly increased at 3 hpi in the jejunum of piglets (Fig. 5A), in accordance with the mRNA level. The eIF4E was also phosphorylated slightly. In comparison, the mRNA level of pAPN significantly increased at 3 hpi, and then decreased to a normal level (Fig. 5B).

Fig 5.

Fig 5

Open in a new tab

Spatial expression of host factors upon viral infection in piglets. (A and B) Piglets were challenged with 105 TCID50 PEDV or DMEM in 3 mL for different times, the jejunum was obtained, the protein level was analyzed by Western Blot with the indicated antibodies (A), and mRNA level of pointed genes was analyzed by RT-qPCR normalized against GAPDH (B).

The ERK-MNK pathway might be responsible for the stimulation of eIF4E phosphorylation

The p38 MAP kinase and Erk1/2 signaling pathways, upstream of Mnk1, are responsible for the regulation of eIF4E phosphorylation. To determine the kinases related to eIF4E phosphorylation in response to PEDV infection, Vero cells were infected with PEDV in the presence of U0126 (Erk upstream target Mek1/2 inhibitor) or SB203580 (a p38 inhibitor, which inhibits p38 catalytic activity by competing with ATP for its binding site, but does not inhibit phosphorylation of p38). As with the results above, Mnk1 phosphorylation at Thr197/202 was significantly enhanced at 1 hpi (Fig. 2A, 5B and 6A). Upstream of Mnk1, both p38 and Erk exhibited increased phosphorylation, which indicated that two kinases are required for Mnk1 activation in PEDV-infected cells (Fig. 6A). In addition, U0126 and SB203580 treatment led to significant depression in Mnk1 phosphorylation (Fig. 6A and B). However, treatment with U0126 suppressed the phosphorylation of eIF4E in PEDV-infected Vero cells (Fig. 6A), while SB203580 did not (Fig. 6B). These results indicate that the activation of Erk rather than p38 is required for early infection-mediated phosphorylation of eIF4E, even though both of them are in fact activated.

Fig 6.

Fig 6

Open in a new tab

The stimulation of the ERK-MNK pathway and the upregulation of downstream host factors at the early stage of PEDV infection. (A and B) Vero cells were mock-infected or infected with 1 MOI of PEDV in the presence or absence of 10 µM U0126 (A) and 10 µM SB203580 (B) at 37°C for 1 h, the protein level was analyzed by Western Blot with the indicated antibodies. (C) PK15 cells were infected with TGEV at an MOI of 1 at 37°C, the cells were harvested at the indicated time, and the protein level was analyzed by Western Blot with the indicated antibodies. (D–F) Vero cells were infected with HCoV-OC43 (D), PRV (E), or HSV-1 (F) at an MOI of 1 at 37°C for 1 h, respectively, the cells were harvested at indicated time and the protein level was analyzed by Western Blot with the indicated antibodies. (G) Schematic diagram of coronavirus PEDV utilizing ERK-MNK-eIF4E pathway and downstream membrane-residential proteins for effective viral entry. Early PEDV infection activates kinase Erk resulting in the phosphorylation of kinase Mnk, and eIF4E. As a consequence, the stimulation of phosphorylated eIF4E modulates the up-expression of TSPAN3, CD63, and ITGB2 in TEMs platform, to facilitate viral attachment and entry of coronavirus PEDV.

In order to explore whether eIF4E phosphorylation appeared during early infection by other viruses, Vero cells were individually infected with HCoV-OC43, PRV, or HSV-1, while PK15 cells were infected with TGEV for indicated times. We identified that viral early infection also induces transient phosphorylation of eIF4E of TGEV, HCoV-OC43, and HSV-1 (Fig. 6C, D and F). The phosphorylation of eIF4E was reduced upon PRV infection, because of both enhanced eIF4E and decreased p-eIF4E (Fig. 6E). We suggest that the virological function of eIF4E phosphorylation is not limited to the entry of coronavirus.

DISCUSSION

Coronavirus PEDV, which occurs around the world, has caused serious problems and great economic losses to the swine industry. The highly pathogenic variant strain reported in 2010 in China causes up to 100% mortality in newborn piglets (31). Although there are no reports of PEDV infections in humans, live virion could infect Huh7 human cells and monkey kidney-derived Vero cell lines efficiently, and this suggests the risk of the potential dissemination of PEDV from swine to humans (32). There are, as yet, no effective vaccines or specific drugs are available to treat PEDV (33). In this study, we provided the first evidence that p-eIF4E significantly facilitates PEDV early entry. This finding suggests that mechanisms to decrease viral susceptibility may be an alternative candidate target for the design of antiviral agents (Fig. 2). We found that the phosphorylation of eIF4E was stimulated not only in early infection by coronavirus PEDV, TGEV, and HCoV-OC43, but also in early infection of herpesvirus HSV-1 (Fig. 2 and 6). Further research indicates that p-eIF4E controls the expression of viral entry-involved proteins TSPAN3, CD63, and ITGB2 (Fig. 4). Moreover, TSPAN3, CD63 and ITGB2 promote the entrance of SARS-CoV-pp and SARS-CoV-2-pp (Fig. 1). Our findings provide evidence that p-eIF4E facilitates viral entry by regulating the selective translation of host mRNAs, which are related to membrane-residential proteins.

eIF4E phosphorylation is not required for normal cells, but is important for the progression of cancer (12, 34). p-eIF4E modulates the selective translation rate of mRNAs without corresponding changes in the mRNA abundance (35). It has been reported that phosphorylation of eIF4E enforces the expression of E2F1, FOXM1, WEE1, IFN-γ, and TNF-α in tumor cells (14, 36–38). Our recent research suggests that loss of eIF4E phosphorylation in Vero cells does not impair cell proliferation and global cellular translation (19), which agrees with previous studies (12, 14). The current study indicated that p-eIF4E regulates the expression of TSPAN3, CD63, and ITGB2 at translation level, but not at transcription level, at early stage of PEDV infection process (Fig. 4). Phospho-eIF4E showed a transient increase at 24 hpi in DENV infection, and 6 hpi in NDV, HSV-1, and MNV1 infection (15–17, 39). Phosphorylation of eIF4E is essential for the effective replication of several viruses. Phosphorylated eIF4E relocates to the polysomes, which contributes to changes in the translational state of specific host mRNAs, so it is important for MNV1 replication (16). Enhancing p-eIF4E has been found to upregulate host cap-dependent translation machinery and benefit efficient viral protein synthesis via interaction between viral NP protein and eIF4E in NDV infection (15). We have previously reported that the phosphorylation of eIF4E facilitates the effective viral replication of PEDV (19, 22, 40); the phenomenon of p-eIF4E-enhanced viral entry has been detected in this study. In addition, we found that the ERK-MNK pathway is responsible for eIF4E phosphorylation during PEDV infection (Fig. 6). It should be noted that p-eIF4E is not always upregulated, and an abrupt reduction of p-eIF4E was observed at 3 hpi in VSV infection (18). Here, we also found a decrease of p-eIF4E upon PRV infection (Fig. 6E). The effect of the ERK-MNK-eIF4E pathway on viral entry might appear in pan-coronavirus, but was not evident in other, unrelated viruses.

Tetraspanins, a family of transmembrane glycoproteins, consist of four transmembrane regions, which allows them to establish a platform called tetraspanin-enriched microdomains (TEMs) (41). TEMs are more flexible and can interact with various partner proteins, including adhesion molecules, laminin-binding integrins, and other tetraspanin family members (42). Research has shown that tetraspanins are needed in both non-enveloped and enveloped viruses through multiple stages of viral infection (25). Our study found that TSPAN3, CD63 as well as ITGB2 facilitated the early entry of PEDV, and even SARS-CoV-pp and SARS-CoV-2-pp entrance (Fig. 1D and F). These results suggest that TSPAN3, CD63, and ITGB2, as a part of TEM platform, to facilitate the entry of coronaviruses.

Research on how CoVs utilize TEMs for receptor-mediated endocytosis and membrane fusion have been reported (43–45). The TEMs, enriched with CD9, CD63, and CD81, contain protease fusion activator TMPRSS2, and CoV receptors APN, ACE2, DPP4, and MHV receptor CEACAM (43). Tetraspanin antibodies anti-CD9, anti-CD63, and anti-CD81 inhibit CoV MHV and IAV entry, and decrease pseudovirus SARS-CoV-pp, MERS-CoV-pp, and hCoV-229E-pp transduction (43). Further study showed that CD9-, but not CD81-enriched microdomains formed cell-surface complex DPP4-TMPRSS2, facilitating the rapid and efficient entry of MERS-CoV pseudovirus (44). Tetraspanins have a variety of virus-specific consequences; the blocking of tetraspanin CD9 on exosomes was shown to limit exosomal endocytosis in DCs, causing a drop in HIV-1 infection (24). It was also shown that CD63 is specifically involved in HIV-1 entry pathways that are facilitated by viral co-receptor CCR5 (46). Here, we found that antibodies against TSPAN3 and CD63 inhibited the attachment of CoV PEDV, while antibodies against CD9 suppressed viral post-attachment stage (Fig. 2G and H). To our knowledge, this is the first virological report on TSPAN3. Although CD63 and CD9 have been shown not to affect MERS-CoV-pp attachment to the entry receptor, it is unsurprising that CD63 facilitated PEDV attachment.

Integrins, consisting of α/β-subunits, are cell adhesion molecules. They are heterodimeric transmembrane proteins and are involved in signal transduction from the extracellular to intracellular, as well as from cell to cell (47). They play important roles in cellular proliferation, migration, and adhesion (48). Research has shown that integrins facilitate the attachment and entry of various viruses as receptor or co-receptor: β1 subtypes for HCMV, αVβ6 and αVβ8 integrins for FMDV, EBV, and HSV-1, αVβ3 for SARS-CoV-2 and rotaviruses (26, 49–51). In this study, we found that β2 subtype ITGB2 improved the attachment of PEDV to the host, and ITGB2 knock-down inhibited the entrance of SARS-CoV-pp and SARS-CoV-2-pp (Fig. 1F). ITGB2, also known as CD18, commonly couples to integrin α subunit αM-CD11b to form complement receptor 3 (CR3). Although CR3 is not a member of the group consisting of integrins α5β1, αVβ1, αVβ3, αVβ5, αVβ6, αVβ8, αIIbβ3, and α8β1, which are famous for recognizing the RGD motif (a characteristic of viral protein involved entry), it has been shown that CR3 mediated HIV-1 adheres to host cells (26, 47, 52). Further study would be meaningful to clarify the relationship between ITGB2 and CD11b in PEDV infection.

In any case, it is interesting that p-eIF4E promotes viral invasion of PEDV by regulating the expression of membrane-residential factors TSPAN3, CD63, and ITGB2. Some details will require further study, such as whether these host factors are the function receptor or principal component in receptor complex, and the relationship among these proteins and the viral proteins involved in viral entry. Noting that the function receptor of PEDV remains controversial, we suggest the possibility of finding viral receptors by utilizing TSPAN3, CD63, and ITGB2 in TEMs platform.

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (32172821), the National Key R&D Program of China (2023YFD1801100), the Hainan Province Science and Technology Special Fund (ZDYF2024XDNY196), and a CAU Grant for the Prevention and Control of Immunosuppressive Disease in Animals of the China Agricultural University.

Contributor Information

Xiao-Jing Chi, Email: chixiaojing@ipbcams.ac.cn.

Xiao-Jia Wang, Email: wangxj@cau.edu.cn.

Shan-Lu Liu, The Ohio State University, Columbus, Ohio, USA.

ETHICS APPROVAL

All animal research projects were sanctioned by the Beijing Laboratory Animal Welfare and Ethics Committee and were approved by the Animal Ethics Committee of China Agricultural University (approval number 201206078) and were performed in accordance with the Regulations of Experimental Animals of Beijing Authority. Animals were housed in a pathogen-free environment with access to standard food and water under 12 h light cycle conditions.

To reduce stress on other animals, and to avoid panic in living animals, euthanasia was carried out in a soundproof room.

REFERENCES

  • 1. Ménager MM, Littman DR. 2016. Actin dynamics regulates dendritic cell-mediated transfer of HIV-1 to T cells. Cell 164:695–709. doi: 10.1016/j.cell.2015.12.036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Lee C. 2015. Porcine epidemic diarrhea virus: an emerging and re-emerging epizootic swine virus. Virol J 12:193. doi: 10.1186/s12985-015-0421-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Klausegger A, Strobl B, Regl G, Kaser A, Luytjes W, Vlasak R. 1999. Identification of a coronavirus hemagglutinin-esterase with a substrate specificity different from those of influenza C virus and bovine coronavirus. J Virol 73:3737–3743. doi: 10.1128/JVI.73.5.3737-3743.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. de Breyne S, Vindry C, Guillin O, Condé L, Mure F, Gruffat H, Chavatte L, Ohlmann T. 2020. Translational control of coronaviruses. Nucleic Acids Res 48:12502–12522. doi: 10.1093/nar/gkaa1116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Abdelrahman Z, Li M, Wang X. 2020. Comparative review of SARS-CoV-2, SARS-CoV, MERS-CoV, and influenza A respiratory viruses. Front Immunol 11:552909. doi: 10.3389/fimmu.2020.552909 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Fehr AR, Perlman S. 2015. Coronaviruses: an overview of their replication and pathogenesis. Methods Mol Biol 1282:1–23. doi: 10.1007/978-1-4939-2438-7_1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Gingras AC, Raught B, Sonenberg N. 1999. eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu Rev Biochem 68:913–963. doi: 10.1146/annurev.biochem.68.1.913 [DOI] [PubMed] [Google Scholar]
  • 8. Richter JD, Sonenberg N. 2005. Regulation of cap-dependent translation by eIF4E inhibitory proteins. Nature 433:477–480. doi: 10.1038/nature03205 [DOI] [PubMed] [Google Scholar]
  • 9. Joshi B, Cai AL, Keiper BD, Minich WB, Mendez R, Beach CM, Stepinski J, Stolarski R, Darzynkiewicz E, Rhoads RE. 1995. Phosphorylation of eukaryotic protein synthesis initiation factor 4E at Ser-209. J Biol Chem 270:14597–14603. doi: 10.1074/jbc.270.24.14597 [DOI] [PubMed] [Google Scholar]
  • 10. Morley SJ. 1997. Intracellular signalling pathways regulating initiation factor eIF4E phosphorylation during the activation of cell growth. Biochem Soc Trans 25:503–509. doi: 10.1042/bst0250503 [DOI] [PubMed] [Google Scholar]
  • 11. Herdy B, Jaramillo M, Svitkin YV, Rosenfeld AB, Kobayashi M, Walsh D, Alain T, Sean P, Robichaud N, Topisirovic I, Furic L, Dowling RJO, Sylvestre A, Rong L, Colina R, Costa-Mattioli M, Fritz JH, Olivier M, Brown E, Mohr I, Sonenberg N. 2012. Translational control of the activation of transcription factor NF-kappaB and production of type I interferon by phosphorylation of the translation factor eIF4E. Nat Immunol 13:543–550. doi: 10.1038/ni.2291 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Furic L, Rong L, Larsson O, Koumakpayi IH, Yoshida K, Brueschke A, Petroulakis E, Robichaud N, Pollak M, Gaboury LA, Pandolfi PP, Saad F, Sonenberg N. 2010. eIF4E phosphorylation promotes tumorigenesis and is associated with prostate cancer progression. Proc Natl Acad Sci U S A 107:14134–14139. doi: 10.1073/pnas.1005320107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Hay N. 2010. Mnk earmarks eIF4E for cancer therapy. Proc Natl Acad Sci U S A 107:13975–13976. doi: 10.1073/pnas.1008908107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Amorim IS, Kedia S, Kouloulia S, Simbriger K, Gantois I, Jafarnejad SM, Li Y, Kampaite A, Pooters T, Romanò N, Gkogkas CG. 2018. Loss of eIF4E phosphorylation engenders depression-like behaviors via selective mRNA translation. J Neurosci 38:2118–2133. doi: 10.1523/JNEUROSCI.2673-17.2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Zhan Y, Yu S, Yang S, Qiu X, Meng C, Tan L, Song C, Liao Y, Liu W, Sun Y, Ding C, Perez DR. 2020. Newcastle disease virus infection activates PI3K/Akt/mTOR and p38 MAPK/Mnk1 pathways to benefit viral mRNA translation via interaction of the viral NP protein and host eIF4E. PLoS Pathog 16:e1008610. doi: 10.1371/journal.ppat.1008610 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Royall E, Doyle N, Abdul-Wahab A, Emmott E, Morley SJ, Goodfellow I, Roberts LO, Locker N. 2015. Murine norovirus 1 (MNV1) replication induces translational control of the host by regulating eIF4E activity during infection. J Biol Chem 290:4748–4758. doi: 10.1074/jbc.M114.602649 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Walsh D, Mohr I. 2004. Phosphorylation of eIF4E by Mnk-1 enhances HSV-1 translation and replication in quiescent cells. Genes Dev 18:660–672. doi: 10.1101/gad.1185304 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Connor JH, Lyles DS. 2002. Vesicular stomatitis virus infection alters the eIF4F translation initiation complex and causes dephosphorylation of the eIF4E binding protein 4E-BP1. J Virol 76:10177–10187. doi: 10.1128/jvi.76.20.10177-10187.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Dong H-J, Wang J, Zhang X-Z, Li C-C, Liu J-F, Wang X-J. 2023. Proteomic screening identifies RPLp2 as a specific regulator for the translation of coronavirus. Int J Biol Macromol 230:123191. doi: 10.1016/j.ijbiomac.2023.123191 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Montero H, García-Román R, Mora SI. 2015. eIF4E as a control target for viruses. Viruses 7:739–750. doi: 10.3390/v7020739 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Li C-C, Chi X-J, Wang J, Potter AL, Wang X-J, Yang C-FJ. 2023. Small molecule RAF265 as an antiviral therapy acts against HSV-1 by regulating cytoskeleton rearrangement and cellular translation machinery. J Med Virol 95:e28226. doi: 10.1002/jmv.28226 [DOI] [PubMed] [Google Scholar]
  • 22. Wang J, Tian W-J, Li C-C, Zhang X-Z, Fan K, Li S-L, Wang X-J. 2022. Small-molecule RAF265 as an antiviral therapy acts against PEDV infection. Viruses 14:2261. doi: 10.3390/v14102261 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Gordon DE, Jang GM, Bouhaddou M, Xu J, Obernier K, White KM, O’Meara MJ, Rezelj VV, Guo JZ, Swaney DL, et al. 2020. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature 583:459–468. doi: 10.1038/s41586-020-2286-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Sims B, Farrow AL, Williams SD, Bansal A, Krendelchtchikov A, Matthews QL. 2018. Tetraspanin blockage reduces exosome-mediated HIV-1 entry. Arch Virol 163:1683–1689. doi: 10.1007/s00705-018-3737-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. New C, Lee Z-Y, Tan KS, Wong A-P, Wang DY, Tran T. 2021. Tetraspanins: host factors in viral infections. Int J Mol Sci 22:11609. doi: 10.3390/ijms222111609 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Bugatti A, Filippini F, Bardelli M, Zani A, Chiodelli P, Messali S, Caruso A, Caccuri F. 2022. SARS-CoV-2 infects human ACE2-negative endothelial cells through an αvβ3 integrin-mediated endocytosis even in the presence of vaccine-elicited neutralizing antibodies. Viruses 14:705. doi: 10.3390/v14040705 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Luganini A, Serra V, Scarpellino G, Bhat SM, Munaron L, Fiorio Pla A, Gribaudo G. 2023. The US21 viroporin of human cytomegalovirus stimulates cell migration and adhesion. mBio 14:e0074923. doi: 10.1128/mbio.00749-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Rivera-Caraballo KA, Nair M, Lee TJ, Kaur B, Yoo JY. 2022. The complex relationship between integrins and oncolytic herpes simplex virus 1 in high-grade glioma therapeutics. Mol Ther Oncolytics 26:63–75. doi: 10.1016/j.omto.2022.05.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Zhang XZ, Tian WJ, Wang J, You JL, Wang XJ. 2022. Death receptor DR5 as a proviral factor for viral entry and replication of coronavirus PEDV. Viruses 14:2724. doi: 10.3390/v14122724 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Li Y, Li J, Wang X, Wu Q, Yang Q. 2021. Role of intestinal extracellular matrix-related signaling in porcine epidemic diarrhea virus infection. Virulence 12:2352–2365. doi: 10.1080/21505594.2021.1972202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Sun RQ, Cai RJ, Chen YQ, Liang PS, Chen DK, Song CX. 2012. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerg Infect Dis 18:161–163. doi: 10.3201/eid1801.111259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Wang J, Deng F, Ye G, Dong W, Zheng A, He Q, Peng G. 2016. Comparison of lentiviruses pseudotyped with S proteins from coronaviruses and cell tropisms of porcine coronaviruses. Virol Sin 31:49–56. doi: 10.1007/s12250-015-3690-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Li Z, Ma Z, Li Y, Gao S, Xiao S. 2020. Porcine epidemic diarrhea virus: molecular mechanisms of attenuation and vaccines. Microb Pathog 149:104553. doi: 10.1016/j.micpath.2020.104553 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Ueda T, Watanabe-Fukunaga R, Fukuyama H, Nagata S, Fukunaga R. 2004. Mnk2 and Mnk1 are essential for constitutive and inducible phosphorylation of eukaryotic initiation factor 4E but not for cell growth or development. Mol Cell Biol 24:6539–6549. doi: 10.1128/MCB.24.15.6539-6549.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Piccirillo CA, Bjur E, Topisirovic I, Sonenberg N, Larsson O. 2014. Translational control of immune responses: from transcripts to translatomes. Nat Immunol 15:503–511. doi: 10.1038/ni.2891 [DOI] [PubMed] [Google Scholar]
  • 36. Gao J, Teng L, Yang S, Huang S, Li L, Zhou L, Liu G, Tang H. 2021. MNK as a potential pharmacological target for suppressing LPS-induced acute lung injury in mice. Biochem Pharmacol 186:114499. doi: 10.1016/j.bcp.2021.114499 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Bartish M, Tong D, Pan Y, Wallerius M, Liu H, Ristau J, de Souza Ferreira S, Wallmann T, van Hoef V, Masvidal L, Kerzel T, Joly A-L, Goncalves C, Preston SEJ, Ebrahimian T, Seitz C, Bergh J, Pietras K, Lehoux S, Naldini L, Andersson J, Squadrito ML, Del Rincón SV, Larsson O, Rolny C. 2020. MNK2 governs the macrophage antiinflammatory phenotype. Proc Natl Acad Sci U S A 117:27556–27565. doi: 10.1073/pnas.1920377117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Ke X-Y, Chen Y, Tham V-Y, Lin R-T, Dakle P, Nacro K, Puhaindran ME, Houghton P, Pang A, Lee VK, Ding L-W, Gery S, Hill J, Chen L, Xu L, Koeffler HP. 2021. MNK1 and MNK2 enforce expression of E2F1, FOXM1, and WEE1 to drive soft tissue sarcoma. Oncogene 40:1851–1867. doi: 10.1038/s41388-021-01661-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Roth H, Magg V, Uch F, Mutz P, Klein P, Haneke K, Lohmann V, Bartenschlager R, Fackler OT, Locker N, Stoecklin G, Ruggieri A, Buchmeier MJ. 2017. Flavivirus infection uncouples translation suppression from cellular stress responses. mBio 8:e02150-16. doi: 10.1128/mBio.02150-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Dong H-J, Wang Z-H, Meng W, Li C-C, Hu Y-X, Zhou L, Wang X-J. 2018. The natural compound homoharringtonine presents broad antiviral activity in vitro and in vivo. Viruses 10:601. doi: 10.3390/v10110601 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Hemler ME. 2005. Tetraspanin functions and associated microdomains. Nat Rev Mol Cell Biol 6:801–811. doi: 10.1038/nrm1736 [DOI] [PubMed] [Google Scholar]
  • 42. Hemler ME. 2003. Tetraspanin proteins mediate cellular penetration, invasion, and fusion events and define a novel type of membrane microdomain. Annu Rev Cell Dev Biol 19:397–422. doi: 10.1146/annurev.cellbio.19.111301.153609 [DOI] [PubMed] [Google Scholar]
  • 43. Earnest JT, Hantak MP, Park JE, Gallagher T. 2015. Coronavirus and influenza virus proteolytic priming takes place in tetraspanin-enriched membrane microdomains. J Virol 89:6093–6104. doi: 10.1128/JVI.00543-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Earnest JT, Hantak MP, Li K, McCray PB, Perlman S, Gallagher T. 2017. The tetraspanin CD9 facilitates MERS-coronavirus entry by scaffolding host cell receptors and proteases. PLoS Pathog 13:e1006546. doi: 10.1371/journal.ppat.1006546doi:28759649 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Malla R, Kamal MA. 2022. Tetraspanin-enriched microdomain containing CD151, CD9, and TSPAN 8 - potential mediators of entry and exit mechanisms in respiratory viruses including SARS-CoV-2. Curr Pharm Des 28:3649–3657. doi: 10.2174/1381612828666220907105543 [DOI] [PubMed] [Google Scholar]
  • 46. Li G, Endsley MA, Somasunderam A, Gbota SL, Mbaka MI, Murray JL, Ferguson MR. 2014. The dual role of tetraspanin CD63 in HIV-1 replication. Virol J 11:23. doi: 10.1186/1743-422X-11-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Mrugacz M, Bryl A, Falkowski M, Zorena K. 2021. Integrins: an important link between angiogenesis, inflammation and eye diseases. Cells 10:1703. doi: 10.3390/cells10071703 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Ludwig BS, Kessler H, Kossatz S, Reuning U. 2021. RGD-binding integrins revisited: how recently discovered functions and novel synthetic ligands (re-)shape an ever-evolving field. Cancers (Basel) 13:1711. doi: 10.3390/cancers13071711 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Zárate S, Romero P, Espinosa R, Arias CF, López S. 2004. VP7 mediates the interaction of rotaviruses with integrin alphavbeta3 through a novel integrin-binding site. J Virol 78:10839–10847. doi: 10.1128/JVI.78.20.10839-10847.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Tomassi S, D’Amore VM, Di Leva FS, Vannini A, Quilici G, Weinmüller M, Reichart F, Amato J, Romano B, Izzo AA, Di Maro S, Novellino E, Musco G, Gianni T, Kessler H, Marinelli L. 2021. Halting the spread of herpes simplex virus-1: the discovery of an effective dual alphavbeta6/alphavbeta8 integrin ligand. J Med Chem 64:6972–6984. doi: 10.1021/acs.jmedchem.1c00533 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Harvey Y, Jackson B, Carr BV, Childs K, Moffat K, Freimanis G, Tennakoon C, Juleff N, Seago J. 2022. An improved alphavbeta6-receptor-expressing suspension cell line for foot-and-mouth disease vaccine production. Viruses 14:621. doi: 10.3390/v14030621 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Day CJ, Hardison RL, Spillings BL, Poole J, Jurcisek JA, Mak J, Jennings MP, Edwards JL. 2022. Complement receptor 3 mediates HIV-1 transcytosis across an intact cervical epithelial cell barrier: new insight into HIV transmission in women. mBio 13:e0217721. doi: 10.1128/mbio.02177-21 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES