A new ROS response factor YvmB protects Bacillus licheniformis against oxidative stress under adverse environment

ABSTRACT

Bacillus spp., a class of aerobic bacteria, is widely used as a biocontrol microbe in the world. However, the reactive oxygen species (ROS) will accumulate once the aerobic bacteria are exposed to environmental stresses, which can decrease cell activity or lead to cell death. Hydroxyl radical (·OH), the strongest oxide in the ROS, can damage DNA directly, which is generated through Fenton Reaction by H₂O₂ and free iron. Here, we proved that the synthesis of pulcherriminic acid (PA), an iron chelator produced by Bacillus spp., could reduce DNA damage to protect cells from oxidative stress by sequestrating excess free iron, which enhanced the cell survival rates in stressful conditions (salt, antibiotic, and high temperature). It was worth noting that the synthesis of PA was found to be increased under oxidative stress. Thus, we demonstrated that the YvmB, a direct negative regulator of PA synthesis cluster yvmC-cypX, could be oxidized at cysteine residue (C57) to form a dimer losing the DNA-binding activity, which led to an improvement in PA production. Collectively, our findings highlight that YvmB senses ROS to regulate PA synthesis is one of the evolved proactive defense systems in bacteria against adverse environments.

IMPORTANCE

Under environment stress, the electron transfer chain will be perturbed resulting in the accumulation of H₂O₂ and rapidly transform to ·OH through Fenton Reaction. How do bacteria deal with oxidative stress? At present, several iron chelators have been reported to decrease the ·OH generation by sequestrating iron, while how bacteria control the synthesis of iron chelators to resist oxidative stress is still unclear. Our study found that the synthesis of iron chelator PA is induced by reactive oxygen species (ROS), which means that the synthesis of iron chelator is a proactive defense mechanism against environment stress. Importantly, YvmB is the first response factor found to protect cells by reducing the ROS generation, which present a new perspective in antioxidation studies.

INTRODUCTION

Bacillus spp., one of the dominant populations in the micro-ecological environment, is widely used as a biocontrol microbe against plant diseases in the world due to its prominent functions. For instance, the secretion of various proteases contributed to the decomposition of organic compounds (1); the generation of antibacterial peptides and insecticidal proteins increased the resistance of plants to harmful microorganisms and pests (2–4); the secretion of indoleacetic acid and phenols promoted plant growth (5); and the degradation of pesticides could be used for environmental remediation (6). Thus, Bacillus spp. is also one of the research hotspots in microbial ecology (7), while their normal growth and functions also depend on aerobic metabolism which can cause the accumulation of reactive oxygen species (ROS) (8) when cells are exposed to the stressful conditions.

ROS include superoxide anion (O₂⁻), hydrogen peroxide (H₂O₂), hydroxyl radical (·OH), and organic hydroperoxides (ROOH), which can damage DNA, proteins, and membranes and further decrease the cell activity or lead to cell death (9, 10). For resisting oxidative stress, some ROS response pathways were reported to activate the antioxidative systems (Fig. 1A), including antioxidative proteins (superoxide dismutase, catalase, peroxidase, thioredoxin, and thioredoxin reductase) and antioxidative small molecules (bacillithiol, cysteine, H₂S, NADH, and NADPH) and so on, which can maintain the redox equilibrium of cells by removing excess ROS (9, 11–15). For instance, transcription factor PerR mainly inhibits the expression of the genes kat (encode catalase), dpr (encode Dps-like peroxide resistance protein), and ahpCF (encode alkyl hydroperoxide reductase) in Bacillus spp. And PerR protein can be oxidized in its histidine site (H37 and H91) by ·OH and the oxidized PerR lost the inhibition ability on targeted genes, which promote the expression of kat, dpr, and ahpCF, resulting in a protection to cells from oxidative stress (11). Whereas, little attention has been paid to studies on the transcription factor sensing oxidation to decrease the generation of ROS, especially the ·OH, which has the strongest oxidizing property and can damage DNA, carbonylate proteins, and peroxidate lipids directly (16).

Fig 1.

The reported ROS response pathways (A) and the metabolic regulation network of PA (B).

Hydroxyl radical is produced by Fenton reaction (16, 17):

$${\displaystyle \begin{array}{c}\mathrm{D}\mathrm{o}\mathrm{n}\mathrm{o}{\mathrm{r}}^{\mathrm{r}\mathrm{e}\mathrm{d}}+{\mathrm{F}\mathrm{e}}^{3+}\to \mathrm{D}\mathrm{o}\mathrm{n}\mathrm{o}{\mathrm{r}}^{\mathrm{o}\mathrm{x}}+{\mathrm{F}\mathrm{e}}^{2+}\\ {\mathrm{F}\mathrm{e}}^{2+}+{\mathrm{H}}_2{\mathrm{O}}_2\to {\mathrm{F}\mathrm{e}}^{3+}+{\mathrm{O}\mathrm{H}}^{-}+\cdot \mathrm{O}\mathrm{H}\\ \cdot \mathrm{O}\mathrm{H}+\mathrm{D}\mathrm{N}\mathrm{A}\to {\mathrm{H}}_2\mathrm{O}+\text{ damage }\end{array}}$$

With the accumulation of H₂O₂, the concentration of free iron plays an important role in the generation of ·OH, while the iron is also an essential micronutrient for cell growth and biofilm formation (18–21). Thus, maintaining intracellular iron homeostasis is vital for cell survival. As reported, transcription factor Fur can control the synthesis of a strong siderophore bacillibactin by sensing the concentration of iron (22, 23), the function of which is to acquire iron rather than alter the total iron concentration in and out of the cell. However, a natural iron chelator pulcherriminic acid (PA), produced by Bacillus spp. and saccharomyces (20), can decrease the iron concentration in the environment by binding Fe³⁺ to form red sediment, especially the soil with high concentration of free iron (24), which may protect plants and soil microbes from iron toxicity. Moreover, it has been reported that PA can modulate iron availability and protect against oxidative stress during microbial interactions (25). On the other side, excess PA will cause extreme Fe deficiency, which means the synthesis of PA should be controlled. As reported, the diffusible molecules and volatiles produced by competitors can induce PA production in B. subtilis, while the induction mechanism is still unclear (25).

PA structurally belongs to the diketopiperazines (DKPs), a large class of cyclic peptides with various biological properties, which is synthesized by cyclodipeptide synthases (CDPS). The CDPS YvmC catalyzes leucyl-tRNA (connected of two leucine by leucyl-tRNA ligase LeuS) to form cyclo-L-leucyl-L-leucyl (cLL) and then cytochrome P450 (encoded by cypX) transforms cLL to PA (Fig. 1B) (26). Previous studies indicated that the transcription factors YvmB, YvnA, and AbrB have direct negative regulation on the expression of yvmC-cypX cluster. YvmA protein is required for the secretion of PA and the expression of yvmA is also negatively regulated by YvmB (27, 28).

In our study, stressful conditions (salt, antibiotic, and high temperature) caused the higher ROS accumulation and also increased PA production. Not only that, we found that the synthesis of PA in B. licheniformis DW2 was enhanced by adding H₂O₂ to the medium, while it had no change in yvmC promoter substitution strain (DW2-P_P43UTR12yvmC), which meant the adjustment of PA synthesis might be one of the defense mechanisms for cell survival. Thus, we hypothesized that there was a transcription factor that can sense ROS to control the synthesis of PA (Fig. 1A). This research will conduct an in-depth study on this issue.

RESULTS

The synthesis of PA protects B. licheniformisfrom H₂O₂ by sequestering free iron

As reported, H₂O₂ is not very toxic to cells but the genotoxicity will be multiplied once it is transformed to ·OH through the Fenton reaction (16). Also, our study showed that the survival rates of B. licheniformis DW2 under H₂O₂ stress were reduced by 27.67% and 34.49% when FeCl₃ and FeSO₄ were respectively added to the MEF medium (Fig. 2A). While the addition of iron chelator EDDHA (Ethy Diaminedhephen Acetic-sodium) to the ME medium restored the resistance of cells to the H₂O₂ (Fig. 2A). The results presented the toxicity of free iron on cells under H₂O₂ stress and the potential of iron chelator to resist oxidative stress.

Fig 2.

The synthesis of PA protected B. licheniformis DW2 from H₂O₂ stress by sequestering free iron. (A) Survival rates of DW2 under 2 mM H₂O₂ stress when 0.15 mM Fe³⁺ or 0.15 mM Fe²⁺ were added to the MEF medium (without iron adding) and EDDHA was added to the ME medium (with 0.15 mM Fe³⁺). (B) PA yields and survival rates of DW2 (wt), DW2ΔyvmC (ΔyvmC), and DW2-P_P43UTR12yvmC (+yvmC) in the ME medium (with 0.15 mM Fe³⁺). PA yields were detected at the mid-log phase (12 h) (Fig. S1). (C) ROS accumulation and DNA damage of DW2, ΔyvmC, and +yvmC in the ME medium. Data were detected at 12 h. (D) Growth curves of DW2, ΔyvmC, and +yvmC in the ME medium with or without 1 mM H₂O₂ added at 6 h. (E) Survival rates of DW2, DW2ΔyvmC, and +yvmC under 2 mM H₂O₂ stress when 0.15 mM Fe³⁺ and 0.15 mM Fe²⁺ were added to the MEF medium. CK means the addition with 0.75 µM Fe³⁺. (F) Survival rates of DW2, DW2Δfur, DW2ΔfurΔyvmC, and DW2Δfur-P_P43UTR12yvmC (DW2Δfur + yvmC) in the ME medium. All data are presented as mean ± SD (n ≥ 3 biological replicates). *: P < 0.05, **: P < 0.01, ***: P < 0.005, ns: P > 0.05.

The PA biosynthetic genes (yvmC and cypX), transport-related gene yvmA, and their regulators (yvmB and yvnA) were arranged in genome DNA were showed in Fig. S2A. Part of the gene sequences of yvmC and cypX overlap together (shown in Fig. S2B), meaning that P_yvmC is the promoter of both yvmC and cypX. To investigate the function of iron chelator PA to cell survival under oxidative stress, we generated B. licheniformis strains either lacking gene yvmC (GenBank: BaLi_c36280, the sequence was shown in Table S1) (DW2ΔyvmC) or carrying it under a strong constitutive promoter P_P43UTR12 (29) in chromosomal DNA (DW2-P_P43UTR12yvmC). As shown in Fig. 2B, DW2ΔyvmC lost the ability to produce PA, while yvmC overexpressed strain produced more PA (117.81 µM/g DCW) than DW2 (53.45 µM/g DCW). Furthermore, we found that the percentage of viable cells of DW2ΔyvmC under H₂O₂ stress was just 57.10%, which was decreased by 8.07% compared with that of wild-type strain DW2, while the survival rate of DW2-P_P43UTR12yvmC (69.71%) was increased by 12.23% compared with that of DW2 (Fig. 2B). Same with expectation, the synthesis of PA could protect B. licheniformis from H₂O₂ stress.

On this basis, we detected the ROS accumulation and the DNA damage of these three strains in the ME medium at the mid-log phase (Fig. 2C). The results displayed that the intracellular ROS level and DNA damage of DW2ΔyvmC was increased significantly compared with that of DW2. On the contrary, the damaged DNA in yvmC overexpressed strain was decreased compared with that in DW2 due to the lower ROS accumulation in DW2-P_P43UTR12yvmC than DW2, which meant that the synthesis of PA helped cells to resist H₂O₂-mediated toxicity by reducing the ROS accumulation and the DNA damage. Moreover, the growth curves of these strains showed the same results that the viability of cells was improved by overexpressing PA when H₂O₂ and iron coexisted in the medium (Fig. 2D). However, it was worth noting that the overexpression of PA was not beneficial to cell growth when H₂O₂ was not added to the medium, which highlights the importance of iron in cell survival in the absence of excess ROS.

It has been reported that PA cannot be synthesized when the concentration of free iron is lower than 1.87 µM (27). Thus, the results in Fig. 2E show that the survival rates have no significant difference between DW2, DW2ΔyvmC, and DW2-P_P43UTR12yvmC when the concentration of Fe³⁺ existed in the medium is 0.75 µM. Moreover, we found that the production of PA could influence the survival rates of these three strains when 0.15 mM Fe³⁺ or Fe²⁺ were added in the MEF medium, even though PA only chelate Fe³⁺ (Fig. 2E), which suggested that it could protect cells from oxidative stress whether Fe³⁺ or Fe²⁺ exist in the environment. In addition, we constructed a strain (DW2Δfur) with higher intracellular free iron by knocking out the fur gene (GenBank: BaLi_c25830 , the sequence was shown in Table S1), which was reported to encode the main transcription regulator of iron uptake and homeostasis in Bacillus spp (19). Then, the yvmC gene was deleted and overexpressed respectively in DW2Δfur to construct two strains, DW2ΔfurΔyvmC and DW2Δfur-P_P43UTR12yvmC. From Fig. 2F, it can be seen that the survival rate of DW2Δfur was lower than that of wild-type strain DW2 due to its higher intracellular free iron, which was consistent with the previous study (22). Then, the survival rate of DW2ΔfurΔyvmC was decreased by 33.55% compared with that of DW2Δfur, while the survival rate of DW2Δfur-P_P43UTR12yvmC was increased (Fig. 2F). Taken together, we demonstrated that the synthesis of PA could decrease the DNA damage of cells by sequestrating free iron, which indicated that PA could indeed protect B. licheniformis from oxidative stress.

The synthesis of PA protects cells against adverse environment

As reported, environmental stresses cause the perturbation of the electron transfer chain resulting in the generation of O₂⁻ that can be transformed to H₂O₂ (8). For investigating whether the synthesis of PA could enhance the ability of cells to resist adverse environment, we detected the intracellular ROS levels and the cell survival rates of strains DW2, DW2ΔyvmC, and DW2-P_P43UTR12yvmC under stressful conditions including salt (6% NaCl), antibiotic (25 µg/mL ampicillin) and high temperature (45°C). As shown in Fig. 3A, the intracellular ROS levels in DW2 were increased by 22.96%, 25.55%, and 55.19% after the cells were respectively treated with salt, antibiotic, and high temperature for 300 min. Besides, the biomass of DW2 was decreased after the cells were cultured under these conditions (Fig. S3), which proved that the adverse environment could indeed improve the ROS accumulation and lead to cell death. In the yvmC deletion strain, the intracellular ROS levels were increased by 93.88%, 76.13%, and 142.01% after the cells were respectively treated with above conditions (Fig. 3B), which illustrated that the environment stresses caused more increase on ROS accumulation in DW2ΔyvmC than in DW2. On the contrary, the intracellular ROS levels in yvmC overexpression strain had no significant difference after NaCl and Amp were exogenous added to the medium for 300 min (Fig. 3C). However, the intracellular ROS level in yvmC overexpression strain was increased by 87.04% after the cells were cultured at 45°C for 300 min (Fig. 3C), which was considered to be caused by the influence of high temperature on the activities of the antioxidative enzymes. As shown in Fig. S4, the SOD activity was decreased 43.67% when DW2 cells were treated at 45°C for 2 h, while the CAT activity was increased 3.41% and the POD activity was increased 1.64-fold, suggesting that high temperature could affect the activities of some intracellular enzymes. Furthermore, the results showed that the survival rates of DW2ΔyvmC were all decreased due to the higher intracellular ROS levels, while the survival rates of DW2-P_P43UTR12yvmC were all increased due to the lower intracellular ROS levels under above environmental stresses (Fig. 3D and E), which proved that the synthesis of PA could help cells to resist adverse conditions by decreasing the accumulation of ROS.

Fig 3.

Effects of different environmental stress on ROS generation and cell survival rate. The intracellular ROS levels of wt (A) △yvmC (B), and +yvmC (C) under different stressful conditions. The strains DW2 (wt), △yvmC, and +yvmC were cultured to the mid-log phase (12 h), and subsequently stimulated under different environmental conditions, then the cells were cultivated continuously and intracellular ROS levels was measured at intervals. (D) The intracellular ROS levels of wt, △yvmC, and +yvmC under different stressful conditions after 300 min stimulation. (E) Survival rate of wt, △yvmC, and +yvmC cells after 120 min stimulation under different stressful conditions. *: P < 0.05, **: P < 0.01, ***: P < 0.005.

The expression of the yvmC-cypX cluster is enhanced by adding H₂O₂ in medium.

Since PA was proved to protect cells from oxidative stress, we considered whether the synthesis of PA can be induced by ROS accumulation. Significantly, the production of PA was increased in DW2 when 0.5 mM H₂O₂ was added to the medium at mid-log phase (Fig. 4A). Also, as shown in Fig. S3, PA production was enhanced after the cells were cultured under the different environmental stresses, which meant that PA might be an evolved and proactive defense against oxidative stress for the bacteria themselves. For understanding the mechanism of H₂O₂-induced enhancement on PA production, we firstly detected the relative transcriptional levels of related genes involved in the synthesis and secretion of PA in DW2. As shown in Fig. 4B, the transcription levels of yvmC and yvmA (GenBank: BaLi_c36270) were increased by 3.35-fold and 2.21-fold respectively when DW2 was cultured in the medium with 0.5 mM H₂O₂, while the transcription levels of leuA (GenBank: BaLi_c30550) and leuS (GenBank: BaLi_c32470) had no significant change. However, the overexpression of yvmA was reported to have no effect on the production of PA because the expression of yvmA was enough for the efflux of PA in DW2 (27). Thus, the improvement of yvmC transcription level was considered to be one of the main reasons for the increase of PA production when the cells were induced by H₂O₂. Moreover, green fluorescent protein (GFP) was used as a report protein to detect the expression activity of promoter P_yvmC. The results showed that the GFP fluorescence intensity in DW2 was increased when cells were stimulated by H₂O₂ (Fig. 4C), which further proved that H₂O₂ stress could promote the expression of YvmC by enhancing the promoter activity of P_yvmC. It was worth noting that the PA production had no change in promoter substituted strain DW2-P_P43UTR12yvmC when H₂O₂ was added to the medium (Fig. 4D), which suggested that H₂O₂ mainly affected the expression rather than the protein activity of YvmC. Hence, we guessed that there is a transcription factor that can sense ROS to control the synthesis of PA.

Fig 4.

The synthesis of PA was induced by ROS under the control of transcription factor YvmB. (A) PA synthesis curve of DW2 in the ME medium with or without 0.5 mM H₂O₂ adding at 12 h. (B) Relative transcriptional levels of leuA, leuS, yvmC, and yvmA in DW2 cultured in the ME medium with or without 0.5 mM H₂O₂. Transcriptional levels of these genes in DW2 cultured in medium without H₂O₂ were regarded as 1. Data were detected at 15 min after treating with H₂O₂. (C) GFP fluorescence assay for detecting the promoter activity of yvmC in DW2 cultured in the ME medium with or without 0.5 mM H₂O₂. (D) PA synthesis curve of +yvmC in the ME medium with or without 0.5 mM H₂O₂. (E) PA synthesis curves of DW2ΔyvmB and DW2-P_P43yvmB (P₄₃yvmB) in the ME medium with or without 0.5 mM H₂O₂ adding at 12 h. (F,) Relative transcriptional level of yvmC in DW2, ΔyvmB, and P₄₃yvmB cultured in the ME medium with or without 0.5 mM H₂O₂. Transcriptional level of yvmC gene in DW2 cultured in medium without H₂O₂ were regarded as 1. Data were detected at 15 min after adding H₂O₂. (G) GFP fluorescence assay for detecting the promoter activity of yvmC in DW2, ΔyvmB, and P₄₃yvmB cultured in the ME medium with or without 0.5 mM H₂O₂. (H) Survival rates of DW2, ΔyvmB, and P₄₃yvmB under 2 mM H₂O₂ stress and PA yields of them detected at 12 h. (I,) Survival rates of ΔyvmC, ΔyvmCΔyvmB, +yvmC, and +yvmCΔyvmB under 2 mM H₂O₂ stress. All data are presented as mean ± SD (n ≥ 3 biological replicates). *: P < 0.05, **: P < 0.01, ***: P < 0.005, ns: P > 0.05, #: P < 0.05 but change fold 0.5 < FC < 2.

The suppression of transcription factor YvmB on PA synthesis is removed under H₂O₂ stress

Previous studies indicated that the transcription factors YvmB, YvnA, and AbrB had direct negative regulation on the expression of yvmC-cypX cluster (27). However, it has been reported that the expression level of YvnA is affected by iron concentration directly or indirectly, while the transcription factor AbrB lost DNA binding activity at transition state due to the phosphorylation (27, 30). Besides, YvmB might be one of the transcription factors in MarR (multiple antibiotic resistance regulator) family through sequence alignment, which widely distributed in bacteria and associated with environmental stress response (28).

Therefore, we constructed yvmB deletion strain (DW2ΔyvmB) and yvmB promoter substituted strain (DW2-P_P43yvmB) for excluding the effect of H₂O₂ stress on the transcription level of yvmB gene (GenBank: BaLi_c22650, the sequence was shown in Table S1). The results in Fig. 4E showed that the PA production of DW2ΔyvmB was higher than that of DW2-P_P43yvmB, which was the same with the previous study (27). On this basis, we found that the PA production of DW2ΔyvmB had no change whether H₂O₂ was added to the medium or not, while the PA production of DW2-P_P43yvmB was improved after adding H₂O₂ to the medium (Fig. 4E). Not only that, the detection of transcriptional level and promoter activity of yvmC gene presented the similar results that no matter H₂O₂ was added to the medium or not, the yvmC relative mRNA level and the GFP fluorescence intensity had no difference in DW2ΔyvmB, while they were all increased in DW2-P_P43yvmB when the H₂O₂ was added to the medium (Fig. 4F and G). The above results demonstrated that the inhibition of YvmB on PA synthesis was removed under H₂O₂ stress.

According to the above results, we further detected the PA production and the survival rates of DW2, DW2ΔyvmB, and DW2-P_P43yvmB under H₂O₂ stress. It was found that the PA production of these three strains was 53.45 µM/g DCW, 78.51 µM/g DCW, and 69.19 µM/g DCW, respectively, and the survival rate of DW2ΔyvmB (76.83%) was increased by 23.70% than that of DW2 (62.11%), while the sensitivity to H₂O₂ was restored in DW2-P_P43yvmB (Fig. 4H). The results illustrated that the deletion of yvmB indeed improved the survival rate of cells under H₂O₂ stress due to the higher PA production. More than that, we knock out the yvmB gene respectively in the strains DW2ΔyvmC and DW2-P_P43UTR12yvmC, in which the PA synthesis cannot be controlled by YvmB. As shown in Fig. 4I, the deletion of yvmB did not affect the cell survival of DW2ΔyvmC and DW2-P_P43UTR12yvmC under H₂O₂ stress, which further indicated that the transcription factor YvmB responded to H₂O₂ only by regulating the synthesis of PA.

The oxidation on cysteine residue (Cys-57) of YvmB lost the binding activity on the promoter of yvmC-cypX cluster

As reported, several MarR family transcriptional regulators can respond to the oxidation stress by forming intermolecular disulfide bond on cysteine residues to generate a dimer, such as OhrR, CosR, and so on (31–33). Moreover, we found that the C57 of YvmB might be a potential site for forming the intermolecular disulfide bond by protein sequence analysis. And the conservation of the cysteine residue in YvmB protein was presented in different Bacillus species (Fig. S5). To investigate whether C57 of YvmB was the oxidation site for sensing H₂O₂, we purified YvmB protein and its mutant YvmB^C57S (the encoding gene yvmB^C57S was shown in Table S1) with His-tag purification kit. Through non-reducing SDS-PAGE analysis, we found that purified YvmB existed as both monomer and dimer simultaneously, and monomeric YvmB could be oxidized by H₂O₂ to form dimer, while YvmB could not form the dimer when protein was incubated with excess DTT (DL-Dithiothreitol) (Fig. 5A). However, purified mutant YvmB^C57S existed as only monomer whether protein was incubated with H₂O₂ or DTT (Fig. 5A), which indicated that the cysteine residue (C57) in YvmB protein might be the oxidation site to respond H₂O₂ stress.

Fig 5.

The oxidation on cysteine residue (Cys-57) of YvmB lost the binding activity on the promoter of yvmC-cypX cluster. (A) Non-reducing SDS-PAGE assays of proteins, YvmB and YvmB^C57S. Purified YvmB and YvmB^C57S proteins were incubated for 30 min with 10 mM DTT or different concentrations of H₂O₂ (0, 2, 4, and 8 mM). M represents protein molecular mass marker (130, 100, 70, 55, 40, 35, 25, 15, and 10 KDa). Hollow arrows indicated the dimer of YvmB protein; solid arrows indicated the monomer of YvmB and YvmB^C57S proteins. (B) PA synthesis curves of P₄₃yvmB^C57S in the ME medium with or without 0.5 mM H₂O₂ adding at 12 h. (C) Electrophoretic mobility shift assays (EMSAs) for testing the binding activity of YvmB on probe P_yvmC (the sequence was shown in Table S1). (D) EMSA for testing the binding activity of YvmB^C57S on probe P_yvmC. Purified YvmB and YvmB^C57S proteins were incubated for 30 min with 4 mM DTT or H₂O₂ before EMSA. The concentration of YvmB and YvmB^C57S proteins are listed across the top in μM. Hollow triangles indicated the free probe; solid triangles indicated the complex of probe and protein. Probe in lane A was served as a negative control.

For further analyzing the effect of the oxidized YvmB on the PA synthesis, we constructed the mutant strain DW2-P₄₃yvmB^C57S by mutating the cysteine residue (C57) to serine in the strain DW2-P_P43yvmB. As shown in Fig. 5B, the PA production of DW2-P₄₃yvmB^C57S had no change when H₂O₂ was added to the medium. More than that, we found that the transcription level and promoter activity of yvmC gene in DW2-P₄₃yvmB^C57S had no difference whether H₂O₂ was added to the medium or not (Fig. S6), which illustrated that C57 is the oxidation site of YvmB for sensing the H₂O₂ to regulate the synthesis of PA.

To investigate how YvmB regulates the synthesis of PA by sensing H₂O₂, we detected the binding activity of YvmB on the promoter of yvmC gene by electrophoretic mobility shift assays (EMSAs) after protein was incubated with H₂O₂ or DTT (Fig. 5C). First, it was proved that YvmB had binding activity on the probe P_yvmC (the sequence was shown in Table S1), which is consistent with previous studies (27). Then, we found that YvmB lost the binding activity on P_yvmC after the protein was incubated with H₂O₂, while it bound more stronger on P_yvmC after the protein was incubated with DTT. The above results demonstrated that the inhibition of YvmB on yvmC-cypX cluster was removed due to the low binding activity on P_yvmC when YvmB was oxidated by H₂O₂. Moreover, we further detected the binding activity of mutant protein YvmB^C57S on the probe P_yvmC and the results displayed that the binding activity of YvmB^C57S on P_yvmC had no significant change no matter whether the protein was incubated with H₂O₂ or DTT (Fig. 5D). In general, we considered that transcription factor YvmB sensed H₂O₂ by forming intermolecular disulfide bond on C57 to generate a dimer and oxidized YvmB relieved the inhibition on yvmC-cypX cluster by losing the DNA-binding activity on the promoter of yvmC.

DISCUSSION

Iron-sulfur clusters consist of ferrous ion, sulfur atom, and cysteine, which are important active center of many enzymes in cells, such as ferredoxin, aconitase, and so on (34). Meanwhile, iron-sulfur clusters also participate in electron transfer, gene expression regulation, enzyme activity regulation, and play an essential role in most bacteria (19). However, iron is involved in the Fenton reaction to generate ·OH, which causes more damage to DNA and cells than other ROS (35, 36). These seemingly contradictory attributes of iron highlight its concentration-dependent dual nature. Our study showed that the survival rate of B. licheniformis DW2 under H₂O₂ stress was decreased obviously by adding free iron, while the synthesis of PA could reduce DNA damage to protect cells from oxidative stress by chelating free iron (Fig. 2). Also, we proved that the overexpression of gene pchC (encode PA synthases, GenBank: BSU_35070) in B. subtilis 168 decreased the intracellular ROS level and increased the cell survival rate (Fig. S7), which suggested the potential role of PA in helping bacteria to resist iron toxicity and oxidative stress. As reported, ROS is generated and accumulated when bacteria are exposed to stressful conditions (8). The results demonstrated that the synthesis of PA could increase the cell survival rate under adverse environments (salt, antibiotic, and temperature) by decreasing the intracellular ROS level (Fig. 5). Besides, it has been reported that the diffusible molecules and volatiles produced by competitors can induce PA production in B. subtilis (25). However, our study found that the environmental stresses mentioned here also can enhance the PA synthesis due to the ROS generation. Thus, we considered that the diffusible molecules and volatiles produced by competitor might be one of the environmental stresses for B. subtilis survival, which could transform into oxidative stress and further induce the PA synthesis.

Previous studies have indicated that PA cannot be synthesized when the concentration of free iron is lower than 1.87 µM maybe because Fe²⁺ is required for cytochrome P450 (encoded by cypX, GenBank: BaLi_c36290) (37, 38). Besides, the transcription factor YvnA negatively regulates the synthesis of PA, the expression of which was reported to be controlled by iron concentration (27). Thus, the PA synthesis was considered to be adjusted by the concentration of free iron. However, we proved that the expression of PA synthase was enhanced under H₂O₂ stress (Fig. 3), which suggested that the production of PA was not only controlled by iron concentration but also associated with ROS concentration.

Our study demonstrated that the cysteine residue at 57-site (C57) of transcription factor YvmB could be oxidized to form intermolecular disulfide bonds and dimer YvmB lost the DNA binding activity on the promoter region of yvmC-cypX cluster (Fig. 4). The above results revealed that the synthesis of PA was an evolved and proactive defense against oxidative stress for cell survival and this progress mainly responded by the oxidation of YvmB. Moreover, it has been reported that YvmB has direct positive regulation on yisI gene (encode aspartyl phosphate phosphatase, GenBank: BaLi_c12930), the expression of which reduced the sporulation process by specifically dephosphorylating the sporulation transcription factor Spo0A (28). We found that the sporulation in DW2ΔyvmB was increased compared with that in DW2 (Fig. S8) and the binding activity of oxidized YvmB on the promoter region of yisI gene was also weakened (Fig. S9). The results meant that the oxidation of YvmB to respond ROS not only improved the synthesis of PA but also enhanced the sporulation process, which all help cells to resist the adverse environment.

As we know, SigB (Protein: WP_023857858.1) and PerR (Protein: WP_003179961.1) are important oxidative response factors, Fur is an important factor to regulate intracellular iron ion concentration in Bacillus spp. (11, 39, 40). In order to investigate whether SigB could regulate the expression of yvmC-cypX, we knocked out gene sigB in B. licheniformis DW2 to construct the mutant DW2△sigB. Then, we detected the PA yield and biomass of DW2 and DW2△sigB at 12 h. The results showed that the deletion of sigB did not affect the synthesis of PA and cell growth (Fig. S10A). Meanwhile, the PA yield of DW2△sigB with or without H₂O₂ addition in ME medium showed that the addition of H₂O₂ could promote the synthesis of PA (Fig. S10B), which was similar to that of DW2 (Fig. 4A). Those results indicated that SigB was not the primary oxidative response factor to regulate the synthesis of PA when cells were simulated with ROS stress. Moreover, the binding activity of PerR or Fur proteins to the promoter of gene yvmC was detected. The results showed that PerR or Fur could not bind to the probe P_yvmC (Fig. S11), suggesting that PerR or Fur cannot directly regulate the expression of yvmC to affect the synthesis of PA. Therefore, YvmB is the primary factor that senses ROS stress to increase the synthesis of PA.

Overall, we found a new ROS response transcription factor YvmB reducing the generation of ·OH by increasing the PA synthesis (Fig. 6). In the case of no ROS accumulation, the synthesis of PA is mainly adjusted by iron concentration and transcription factor YvnA, which can ensure the normal growth of bacteria by balancing extracellular free iron concentration. On the other side, ROS will be generated and accumulated when bacteria are exposed to the stressful conditions. Under this circumstance, transcription factor YvmB will be oxidized to relieve the inhibition on yvmC-cypX cluster leading to an enhancement on PA production, which will further decrease the generation of ·OH by chelating free iron. Our study not only perfected the regulation mechanism of YvmB on PA synthesis but also demonstrated that both the oxidation of YvmB and the synthesis of PA were all one of the evolved proactive defense systems in bacteria against adverse environment. The ROS response pathway reported in this study is hoped to provide the idea in antioxidation studies as well as help Bacillus spp. to be applied better in biocontrol.

Fig 6.

ROS response pathway mediated by transcription factor YvmB protected cells from the adverse environment by increasing the PA synthesis. YvmB^red indicated the reduction state of YvmB; YvmB^ox indicated the oxidation state of YvmB. SOD, superoxide dismutase; ETC, electron transport chain.

MATERIALS AND METHODS

Microbial strains, plasmids, and growth conditions

The bacterial strains and plasmids that were developed and used in this study are listed in Table 1. All cloning steps were carried out in E. coli DH5α. Shuttled vector pHY300PLK (the sequence was shown in Table S1) was used to construct the overexpression vector and shuttled vector T2(2)-ori (the sequence was shown in Table S1) was used for gene knocked in and knocked out. The positive recombinant E. coli strain was used to obtain plasmids for the transformation of B. licheniformis.

TABLE 1.

Bacterial strains or plasmids used in the study

Strains or plasmids	Description	Source
Strains
Escherichia coli DH5α	supE44 ΔlacU169 (f 80 lacZΔM15) hsd R17 recA1 gyrA96 thi1 relA1	TaKaRa
Escherichia coli BL21(DE3)	F− ompT, hsdSB(rB− mB−), gal dcm (DE3)	TaKaRa
Bacillus licheniformis DW2	Wild-type (CCTCC M2011344)	Stored in lab
Bacillus subtilis 168	ΔtrpC2	Stored in lab
DW2ΔyvmC	Gene yvmC was deleted in DW2	This study
DW2-PP43UTR12yvmC	Gene yvmC under control of the constitutive promoter PP43UTR12 in DW2	This study
DW2Δfur	Gene fur was deleted in DW2	This study
DW2ΔfurΔyvmC	Gene yvmC was deleted in DW2Δfur	This study
DW2Δfur-PP43UTR12yvmC	Gene yvmC under control of the constitutive promoter PP43UTR12 in DW2Δfur	This study
DW2ΔyvmB	Gene yvmB was deleted in DW2	This study
DW2-P43yvmB	Gene yvmB under control of the constitutive promoter P43 in DW2	This study
DW2ΔyvmCΔyvmB	Gene yvmB was deleted in DW2ΔyvmC	This study
DW2-PP43UTR12yvmCΔyvmB	Gene yvmB was deleted in DW2-PP43UTR12yvmC	This study
DW2-P43yvmBC57S	Gene yvmB was substituted by yvmBC57S and controlled by the constitutive promoter P43	This study
BS168-P43pchC	Gene pchC under control of the constitutive promoter P43 in BS168	This study
DW2/pHY-PyvmCgfp	DW2 with plasmid pHY-PyvmCgfp	This study
DW2ΔyvmB/pHY-PyvmCgfp	DW2ΔyvmB with plasmid pHY-PyvmCgfp	This study
DW2-PP43yvmB/pHY-PyvmCgfp	DW2-PP43yvmB with plasmid pHY-PyvmCgfp	This study
DW2-P43yvmBC57S/pHY-PyvmC gfp	DW2-P43yvmBC57S with plasmid pHY-PyvmCgfp	This study
BL21/pET28a-yvmB	BL21 with plasmid pET28a-yvmB	This study
BL21/pET28a-yvmBC57S	BL21 with plasmid pET28a-yvmBC57S	This study
Plasmids
T2(2)-ori	E. coli and B. licheniformis shuttle vector, OripUC/Orits, Kanr	Stored in lab
T2-ΔyvmC	T2(2)-ori derivative harboring homologous arms for yvmC deletion, orist, Kanr	This study
T2-Δfur	T2(2)-ori derivative harboring homologous arms for fur deletion, orist, Kanr	This study
T2-ΔyvmB	T2(2)-ori derivative harboring homologous arms for yvmB deletion, orist, Kanr	This study
T2-PP43UTR12yvmC	T2(2)-ori derivative harboring homologous arms and PP43UTR12 promoter for yvmC promoter substitution, orist, Kanr	This study
T2-P43yvmB	T2(2)-ori derivative harboring homologous arms and P43 promoter for yvmB promoter substitution, orist, Kanr	This study
T2-P43yvmBC57S	T2(2)-ori derivative harboring homologous arms, P43 promoter and yvmBC57S gene substitution, orist, Kanr	This study
T2-P43pchC	T2(2)-ori derivative harboring homologous arms and P43 promoter for pchC promoter substitution, orist, Kanr	This study
pHY300PLK	E. coli-Bacillus shuttle vector; Ampr in E. coli	Stored in lab
pHY-PyvmCgfp	pHY300PLK derivative containing gfp gene, yvmC promoter, and amyl terminator, Tcr	This study
pET28a(+)	Protein expression vector in BL21(DE3), Kanr	Stored in lab
pET28a-yvmB	pET-28a(+) derivation containing yvmB gene, Kanr	This study
pET28a-yvmBC57S	pET-28a(+) derivation containing yvmBC57S gene, Kanr	This study

For plasmid construction and positive colonies screening, the strains were cultivated at 37°C in LB medium (10 g/L tryptone, 5 g/L yeast extract, and 10 g/L NaCl) containing 20 µg/mL tetracycline or 25 µg/mL kanamycin as needed. And the LB medium was used as seed medium for the preparation of recombinant B. licheniformis seeds. ME medium [20 g/L glucose, 12 g/L sodium citrate, 7 g/L (NH₄)₂SO₄, 0.50 g/L K₂HPO₄·3H₂O, 0.50 g/L MgSO₄·7H₂O, 0.04 g/L FeCl₃·6H₂O (0.15 mM Fe³⁺), 0.01 g/L MnSO₄·H₂O, and 0.15 g/L CaCl₂, pH 7.5] was used for PA fermentation. MEF medium [20 g/L glucose, 12 g/L sodium citrate, 7 g/L (NH₄)₂SO₄, 0.50 g/L K₂HPO₄·3H₂O, 0.50 g/L MgSO₄·7H₂O, 0.01 g/L MnSO₄·H₂O, and 0.15 g/L CaCl₂, pH 7.5] was used to confirm the iron toxicity.

For B. licheniformis and its recombinant strains, colonies were inoculated into seed medium with 20 µg/mL tetracycline and cultured for 12 h at 37°C and 230 rpm. Then, 3% (vol/vol) of the precultured seeds were inoculated into 50 mL ME fermentation medium without antibiotics in 250 mL shake flasks and cultured for 36 h at 37°C and 230 rpm.

Construction of plasmids and recombinant strains

To construct the gene deletion vectors, temperature-sensitive T2(2)-ori plasmid with kanamycin resistance was used. All of the primers used in this work are listed in Table 2. The construction procedures of yvmC deletion vector and strain were served as the examples. For yvmC deletion, the upstream and downstream fragments of gene yvmC were amplified by the primers yvmC-F1/R1 and yvmC-F2/R2 based on the genomic DNA of B. licheniformis DW2, respectively (Table 2). And the upstream and downstream fragments were fused by Splicing Overlapping Extension PCR (SOE-PCR) with primers yvmC-F1/R2. The fused fragment was inserted into the plasmid T2(2)-Ori at the restriction sites BamH I/Xba I, and colony PCR and DNA sequence were performed to confirm that the yvmC deletion vector was constructed successfully, named as T2-ΔyvmC. Then, T2-ΔyvmC was electro-transferred into B. licheniformis DW2, and the positive transformant was cultivated in LB medium with 20 mg/mL kanamycin at 220 rpm and 45°C, and subcultured for three times to obtain the single-crossover recombinants. The recombinants were grown in LB medium at 37°C with six subcultures, and the kanamycin-sensitive colonies were further confirmed by colony PCR and DNA sequence, and the yvmC deletion strain was named DW2ΔyvmC.

TABLE 2.

Primers used in the study^a

Primer	Sequence (5′→3′)
The primers used for plasmid construction
T2-ΔyvmC-AF	CTGCAGCCCGGGGGATCCCTCCTTTATCAATGTCAACGAAC
T2-ΔyvmC-AR	TTAGATTCCACACTTTCGTCCGGGCGTCTGCGTTTTAGTATTTC
T2-ΔyvmC-BF	GAAATACTAAAACGCAGACGCCCGGACGAAAGTGTGGAATCTAA
T2-ΔyvmC-BR	GATCTTTTCTACGAGCTCAGCGAGCTGTTCACTGCATTTA
T2-ΔyvmC-YF	GATGAACAGCGAGACGGACAG
T2-ΔyvmC-YR	CATCGCTACTCCCTCGTATTCG
T2-Δfur-AF	CTGCAGCCCGGGGGATCCAACTGGATGATGGTAAGCCTTGT
T2-Δfur-AR	AGGAGGGAAAGTCAATGGAAACTGTCAGCAAAAGGAATCGGAA
T2-Δfur-BF	TTCCGATTCCTTTTGCTGACAGTTTCCATTGACTTTCCCTCCT
T2-Δfur-BR	GATCTTTTCTACGAGCTCTCGGGATTTCCATCATCGG
T2-Δfur-YF	ACTTCCTGTAATGACAGCACCTTC
T2-Δfur-YR	TAATGGGTGTGATTTTCGGC
T2-ΔyvmB-AF	CTGCAGCCCGGGGGATCCCGAGCTGGGAGGGACTTTT
T2-ΔyvmB-AR	TTCCTATCCGTTTCTGTCATAAGTGTCAGTTCAGACATAGTCAATGGAC
T2-ΔyvmB-BF	GTCCATTGACTATGTCTGAACTGACACTTATGACAGAAACGGATAGGAA
T2-ΔyvmB-BR	GATCTTTTCTACGAGCTCACAGGAGAACGCTTCCACATC
T2-ΔyvmB-YF	CTTTTAGCCAGGGATGGACAAC
T2-ΔyvmB-YR	GCGGTTTCCGTCAGCATC
T2-PP43UTR12yvmC-AF	CTGCAGCCCGGGGGATCCCGTATTCAACAGCCAGCTCC
T2-PP43UTR12yvmC-AR	ATATTAGAAAGGAGGAATATATAATGACAGAGCTTACAATGGAGAG
T2-PP43UTR12yvmC-BF	CTCTCCATTGTAAGCTCTGTCATTATATATTCCTCCTTTCTAATAT
T2-PP43UTR12yvmC-BR	CTTTCATGCTGTACCTTGCCTGCGGAATTTCCAATTTCATGC
T2-PP43UTR12yvmC-CF	GCATGAAATTGGAAATTCCGCAGGCAAGGTACAGCATGAAAG
T2-PP43UTR12yvmC-CR	GATCTTTTCTACGAGCTCGTAATGAAGATGAACAGCGAGAC
T2-PP43UTR12yvmC-YF	ACGGTGATAAGCAAGAAGCG
T2-PP43UTR12yvmC-YR	AAGAAACAGTCCAAAGTCCCGT
T2-P43yvmB-F1	CTGCAGCCCGGGGGATCCTAATAGGCATCTTTTAGCCAGGG
T2-P43yvmB-R1	AGCGAAAACATACCACCTATCAGGTGATGTATGTTCAGATGCCC
T2-P43yvmB-F2	GGGCATCTGAACATACATCACCTGATAGGTGGTATGTTTTCGCT
T2-P43yvmB-R2	GTTTTGTCAGTTCAGACATAGTCAAGTGTACATTCCTCTCTTACCTA
T2-P43yvmB-F3	TAGGTAAGAGAGGAATGTACACTTGACTATGTCTGAACTGACAAAAC
T2-P43yvmB-R3	GATCTTTTCTACGAGCTCAAGGGGTTTCTTGTCAATCGC
T2-P43yvmB-YF	TCAAAAGGCGTCAACTAACGG
T2-P43yvmB-YR	CCTCGCCATTCACTTCACCTC
T2-P43pchC-AF	CTGCAGCCCGGGGGATCCTTCCTTGATCAGTTTTGTGC
T2-P43pchC-AR	CCCTGGCTAAAAGATGCCTATTATCAATACCCATATCATGA
T2-P43pchC-BF	TCATGATATGGGTATTGATAATAGGCATCTTTTAGCCAGGG
T2-P43pchC-BR	TTCCGTTACCATTCCGGTCATGGTGATGTATGTTCAGATGCCC
T2-P43pchC-CF	GGGCATCTGAACATACATCACCATGACCGGAATGGTAACGGAA
T2-P43pchC-CR	GATCTTTTCTACGAGCTCGCTCAGCTATGACATATTCCAC
T2-P43pchC-YF	CTCATGTAAGTCGAAAATCCG
T2-P43pchC-YR	GTTTTACTCCCCCTATCATCC
pHY-PyvmCgfp-AF	TTTTTATAACAGGAATTCCTTTCATGCTGTACCTTGCCT
pHY-PyvmCgfp-AR	TATATATTCCTCCTTTCTAATATACTGATTTCCTCCTTAACGGAC
pHY-PyvmCgfp-BF	GTCCGTTAAGGAGGAAATCAGTATATTAGAAAGGAGGAATATATA
pHY-PyvmCgfp-BR	TATGAGTAAACTTGGTCTGACAGTTACTTGTACAGCTCGTCCATGC
pHY-PyvmCgfp-CF	GCATGGACGAGCTGTACAAGTAACTGTCAGACCAAGTTTACTCATA
pHY-PyvmCgfp-CR	TTGCCCAAGCTTCTAGAGATCTTCACCTAGATCCTTTTA
pHY-YF	TTGTCATTAGTTGGCTGGTT
pHY-YR	GGGAAACGCCTGGTATCTT
pET28a-yvmB-F	CAAATGGGTCGCGGATCCTTGACTATGTCTGAACTGA
pET28a-yvmB-R	GTGGTGGTGGTGGTGGTGTTGTTTCCTATCCGTTTCTGTCATA
pET28a-yvmBC57S-F	ATCATCACCGATACTGCTGATGACATGGATGGTCGTCATA
pET28a-yvmBC57S-R	TGTCATCAGCAGTATCGGTGATGATGAACCGATTAATAAT
The primers used for RT-qPCR
16S-F	ACCGTTAACCGCGTACGAAA
16S-R	AGCGATGACTCCCGTACCTT
yvmC-RT-F	CATACCAGCGTTTGCGGATG
yvmC-RT-R	GACGGCAAATTCATGACGGG
yvmB-RT-F	TCCTGCACCTGAACGAACAA
yvmB-RT-R	GGCGTCAGCCTGAAGTAGAT
yvmA-RT-F	GTCGGCTTGCTGTATTTGCC
yvmA-RT-R	GTGACGCCGAAAAGAACGAG
yvnA-RT-F	ATCAGCGAAAACGAGGCAGA
yvnA-RT-R	AAAGCGGATGACGGTTTCCA
leuS-RT-F	CGTCTACCACGAAACGGTCA
leuS-RT-R	CTCCACAGCTCTTCAGCCAA
leuA-RT-F	CATTCACCAGGACGGCTTCT
leuA-RT-R	GATTTTGCGGTCTGCCGTTT
The primers used for probe amplification in EMSA
EMSA-PyvmC-F	b GTTGACAACTGGAAAAGATAGGG
EMSA-PyvmC-R	GTCTGCGTTTTAGTATTTCATTGC
EMSA-PleuS-F	b AGAGAGTTGACGGCTGGTGAA
EMSA-PleuS-R	TTGTAAAAACCTCCTTTGAATA
EMSA-PyisI-F	ACAACCGTCACATACAGCCGA
EMSA-PyisI-R	GCCTCTTTGGAGTTGATGCC

^a The bold words refer to the sites of restriction endonuclease.

^b Refers to primers labeled by biotin.

For gene overexpression strain, the method of allelic replacement was used, which simply means a strong constitutive promoter P_P43UTR12 (29) was used to replace the promoter of target genes. This method was similar to gene knockout as described above, like the overexpression of yvmC, the upstream and downstream fragments of promoter yvmC were amplified by the primers P_P43UTR12yvmC-F1/R1 and P_P43UTR12yvmC-F3/R3 based on the genomic DNA of B. licheniformis DW2, respectively (Table 1). P_P43UTR12 promoter was amplified and optimized by the primers P_P43UTR12yvmC-F2/R2 from the genomic DNA of B. subtilis 168 (29). And the upstream, P_P43UTR12 promoter and downstream fragments were fused by SOE-PCR with primers P_P43UTR12yvmC-F1/R3. The fused fragment was inserted into the plasmid T2(2)-Ori at the restriction sites BamH I/Xba I, and colony PCR and DNA sequence were performed to confirm that the yvmC overexpressed vector was constructed successfully, named as T2-P_P43UTR12yvmC. Then, T2-P_P43UTR12yvmC was electro-transferred into B. licheniformis DW2, and the positive transformant was cultivated in LB medium with 20 mg/mL kanamycin at 220 rpm and 45°C, and subcultured for three times to obtain the single-crossover recombinants. The recombinants were grown in LB medium at 37°C with six subcultures, and the kanamycin-sensitive colonies were further confirmed by colony PCR and DNA sequence, and the yvmC overexpressed strain was named DW2-P_P43UTR12yvmC.

Analysis of PA concentration

The red pigment produced by B. licheniformis DW2 was shown to be pulcherrimin in our previous research (38). Two milliliters of culture broth were centrifuged at 10,000 × g for 2 min. Pellets (containing cells and pulcherrimin) were washed two times with deionized water, and resuspended in 2 M NaOH solution to dissolve pulcherrimin to form PA. The absorbance at 410 nm was used to characterize the PA content.

H₂O₂-kill assay and generation of growth curves

Overnight cultures in Luria–Bertani broth were inoculated into ME medium and grown at 37°C to mid-log phase (12 h). Cells were then treated with 2 mM H₂O₂, and after 15 min of incubation, samples were diluted and plated on Luria–Bertani broth agar, and incubated at 37°C for 16–18 h. Cell survival was determined by counting CFU and is shown as the mean value ± SD from three independent experiments.

Subcultures of specified strains were grown overnight at 37°C, diluted in fresh medium at 1:100, inoculated into conical flasks in triplicate, and grown at 37°C with 230 rpm. When the cultures reached an OD₆₀₀ of 0.5, cells were treated with H₂O₂ (2 mM) and incubated at 37°C for 12 h. OD₆₀₀ values were recorded automatically at specified times, and the mean value of the triplicate cultures was plotted.

Determination of ROS

The intracellular ROS levels were measured by reactive oxygen species assay kit (Beyotime, China). In brief, appropriate amount of cell pellets were collected at 5000 rpm at 4°C for 2 min. And the cell pellets were washed two times with PBS solution and then were resuspended with PBS solution containing 10 µM 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) which can be absorbed into cells freely and be oxidized to DCF, a fluorescent product. The mixtures were incubated at 37°C for 25 min, and then cell pellets were harvested and washed three times with PBS solution to remove extracellular residual DCFH-DA. The fluorescence value of resuspended cells was measured at excitation and emission wavelengths of 485 and 525 nm by using Multi-Mode Microplate Reader (SpectraMax iD3; Molecular Devices).

DNA damage assay

The DNA damage rate was detected according to the previous study (16). Overnight cultures in LB broth were inoculated into ME medium and grown at 37°C to mid-log phase (12 h), and 1 mL aliquots was treated with 2 mM H₂O₂ for 30 min. Cells were fixed and labeled using a protocol for the One Step TUNEL Apoptosis Assay Kit (Beyotime Biotechnology, China). Then, the DNA damage rate was measured according to the user manual.

RNA extraction and RT-qPCR

B. licheniformis cells were grown until mid-log phase (12 h), and total RNA was extracted using the RNA extraction kit according to the manufacturer’s protocol. All RNA samples were treated with DNaseI (Fermentas); 500 ng total RNA was reverse-transcribed with 100 U SuperScript III enzyme from the First-Strand Synthesis Kit for RT-qPCR (Invitrogen) according to the manufacturer’s protocol in the presence of appropriate gene-specific primers (Table 2). One microliter reverse transcription reaction was used as the template for real-time PCR. The gene encoding 16S was used for normalization. Each real-time PCR mixture (25 µL) contained 10 µL SYBR Green I PCR Master Mix (Syntol), 12 µL nuclease-free H₂O, 1 µL 10 µM forward primer, 1 µL 10 µM reverse primer, and 1 µL cDNA template. Amplifications were carried out using the DTlite S1 CyclerSystem (DNA Technology). Reaction products were analyzed using 2% agarose electrophoresis to confirm that the detected signals originated from products of expected lengths. Each RT-qPCR was performed at least in triplicate, and average data were reported. Error bars correspond to the SD.

Construction, expression, and purification of 6His-YvmB and 6His-YvmB^C57S

Gene yvmB was cloned into pET28a and expressed in E. coli strain BL21 (DE3). Simply, primers yvmB-F and yvmB-R were used to amplify the yvmB gene from B. licheniformis DW2 chromosomal DNA. The amplified fragments were inserted into pET28a at EcoR I and Xho I to produce the plasmids pET28a-yvmB. Clones were verified by DNA sequencing and transformed into BL21 (DE3) for expression. The construction of pET28a-yvmB^C57S was the same. The expression and purification procedures for YvmB and YvmB^C57S are described as follows. The strains were grown at 37°C overnight in 5 mL of LB medium containing 20 mg/mL kanamycin. Then, the cultures were transferred into 100 mL of LB medium containing 20 mg/mL kanamycin, incubated at 37°C until the OD₆₀₀ reached 0.6–1.0, and IPTG (isopropyl-1-thio-b-Dgalactopyranoside) was added to a final concentration of 0.4 mM. After 18–24 h incubation at 16°C, the cells were harvested by centrifugation. The cells were lysed at 4°C by high pressure crusher in lysis buffer which containing 10 mM Tris (pH 8.0), 300 mM NaCl, and 50 mM Na₂HPO₄. The clarified cell lysate was loaded onto a Ni NTA Beads 6FF (Smart Lifesciences), washed with Ni-NTA wash buffer and eluted with Ni-NTA elution buffer. The protein YvmB and YvmB^C57S were dissolved in a buffer containing 50 mM Na₂HPO₄ (pH 8.0), 300 mM NaCl, and 10% glycerol.

Electrophoretic mobility shift assay

EMSA was performed using the method of Wang et al. (27). The probe was amplified from B. licheniformis DW2 chromosomal DNA by using biotin-labeled primer pairs (Tsingke, China). EMSAs were carried out by using the chemiluminescence EMSA kits (Beyotime, China) according to the manufacturer’s instructions. Samples were analyzed in 8% native-PAGE gels. Proteins were transblotted to nylon membranes (Beyotime, China) by use of a mini-transblot electrophoresis apparatus (Liuyi, China). Membranes were treated and analyzed by use of an MF-Chemi Bis chemiluminescence imaging system (DNR Bio-Imaging Systems, Israel).

Analysis of YvmB oxidation in vitro by SDS-PAGE

Purified His6-tagged YvmB and YvmB^C57S proteins were treated with 20 mM of H₂O₂ at 37°C for 30 min to oxidize YvmB and YvmB^C57S. Disulfide-bond formation was monitored by non-reducing SDS-PAGE (without 2-Mercaptoethanol or DTT).

GFP expression assay

The GFP mediated by yvmC promoter was used to verify the effect of YvmB on yvmC expression in the intracellular. To construct the related vector, yvmC promoter and amyL terminator were amplified by the primers P_yvmC-F1/R1 and P_yvmC-F3/R3 from B. licheniformis DW2, gene gfp (the sequence was shown in Table S1) was amplified by the primers P_yvmC-F2/R2, and fused by SOE-PCR. The fused fragment was inserted into pHY300PLK at the restriction sites EcoR I/Xba I, and the positive plasmid pHY-P_yvmCgfp was selected by colony PCR and DNA sequence. Then, pHY-P_yvmCgfp was introduced into DW2 and DW2ΔyvmB by electro-transformation, resulting in the GFP overexpression strain, named DW2/pHY-P_yvmCgfp and DW2ΔyvmB/pHY-P_yvmCgfp.

Overnight cultured seeds were inoculated into ME medium and grown at 37°C to mid-log phase (12 h), and 0 mM or 0.5 mM H₂O₂ was added to the medium. The fluorescence intensity of GFP was measured every 1 h at excitation and emission wavelengths of 480 and 520 nm by using Multi-Mode Microplate Reader (SpectraMax iD3; Molecular Devices).

DATA AVAILABILITY

Data in this study are shown in the main manuscript and the Supplementary Materials and are available from the corresponding author upon request. Strains and plasmids constructed in this work are listed in Table 1 and are available upon request. The GenBank of related genes were shown in this manuscript and the sequences of related genes, promoters, and plasmids were listed in Table S1.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/aem.01468-23.

Fig. S1 to Fig. S11, Table S1. aem.01468-23-s0001.docx.

Fig. S1 (Cell growth curve of B. licheniformis DW2 in ME culture), Fig. S2 (Analysis of pulcherriminic acid biosynthetic genes and the transcription factors), Fig. S3 (Effects of different adverse conditions on PA synthesis and cell growth of DW2 in ME culture), Fig. S4 (The effects of NaCl, ampicillin, or 45{degree sign}C stimulation on SOD, CAT, and POD synthesis), Fig. S5 (Multiple sequence alignment of YvmB from different Bacillus species), Fig. S6 (Effects of YvmBC57S expression on the relative transcriptional level of yvmC and the activity of yvmC promoter PyvmC under H2O2 stress), Fig. S7 (Effects of overexpressed gene pchC on PA synthesis, ROS accumulation and cell survival in B. subtilis 168), Fig. S8 (The number of spores calculated in yvmB deleted strains compared with wild-type), Fig. S9 (EMSA for testing the binding activity of YvmB on probe PyisI), Fig. S10 (The effects of gene sigB deletion on PA synthesis), Fig. S11 Electrophoretic mobility shift assays [EMSA] for testing the binding activity of Fur and PerR on probe PyvmC), and Table S1 (Gene sequence of related genes, promoters, or plasmids used in this study).

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.