Skip to main content
Respiratory Research logoLink to Respiratory Research
. 2005 Apr 13;6(1):34. doi: 10.1186/1465-9921-6-34

Titanium dioxide particle – induced goblet cell hyperplasia : association with mast cells and IL-13

Mi-Hyun Ahn 1, Chun-Mi Kang 1, Choon-Sik Park 1,✉, Sang-Jun Park 1, Taiyoun Rhim 1, Pyeong-Oh Yoon 1, Hun Soo Chang 1, Soo-Ho Kim 1, Hiroko Kyono 2, Kwang Chul Kim 3
PMCID: PMC1087883  PMID: 15829015

Abstract

Background

Inhalation of particles aggravates respiratory symptoms including mucus hypersecretion in patients with chronic airway disease and induces goblet cell hyperplasia (GCH) in experimental animal models. However, the underlying mechanisms remain poorly understood.

Methods

To understand this, the numbers of goblet cells, Muc5ac (+) expressing epithelial cells and IL-13 expressing mast cells were measured in the trachea of sham or TiO2 particles – treated rats using periodic acid-Schiff, toluidine blue and immunohistochemical staining. RT-PCR for Muc-1, 2 and 5ac gene transcripts was done using RNA extracted from the trachea. Differential cell count and IL-13 levels were measured in bronchoalveolar lavage (BAL) fluid. In pretreatment groups, cyclophosphamide (CPA) or dexamethasone (DEX) was given before instillation of TiO2. TiO2 treatment markedly increased Muc5ac mRNA expression, and Muc5ac (+) or PAS (+) epithelial cells 48 h following treatment.

Results

The concentration of IL-13 in BAL fluids was higher in TiO2 treated – rats when compared to those in sham rats (p < 0.05). Pretreatment with cyclophosphamide (CPA) decreased the number of neutrophils and eosinophils in BAL fluid of TiO2 treated – rats (p < 0.05), but affected neither the percentage of PAS (+) cells, nor IL-13 levels in the BAL fluids (p > 0.05). In contrast, pretreatment with dexamethasone (DEX) diminished the percentage of PAS (+) cells and the levels of IL-13 (p < 0.05). TiO2 treatment increased the IL-13 (+) mast cells (p < 0.05) in the trachea, which was suppressed by DEX (p < 0.05), but not by CPA pretreatment (p > 0.05). In addition there were significant correlations of IL-13 (+) rate of mast cells in the trachea with IL-13 concentration in BAL fluid (p < 0.01) and with the percentage of Muc5ac (+) cells in the sham and TiO2 treated rats (p < 0.05).

Conclusion

In conclusion, TiO2 instillation induces GCH and Muc5ac expression, and this process may be associated with increased production of IL-13 by mast cells.

Keywords: goblet cells, Muc5ac, particle, IL-13, mast cell, dexamethasone, cyclophosphamide

Background

Excessive mucus secretion is one of the major clinical manifestations of chronic airway diseases such as asthma, chronic bronchitis, and cystic fibrosis [1]. The excessive mucus is attributed to goblet cell hyperplasia (GCH) and submucosal gland hypertrophy, which are hallmarks of airway remodeling in chronic airway diseases [2,3]. Air pollution aggravates respiratory symptoms in patients with chronic airway diseases. Chronic obstructive pulmonary disease (COPD) patients living in communities exposed to high levels of air pollution have faster rates of decline in lung function than patients living in areas with low pollution [4]. The level of environmental particles is also positively correlated with exacerbation of asthma [5].

Airborne particulate matter less than 10 μm in aerodynamic diameter (PM10) is a complex mixture of organic and inorganic compounds containing sulfates and various metals such as aluminum, calcium, copper, iron, lead, magnesium, titanium, and zinc [6]. Clinically, PM10 particles are thought to provoke airway inflammation with the release of mediators that are capable of exacerbating lung disease in susceptible individuals [5,7]. This assumption is based on experimental evidence of airway inflammation following direct instillation or inhalation of PM10 particles in animal models [8]. Furthermore, inhaled particles directly stimulate macrophages and epithelial cells to produce inflammatory cytokines such as TNF-α, GM-CSF and IL-8 [9,10], which induce neutrophil- and eosinophil-mediated airway inflammation, and eventually lead to GCH. Recently, particle exposure favors the antigen – sensitized lung toward Th2 environment with over secretion of IL-13, IL-4 [11] and IL-5 [12]. Beside the inflammatory cell mediated – GCH, IL-13 directly induces GCH and Muc5AC gene expression through the signaling of IL-4Rα and IL-13Rα [13,14]. Therefore, we hypothesized that particles induce GCH via over-production of IL-13 by recruited inflammatory cells.

Titanium dioxide (TiO2) particles, one component of PM10, are found in dusty workplaces such as industries involved in the crushing and grinding of the mineral ore rutile [15]. It was reported that 50% of TiO2-exposed workers had respiratory symptoms accompanied by reduction in pulmonary function [16]. Because acute and chronic exposure to TiO2 particles induces inflammatory responses in the airways and alveolar spaces of rats [17,18], TiO2 – instilled rat may be a good model to study the particle induced – airway injury. In this study, we evaluated the role of neutrophilic and eosinophilic inflammation by pretreatment with cyclophosphamide inducing neutropenia [19] and the association of IL-13 by pretreatment with dexamethasone suppressing IL-13 gene expression [20].

Methods

Treatment protocols

Particles of TiO2 (mean diameter = 0.29 μm, DuPont, Wilmington, DE) were suspended in endotoxin-free saline. The endotoxin concentration of the TiO2 suspension was less than <0.32 EU/ml as measured with a limulus amebocyte lysate kit (QCL-1000; BioWhittaker, Inc., Walkersville, MD). Seven-week-old male Sprague-Dawley rats (Charles River Technology Inc.) received a single intratracheal instillation of homogeneous suspension of TiO2 particles (4 mg/kg in 200 μl of endotoxin free water). In a pretreatment group, cyclophosphamide (CPA) (100 mg/kg, i.p.) was given 5 days before instillation of TiO2 and a second injection of CPA (50 mg/kg, i.p.) 1 day before TiO2 instillation. In the second pretreatment group, dexamethasone (DEX) (0.25 mg/kg, i.p.; Sigma, St. Louis, MO) was administered 24 h before TiO2 instillation. The Institutional Animal Care and Use Committee of Soonchunhyang University approved the study protocols.

Preparation of lung tissues and morphological analysis

Rats were sacrificed at 4, 24, 48 and 72 hr after TiO2 instillation by being anesthetized with pentobarbital sodium (65 mg/kg, i.p.) and bronchoalveolar lavage (BAL) was performed by 5 times instillation of 1 ml normal saline and gentle retrieval. Cell numbers were measured using a hemacytometer and differential cell counts were performed on slides prepared by cyto-centrifugation and Diff-Quik staining (Scientific Products, Gibbstowne, NJ). Immediately following BAL, the trachea was snap-frozen for RNA extraction or fixed with 4% paraformaldehyde in PBS and embedded in paraffin. The tissues were subjected to periodic acid-Schiff (PAS) and toluidine blue staining to permit measurement of goblet cells and mast cells, respectively. Morphometric analysis was performed under light microscopy at ×400 magnification. PAS positive epithelial cells and total epithelial cells were counted on the length of 250 μm basement membrane at each of four predetermined sites (12, 3, 6, 9 o'clock; 12 o'clock was the membranous portion) using a soft program (Nikon DXM 1200, Nikon Inc. N.Y. USA & Image Pro Plus 4.01 software, Media Cybernetics, Maryland, USA). Results are expressed as the percentage of goblet cells among the epithelial cells. Mast cells in the airway wall were counted on the membranous portion. The results are expressed as the number of cells staining positive for toluidine blue per area of 0.01 mm2.

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was isolated using the modified guanidium thiocyanate-phenol-chloroform extraction method [21]. DNase I (10,000 U/ml; Stratagene, La Jolla, CA)-treated RNA was reverse-transcribed by incubating with 0.5 mM dNTP, 2.5 mM MgCl2, 5 mM DTT, 1 μl of random hexamer (50 ng/μl) and SuperScript II RT (200 unit/μl; Life Technologies, Grand Island, NY) at 42°C for 50 min, and heat inactivated at 70°C for 15 min. cDNA was aliquoted into tubes containing specific primer pairs for rat GAPDH, Muc1, Muc2 and Muc5ac genes for amplification (300, 403, 421, and 382-bp fragments, respectively). Nucleotide sequences of the primers were as follows. GAPDH-forward ; 5'GGCATTGCTCTCAATGACAA3', GAPDH-reverse; 5'AGGGCCTCTCTCTTGCTCTC3', Muc1-forward; 5' AGAGCTATGGGCAGCTGG 3', Muc1-reverse; 5' ACTACCCCAGTGTCCCTC 3', Muc2-forward; 5' TACTGCTGATGACTGTAT 3', Muc2-reverse; 5'GGCCACAGGCCTGATACT3', Muc5ac-forward; 5' TACAAGCCTGGTGAGTTC 3', Muc5ac-reverse; 5' TCACAGTGCAGCGTCACA 3'. Amplification was performed for 40 cycles (one cycle: 1 min at 94°C, 1 min at 52°C, and 1 min at 72°C) with initial denaturation at 94°C for 5 min and a final extension at 72°C for 10 min.

Immunohistochemical identification of Muc5ac-expressing epithelial cells and IL-13-expressing cells

Muc5ac-positive (+) epithelial cells and IL-13-positive (+) cells were identified by immunohistochemical staining. Three-micron tissue sections of the trachea were treated with 0.3% H2O2-methanol for 20 min to block endogenous peroxidase, and then incubated at 4°C overnight with anti-rat Muc5ac mouse monoclonal antibody (1:200 dilution; Neomarkers, Fremont, CA) or biotinylated anti-rat IL-13 antibody (1:5 dilution; Biosource, Camarillo, CA). After the slides had been incubated with avidin-biotin peroxidase complex (ABC kit, Vector Laboratories, Burlingame, CA), color was developed with 3,3'-diaminobenzidine tetrachloride (DAB, Zymed Laboratories, South San Francisco, CA). The Muc5ac expressing epithelial cells and total epithelial cells were counted on the length of 250 μm epithelial basement membrane at each of four predetermined sites (12, 3, 6, 9 o'clock; 12 o'clock was the membranous portion). Results are expressed as the percentage of Muc5ac (+) cells among the epithelial cells. IL-13 (+) cells was counted on the membranous portion in the same way as mast cells were counted. The results are expressed as the positive rate of mast cells for IL-13 stain per area of 0.01 m2.

Measurement of IL-13 concentration in BAL fluids

The levels of IL-13 in the BAL fluids were measured with a quantitative sandwich enzyme-linked immunoassay kit (Biosource, Camarillo, CA). The lower limit of detection was approximately 1.5 pg/ml. Values below this limit were considered as zero for statistical analysis. Inter- and intra-assay coefficients of variance were less than 10%.

Statistical analysis

Differences between independent samples were compared using the Spearman test for continuous data. If differences were found significant, the Mann-Whitney U test was applied to compare differences between two samples. Differences were considered significant when the p value was less than 0.05. Results are expressed as means ± standard error of the mean (SEM) unless otherwise stated. The correlations were analyzed between the ratio of Muc5ac (+) expressing epithelial cell and the concentration of IL-13 in BAL fluid and the number of mast cell and the IL-13 positive rate of mast cells by Spearman's non-parametric correlation using SPSS (version 10.0, Chicago, USA)

Results and Discussion

Expression of Muc gene transcripts in the trachea of TiO2 or saline – instilled rats

Total RNA was extracted from the trachea 24 h following treatment with saline or TiO2 and analyzed for Muc1, Muc2, and Muc5ac transcripts by RT-PCR. As shown in Figure 1, Muc1, Muc2 and Muc5ac mRNAs were practically undetectable in sham-treated rats. In contrast, TiO2 treatment markedly increased Muc5ac mRNA, but only modestly increased Muc2 mRNA. Muc1 mRNA was not seen in TiO2-treated rats.

Figure 1.

Figure 1

The expression of Muc1, Muc2 and Muc5ac mRNA in TiO2 treated rats. Rats were treated with TiO2, as described in Methods. Twenty-four hours after treatment, the levels of the Muc gene transcripts in the trachea were quantified using RT-PCR. GAPDH was used to ensure an equal loading of RNA samples. This figure is representative of 4 experiments.

The effect of TiO2 instillation on Muc5ac-positive and PAS-positive epithelial cells in trachea

Rats were given a single intratracheal instillation of saline or TiO2 and the percentage of Muc5ac-positive (Muc5ac (+)) and PAS-positive (PAS (+)) epithelial cells were measured. At 24 h after saline instillation, almost no PAS (+) or Muc5ac (+) epithelial cells were found in the trachea (Fig. 2Aa, b). TiO2 instillation, however, induced PAS (+) or Muc5ac (+) cells in the trachea at 24 h (Fig. 2Ac, d). The percentage of Muc5ac (+) cells was significantly higher at 24 hr (p < 0.05) and further increased (Fig. 2B) in TiO2 – instilled rats and maintained until 72 h when compared with those of sham rats (p < 0.01). The percentage of PAS (+) cells was very similar to that of Muc5ac (+) cells at 48 h after TiO2 instillation (Figure 2B).

Figure 2.

Figure 2

Light microscopic analysis of the trachea and the percentage of Muc5ac, PAS (+) epithelial cells. Rats were treated intratracheally with saline or TiO2, and the tracheas were prepared for morphometric analysis of PAS (+) and Muc5ac (+) cells as described in Methods. A. Histology of trachea 24 hr after saline or TiO2 treatment. PAS (+) cells were stained red whereas Muc5ac (+) cells dark brown. Note that the trachea obtained from the saline-treated group contained little or no PAS (+) (Aa) or Muc5ac (+) cells (Ab) while the trachea from TiO2-treated group contains significant number of PAS (+) (Ac) and Muc5ac (+) cells (Ad). B. Time (4, 24, 48,72 h) dependent change in the percentage of Muc5ac (+) cells following saline (open bar, n = 8) or TiO2 treatment (closed bar, n = 8). Note that the percentage of PAS (+) cells was similar to that of Muc5ac (+) cells at 48 hr after TiO2 instillation. * p < 0.05, ** p < 0.01 as compared with the saline treated group.

Effects of cyclophosphamide and dexamethasone on the number of inflammatory cells and IL-13 levels in BAL fluid of TiO2-treated rats

The numbers of eosinophils and neutrophils are markedly increased in the BAL fluids at 48 h after TiO2 instillation when compared with those in saline-treated rats (p < 0.05, respectively) (Fig. 3A and 3B). Also, the levels of IL-13 in BAL fluids were significantly higher in TiO2 – treated rats than those of sham rats at 48 h after treatment (p < 0.05) (Fig. 3D). Pretreatment with CPA prior to TiO2 instillation significantly decreased the numbers of neutrophils and eosinophils in BAL fluids when compared with those in rats at 48 h after treatment with TiO2 alone (p < 0.05, Fig. 3A &3B). Pretreatment with CPA, however, did not affect both the ratio of PAS (+) cells in the trachea and the IL-13 levels in BAL fluids of TiO2-treated rats (p > 0.05, Fig. 3C &3D). Pretreatment with DEX prior to TiO2 instillation significantly decreased the number of eosinophils in BAL fluid (p < 0.05, Fig. 3A), the ratio of PAS (+) cells in the trachea (p < 0.05, Fig 3C) and the levels of IL-13 in BAL fluid (p < 0.05, Fig. 4D) compared with those of rats instilled by TiO2 alone.

Figure 3.

Figure 3

The cell distribution in BAL fluid of TiO2 instilled rats with or without pretreatment. Rats were pretreated with CPA (n = 6) or DEX (n = 6) and then treated intratracheally with TiO2. Saline (n = 8) or TiO2 (n = 8) was treated without pretreatment. At 48 h post-treatment, BAL fluids were collected and analyzed for the numbers of eosinophils (A), neutrophils(B), and the levels of IL-13(D). PAS (+) cells (C) were measured in the trachea as described in Methods. * p < 0.05 as compared with saline – treated group, † p < 0.05 as compared with TiO2 – treated group.

Figure 4.

Figure 4

The effects of cyclophosphamide (CPA) or dexamethasone (DEX) on the IL-13 (+) expressing cells. Rats were pretreated intratracheally with saline (Fig. A, E ; n = 8), CPA (Fig. C, E ; n = 6) or DEX (Fig. D, E ; n = 6) prior to treatment with TiO2 Eight rats were treated with TiO2 alone (Fig. B, E ; n = 8) as described in Methods. At 48 h post-treatment, IL-13 (+) cells are stained brown whereas toluidine blue (+) mast cells are stained dark purple. Note that saline – treated group contained little or no IL-13 (+) cells (Aa) in spite of the presence of mast cells (Ab). TiO2-treated group showed significantly increasing numbers of mast cells when compared with sham group (E) and the mast cells (Ba) showed strong positivity for IL-13 protein (Bb). CPA pretreatment did not affect the TiO2 induced-increase in the number of IL-13 (+) cells (Ca) or mast cells (Cb & E). On the other hand, DEX pretreatment significantly decreased the number of mast cells (Db & E) and reduced the IL-13 (+) cells (Da). * p < 0.05 as compared with saline treated group, † p < 0.05 as compared with TiO2 treated group.

Effects of cyclophosphamide and dexamethasone on the number and IL-13 expression of mast cells in TiO2-treated rats

Toluidine blue – stained mast cells were observed in and around the muscle layer of the trachea in saline-treated rats. The shape of the cells was relatively round with a single nucleus and a large cytoplasm containing granules (Fig. 4Ab). In TiO2-instilled rats, some mast cells showed an elongated and branching shape of the cytoplasm (Fig. 4Bb). The trachea of the saline-treated group contained no IL-13 (+) cells (Fig. 4Aa) in spite of the presence of mast cells (Fig. 4Ab). TiO2-instilled rats increased the number of mast cells when compared with the saline control group (p < 0.05, Figs. 4Bb and 4E). Serial section slides of the trachea showed that IL-13 protein was expressed exclusively on the mast cells in TiO2 – treated rats (Fig. 4Ba). CPA pretreatment did not affect the TiO2-induced increase in the number of toluidine blue (+) mast cells positive for IL-13 (p > 0.05, Fig. 4Ca, 4Cb &4E). However, DEX pretreatment significantly decreased the number of toluidine blue (+) mast cells expressing IL-13 compared to those of TiO2 – treated rats (p < 0.05, Fig. 4Da, 4Db &4E).

The correlation between the number of IL-13 expressing mast cells, the concentration of IL-13 in BAL and Muc 5ac positive epithelial cells in the airway

The number of mast cells in the trachea was significantly correlated with percentage of Muc5ac (+) epithelial cells and concentration of IL-13 in BAL fluid of TiO2 – treated (n = 7) and sham (n = 6) rats (p < 0.001 and p < 0.0001, respectively, Table 1). However, the number of eosinophil and neutrophils in BAL fluids were correlated with neither the percentage of Muc5ac (+) epithelial cells nor the concentration of IL-13 in BAL fluid (p > 0.05, Table 1). In addition, there were significant correlations of IL-13 (+) rate of mast cells in the trachea with IL-13 concentration in BAL fluid (r = 0.782, p < 0.01, Fig. 5A) and with the percentage of Muc5ac (+) cells in the sham and TiO2 treated rats (r = 0.604, p < 0.05, Fig 5B).

Table 1.

The correlation of Muc5ac(+) cells or the IL-13 concentration with the number of inflammatory cells. The correlation between percentage of Muc5ac (+) epithelial cells or concentration of IL-13 in BAL fluid and number of eosinophil, neutrophil and mast cell in sham (n = 6) and TiO2 – instilled rats (n = 7).

Correlation (ρ) Eosinophils No. in BAL fluid Neutrophils No. in BAL fluid Mast cells No. in trachea
% of Muc5ac (+) 0.156 (p = 0.549) -0.195 (p = 0.438) 0.813 (p = 0.001*)
Concentration of IL-13 in BAL fluid 0.447 (p = 0.138) 0.193 (p = 0.57) 0.903 (p = 0.0001**)

* p < 0.05, ** p < 0.01

Figure 5.

Figure 5

The correlation of the IL-13(+) mast cells with Muc5ac(+) epithelial cells and the IL-13 concentration. The percentage of IL-13 (+) mast cells was correlated with concentration of IL-13 in BAL fluid (r = 0.782, p < 0.01) and the percentage of Muc5ac (+) cells (r = 0.604, p < 0.05) (open circle; sham, open square; TiO2 – instilled rats).

Discussion

Although air pollution contains heavy metallic environmental particles that increases morbidity and mortality of the patients with chronic airway diseases [4,5], the underlying mechanisms of mucus hyperproduction causing airway obstruction has not been revealed in detail. In this study, we demonstrated that a single instillation of TiO2 is able to induce GCH within 24 h. The TiO2-induced GCH is associated with a dramatic increase in Muc5ac gene and protein expression in the present study (Figure 1 &2). Up regulation of Muc5ac gene in TiO2 – induced GCH is thought to be a common pathway in the process of GCH because MUC5AC has been demonstrated to be a major MUC gene during the process of GCH observed in the other non-particulates experimental model of airway diseases [22-25] and the asthmatics [26]. GCH is known as associated with airway inflammation and can be experimentally induced by various inflammatory agents such as LPS [22], neutrophil elastase [27], cathepsin B [23], IL-4 [25], IL-9 [28], and IL-13 [29,30].

The exact mechanism of GCH, however, may differ in the experimental models. Neutrophils or eosinophils have been implicated in the induction of GCH in some animal models [30,31]. Neutrophils and eosinophils depleted rats using CPA or specific antibodies inhibit granulocyte in agarose plug-induced and IL-13-induced GCH model [29,31]. The epidermal growth factor receptor cascades are showed to be involved in underlying mechanism of the neutrophils – induced GCH [29,31]. However, in the present study we showed that depletion of these inflammatory cells by pretreatment with CPA similar dose used in the previously study [29,31] did not prevent TiO2-induced GCH (Figure 4). Because cyclophosphamide effectively suppressed the number of neutrophils and eosinophils in peripheral blood (data not shown) and airways in the present study although not complete (Figure 4), our data indicates that these inflammatory cells may be not responsible for the TiO2-induced GCH. The dissociation of GCH from airway eosinophilia has been well documented in murine asthma models, in which anti-IL-5 (TRFK-5) [32], or IL-5 deficiency [33] reduced airway eosinophilia without affecting the induction of GCH. Therefore, depending on the experimental models investigated, the induction of GCH may not require neutrophils and eosinophils. Furthermore, IL-13 is known to induce GCH without any help of other inflammatory cells [24] and has been clearly shown to play a single, common pathway by which GCH is induced by CD4+ cells and IL-9 [34]. This process needs IL-4 receptor alpha, but not IL-4 or IL-5 [33,34]. These data suggested a possibility that IL-13 is also involved in the particle – induced GCH.

In the present study, the levels of IL-13 in BAL fluids increased after TiO2 instillation concomitantly with the development of GCH and the increase of IL-13 was completely abolished by pretreatment with DEX (0.25 mg/Kg), but not by that with CPA (Figure 4). These results suggest that the elevation of IL-13 may be associated with particles such as TiO2-induced GCH without any assistance of neutrophils or eosinophils. The in vivo effect of dexamethasone has been also demonstrated in allergic asthma model [35]. Dexamethasone (4 mg / kg) effectively abolishes allergic airway inflammation in mice by suppression of IL-13 m-RNA and protein expression [35]. The exact biochemical mechanism of GCH induction by IL-13 is not fully understood. One possible explanation is that IL-13 converts the bronchial epithelium from an absorptive to a secretory phenotype through loss of an amiloride-sensitive current and an increase in calcium-sensitive apical anion conductance [36]. The increase in apical anion conductance in the airway epithelium is most likely due to the ability of IL-13 to induce expression of hCLCA1/mCLCA3, which encodes a calcium-activated chloride channel. This channel is necessary and sufficient for the development of GCH and mucus hypersecretion in some experiments [37].

Besides Th2 cells, IL-13 is produced by mast cells, eosinophils [38,39], and macrophages [40]. Since IL-13 was not decreased in rats of which eosinophils depleted by pretreatment of CPA (Figure 4), we can exclude eosinophils as the source of IL-13. Interestingly, serial thin section slides revealed that the IL-13 positive cells are mast cells, as shown by staining with toluidine blue. Also, we found the significant correlation between the IL-13 (+) rate of mast in tissue, concentration of IL-13 in BAL fluid and Muc5ac positive cells (Figure 5 and table 1). Based on these data, mast cells may be the cellular source for IL-13 present in the airways of TiO2-treated rats. It is well known that mast cells produce IL-13 when stimulated with antigen [39] and that the synthesis can be suppressed by dexamethsone [20]. Our finding showed that TiO2 instillation increased the numbers of IL-13 expressing mast cells and Muc5ac (+) goblet cells, both of which were decreased by dexamethsone pretreatment is a novel finding to our knowledge. It is not known whether TiO2 – induced IL-13 overproduction is specific to TiO2 or generally related to other particulates. However, base on the findings of particles such as diesel exhaust particles or carbon black particle – induced the deviation to Th2 environment in antigen sensitized lung [11,12], TiO2 – induced GCH via over production of IL-13 may be a general finding attributed to the particulate matters, but it remains unproven.

Conclusion

We demonstrated that a single intratracheal instillation of TiO2 particles induces GCH and Muc5ac gene expression within 24 h in rats, and that this process may be associated with elevated amount of IL-13 derived from mast cells. The present study may provide experimental evidences to support that patients with chronic airway disease may aggravate their symptoms and airway functions in the heavily polluted environment of particulate matters.

Acknowledgments

Acknowledgements

The authors are indebted to Hwan-man Shin, Myong-ran Lee, and Eun-young Kim for their excellent animal care and technical support throughout the study. The authors express thanks to at least two professional editors, both native speakers of English for their kind editing for grammar and topographic error http://www.textcheck.com. This work was supported by a grant from the Korea Health 21 R&D Project, Ministry of Health and Welfare, Republic of Korea (01-PJ3-PG6-01GN04-003).

Contributor Information

Mi-Hyun Ahn, Email: mh2300@hotmail.com.

Chun-Mi Kang, Email: doroshi73@hanmail.net.

Choon-Sik Park, Email: mdcspark@unitel.co.kr.

Sang-Jun Park, Email: sjpark@schbc.ac.kr.

Taiyoun Rhim, Email: xodus@schbc.ac.kr.

Pyeong-Oh Yoon, Email: pyoungoh@hotmail.com.

Hun Soo Chang, Email: intron@hanyang.ac.kr.

Soo-Ho Kim, Email: sinbasi35@hotmail.com.

Hiroko Kyono, Email: hikyono@aqua.ocn.ne.jp.

Kwang Chul Kim, Email: kkim@umaryland.edu.

References

  1. Openshaw PJ, Turner-Warwick M. Observations on sputum production in patients with variable airflow obstruction; Implications for the diagnosis of asthma and chronic bronchitis. Respir Med. 1989;83:25–31. doi: 10.1016/s0954-6111(89)80056-3. [DOI] [PubMed] [Google Scholar]
  2. Thurlbeck WM, Malaka D, Murphy K. Goblet cells in the peripheral airways in chronic bronchitis. Am Rev Respir Dis. 1975;112:65–9. doi: 10.1164/arrd.1975.112.1.65. [DOI] [PubMed] [Google Scholar]
  3. Aikawa T, Shimura S, Sasaki H, Ebina M, Takishima T. Marked goblet cell hyperplasia with mucus accumulation in the airways of patients who died of severe acute asthma attack. Chest. 1992;101:916–21. doi: 10.1378/chest.101.4.916. [DOI] [PubMed] [Google Scholar]
  4. Pope CA, Kanner RE. Acute effects of PM10 pollution on pulmonary function of smokers with mild to moderate chronic obstructive pulmonary disease. Am Rev Respir Dis. 1993;147:1336–40. doi: 10.1164/ajrccm/147.6_Pt_1.1336. [DOI] [PubMed] [Google Scholar]
  5. Schwartz J, Slater D, Larson TV, Pierson WE, Koenig JQ. Particulate air pollution and hospital emergency room visits for asthma in Seattle. Am Rev Respir Dis. 1993;147:826–31. doi: 10.1164/ajrccm/147.4.826. [DOI] [PubMed] [Google Scholar]
  6. Pagan I, Costa DL, McGee JK, Richards JH, Dye JA. Metals mimic airway epithelial injury induced by in vitro exposure to Utah Valley ambient particulate matter extracts. J Toxicol Environ Health A. 2003;66:1087–112. doi: 10.1080/15287390390213908. [DOI] [PubMed] [Google Scholar]
  7. Seaton A, MacNee W, Donaldson K, Godden D. Particulate air pollution and acute health effects. Lancet. 1995;345:176–8. doi: 10.1016/S0140-6736(95)90173-6. [DOI] [PubMed] [Google Scholar]
  8. Li XY, Gilmour PS, Donaldson K, MacNee W. Free radical activity and pro-inflammatory effects of particulate air pollution (PM10) in vivo and in vitro. Thorax. 1996;51:1216–1222. doi: 10.1136/thx.51.12.1216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Becker S, Soukup JM, Gilmour MI, Devlin RB. Stimulation of human and rat alveolar macrophages by urban air particulates: effects on oxidant radical generation and cytokine production. Toxicol Appl Pharmacol. 1996;141:637–48. doi: 10.1006/taap.1996.0330. [DOI] [PubMed] [Google Scholar]
  10. Fujii T, Hayashi S, Hogg JC, Vincent R, Van Eeden SF. Particulate matter induces cytokine expression in human bronchial epithelial cells. Am J Respir Cell Mol Biol. 2001;25:265–71. doi: 10.1165/ajrcmb.25.3.4445. [DOI] [PubMed] [Google Scholar]
  11. Hamilton RF, Jr, Holian A, Morandi MT. A comparison of asbestos and urban particulate matter in the in vitro modification of human alveolar macrophage antigen-presenting cell function. Exp Lung Res. 2004;30:147–62. doi: 10.1080/01902140490266439. [DOI] [PubMed] [Google Scholar]
  12. Li N, Hao M, Phalen RF, Hinds WC, Nel AE. Particulate air pollutants and asthma, A paradigm for the role of oxidative stress in PM-induced adverse health effects. Clinical Immunology. 2003;109:250–265. doi: 10.1016/j.clim.2003.08.006. [DOI] [PubMed] [Google Scholar]
  13. Zhu Z, Homer RJ, Wang Z, Chen Q, Geba GP, Wang J, Whang Y, Elias JA. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production. J Clin Invest. 1999;103:779–788. doi: 10.1172/JCI5909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Grunig G, Warnock M, Wakil AE, Venkayya R, Brombacher F, Rennick DM, Sheppard D, Mohrs M, Donaldson DD, Locksley RM, Corry DB. Requirement for IL-13 independently of IL-4 in experimental asthma. Science. 1998;282:2261–3. doi: 10.1126/science.282.5397.2261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Templeton DM. Titanium. In: Seiler HG, Siegel A, Siegel H, editor. handbook on metals in clinical and analytic chemistry. New York: Marcel Dekker; 1994. pp. 627–30. [Google Scholar]
  16. Garabrant DH, Fine LJ, Oliver C, Bernstein L, Peters JM. Abnormalities of pulmonary function and pleural disease among titanium metal production workers. Scand J Work Environ Health. 1987;13:47–51. doi: 10.5271/sjweh.2087. [DOI] [PubMed] [Google Scholar]
  17. Schapira RM, Ghio AJ, Effros RM, Morrisey J, Almagro UA, Dawson CA, Hacker AD. Hydroxyl radical production and lung injury in the rat following silica or titanium dioxide instillation in vivo. Am J Respir Cell Mol Biol. 1995;12:220–6. doi: 10.1165/ajrcmb.12.2.7865220. [DOI] [PubMed] [Google Scholar]
  18. Warheit DB, Hansen JF, Yuen IS, Kelly DP, Snajdr SI, Hartsky MA. Inhalation of high concentrations of low toxicity dusts in rats results in impaired pulmonary clearance mechanisms and persistent inflammation. Toxicol Appl Pharmacol. 1997;145:10–22. doi: 10.1006/taap.1997.8102. [DOI] [PubMed] [Google Scholar]
  19. Nagai H, Yamaguchi S, Tanaka H, Inagaki N. Effect of some immunosuppressors on allergic bronchial inflammation and airway hyperresponsiveness in mice. Int Arch Allergy Immunol. 1995;108:189–95. doi: 10.1159/000237138. [DOI] [PubMed] [Google Scholar]
  20. Fushimi T, Okayama H, Shimura S, Saitoh H, Shirato K. Dexamethasone suppresses gene expression and production of IL-13 by human mast cell line and lung mast cells. J Allergy Clin Immunol. 1998;102:134–42. doi: 10.1016/s0091-6749(98)70064-8. [DOI] [PubMed] [Google Scholar]
  21. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–9. doi: 10.1016/0003-2697(87)90021-2. [DOI] [PubMed] [Google Scholar]
  22. Harkema JR, Hotchkiss JA. In vivo effects of endotoxin on intraepithelial mucosubstances in rat pulmonary airways. Quantitative histochemistry. Am J Pathol. 1992;141:307–17. [PMC free article] [PubMed] [Google Scholar]
  23. Cardozo C, Padilla ML, Choi HS, Lesser M. Goblet cell hyperplasia in large intrapulmonary airways after intratracheal injection of cathepsin B into hamsters. Am Rev Respir Dis. 1992;145:675–679. doi: 10.1164/ajrccm/145.3.675. [DOI] [PubMed] [Google Scholar]
  24. Kibe A, Inoue H, Fukurama S, Machida K, Matsumoto K, Koto H, Ikegami T, Aizawa H, Hara N. Differential regulation by glucocorticoid of interleukin-13-induced eosinophilia, hyprresponsiveness, and goblet cell hyperplasia in mouse airways. Am J Respir Crit Care Med. 2003;167:50–56. doi: 10.1164/rccm.2110084. [DOI] [PubMed] [Google Scholar]
  25. Dabbagh K, Takeyama K, Lee HM, Ueki IF, Lausier JA, Nadel JA. IL-4 induces mucin gene expression and goblet cell metaplasia in vitro and in vivo. J Immunol. 1999;162:6233–7. [PubMed] [Google Scholar]
  26. Ordonez CL, Khashayar R, Wong HH, Ferrando R, Wu R, Hyde DM, Hotchkiss JA, Zhang Y, Novikov A, Dolganov G, Fahy JV. Mild and moderate asthma is associated with airway goblet cell hyperplasia and abnormalities in mucin gene expression. Am J Respir Crit Care Med. 2001;163:517–523. doi: 10.1164/ajrccm.163.2.2004039. [DOI] [PubMed] [Google Scholar]
  27. Lucey EC, Stone PJ, Breuer R, Christensen TG, Calore JD, Catanese A, Franzblau C, Snider GL. Effect of combined human neutrophil cathepsin G and elastase on induction of secretory cell metaplasia and emphysema in hamsters, with in vitro observations on elastolysis by these enzymes. Am Rev Respir Dis. 1985;132:362–6. doi: 10.1164/arrd.1985.132.2.362. [DOI] [PubMed] [Google Scholar]
  28. Townsend MJ, Fallon PG, Matthews DJ, Smith P, Jolin HE, McKenzie ANJ. IL-9-deficient mice establish fundamental roles for IL-9 in pulmonary mastocytosis and goblet cell hyperplasia but not T cell development. Immunity. 2000;13:573–583. doi: 10.1016/S1074-7613(00)00056-X. [DOI] [PubMed] [Google Scholar]
  29. Shim JJ, Dabbagh K, Ueki IF, Dao-Pick T, Burgel PR, Takeyama K, Tam DC, Nadel JA. IL-13 induces mucin production by stimulating epidermal growth factor receptors and by activating neutrophils. Am J Physiol Lung Cell Mol Physiol. 2001;280:L134–40. doi: 10.1152/ajplung.2001.280.1.L134. [DOI] [PubMed] [Google Scholar]
  30. Singer M, Lefort J, Vargaftig BB. Granulocyte depletion and dexamethasone differentially modulate airways hyperreactivity, inflammation, mucus accumulation, and secretion induced by rmIL-13 or antigen. Am J Respir Cell Mol Biol. 2002;26:74–84. doi: 10.1165/ajrcmb.26.1.4618. [DOI] [PubMed] [Google Scholar]
  31. Lee HM, Takeyama K, Dabbagh K, Lausier JA, Ueki IF, Nadel JA. Agarose plug instillation causes goblet cell metaplasia by activating EGF receptors in rat airways. Am J Physiol Lung Cell Mol Physiol. 2000;278:L185–92. doi: 10.1152/ajplung.2000.278.1.L185. [DOI] [PubMed] [Google Scholar]
  32. Mathur M, Herrmann K, Li X, Qin Y, Weinstock J, Elliott D, Monahan J, Padrid P. TRFK-5 reverses established airway eosinophilia but not established hyperresponsiveness in a murine model of chronic asthma. Am J Respir Crit Care Med. 1999;159:580–7. doi: 10.1164/ajrccm.159.2.9712018. [DOI] [PubMed] [Google Scholar]
  33. Cohn L, Homer RJ, MacLeod H, Mohrs M, Brombacher F, Bottomly K. Th2-induced airway mucus production is dependent on IL-4Ralpha, but not on eosinophils. J Immunol. 1999;162:6178–83. [PubMed] [Google Scholar]
  34. Whittaker L, Niu N, Temann UA, Stoddard A, Flavell RA, Ray A, Homer RJ, Cohn L. Interleukin-13 mediates a fundamental pathway for airway epithelial mucus induced by CD4 cells and interleukin-9. Am J Respir Cell Mol Biol. 2002;27:593–602. doi: 10.1165/rcmb.4838. [DOI] [PubMed] [Google Scholar]
  35. Eum SY, Maghni K, Hamid Q, Eidelman DH, Campbell H, Isogai S, Martin JG. Inhibition of allergic airways inflammation and airway hyperresponsiveness in mice by dexamethasone : Role of eosinophils, IL-5, eotaxin, and IL-13. J Allergy Clin Immunol. 2003;111:1049–61. doi: 10.1067/mai.2003.1416. [DOI] [PubMed] [Google Scholar]
  36. Danahay H, Atherton H, Jones G, Bridges RJ, Poll CT. Interleukin-13 induces a hypersecretory ion transport phenotype in human bronchial epithelial cells. Am J Physiol Lung Cell Mol Physiol. 2002;282:L226–36. doi: 10.1152/ajplung.00311.2001. [DOI] [PubMed] [Google Scholar]
  37. Zhou Y, Dong Q, Louahed J, Dragwa C, Savio D, Huang M, Weiss C, Tomer Y, McLane MP, Nicolaides NC, Levitt RC. Characterization of a calcium-activated chloride channel as a shared target of Th2 cytokine pathways and its potential involvement in asthma. Am J Respir Cell Mol Biol. 2001;25:486–91. doi: 10.1165/ajrcmb.25.4.4578. [DOI] [PubMed] [Google Scholar]
  38. Wills-Karp M, Chiaramonte M. Interleukin-13 in asthma. Curr Opin Pulm Med. 2003;9:21–7. doi: 10.1097/00063198-200301000-00004. [DOI] [PubMed] [Google Scholar]
  39. Burd PR, Thompson WC, Max EE, Mills FC. Activated mast cells produce interleukin 13. J Exp Med. 1995;181:1373–80. doi: 10.1084/jem.181.4.1373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Hancock A, Lynne Armstrong , Rafael Gama , Ann Millar Production of Interleukin 13 by alveolar macrophages from normal and fibrotic lung. Am J Respir Cell Mol Biol. 1998;18:60–65. doi: 10.1165/ajrcmb.18.1.2627. [DOI] [PubMed] [Google Scholar]

Articles from Respiratory Research are provided here courtesy of BMC

RESOURCES