Effects of betaine on growth performance and intestinal health of rabbits fed different digestible energy diets

Abstract

An experiment was conducted to determine the effects of betaine on growth performance and intestinal health in rabbits fed diets with different levels of digestible energy. During a 36-d experiment, a total of 144 healthy 35-d-old weaned New Zealand white rabbits with a similar initial body weight (771.05 ± 41.79 g) were randomly distributed to a 2 × 3 factorial arrangement. Experimental treatments consisted of two levels of digestible energy (normal: 10.20 and low: 9.60 MJ/kg) and three levels of betaine (0, 500, and 1,000 mg/kg). Results indicated that rabbits fed the diet with low digestible energy (LDE) had reduced body gain/feed intake on days 1 to 14 and 1 to 36 (P < 0.05), increased the apparent total tract digestibility (ATTD) of neutral detergent fiber, acid detergent fiber (ADF), and n-free extract, and decreased the ATTD of gross energy (GE), crude fiber, and organic matter (OM; P < 0.05). The LDE diet upregulated the gene abundance levels of duodenum junctional adhesion molecule-3 (JAM-3) and downregulated the ileum toll-like receptor 4, myeloid differentiation factor 88, and interleukin-6 (IL-6; P < 0.05). Activities of amylase, lipase, trypsin, and the immunoglobulin M content in the jejunum were decreased in the LDE treatment group (P < 0.05). Dietary betaine supplementation increased the ATTD of GE, dry matter (DM), ADF, and n-free extract by LDE (P < 0.05). The villus height, crypt depth, and goblet cell numbers were decreased, and the villus–crypt ratio was increased in the duodenum (P < 0.05). The gene abundance levels of duodenum IL-2 were downregulated, and the duodenum JAM-2 and JAM-3 were upregulated (P < 0.05). Furthermore, the addition of betaine to the LDE diet increased the ATTD of GE, DM, and OM in rabbits (P < 0.05). Gene abundance levels of ileum IL-6 and duodenum JAM-3 were upregulated (P < 0.05). In summary, LDE diets can reduce the activity of intestinal digestive enzymes and decrease the ATTD of nutrients. However, the addition of betaine to LDE diets improved the intestinal barrier structure and nutrient ATTD in rabbits, with better results when betaine was added at an additive level of 500 mg/kg.

Dietary betaine can alleviate the adverse effects of low dietary energy on rabbit production.

Introduction

Rabbits are monogastric hindgut fermenting herbivores with a short breeding cycle, high litter size, and a high feed conversion rate (Lebas et al., 1986). Rabbit meat is very healthy due to its high polyunsaturated fatty acid and protein content, low cholesterol level, and sodium content (Dalle Zotte and Szendro, 2011). Therefore, rabbits are also becoming increasingly popular in China as quality meat-producing animals. However, rabbits are relatively sensitive, fragile, and prone to intestinal diseases, thus affecting production levels and efficiency (Bischoff, 2011). Betaine, also known as trimethylglycine, has a variety of beneficial physiological functions, such as anti-oxidant stress (Park and Kim, 2017), stimulated feeding inducement (Felix and Sudharsan, 2015), and it can partly replace the methyl donor effect of methionine, which has the effect of saving methionine (Rao et al., 2011). Betaine acts as an efficient methyl donor and its unstable methyl treatment group is directly involved in the transmethylation reactions of various metabolic processes; thus, it may have a greater impact on protein and energy metabolism (Mahmoudnia and Madani, 2012). Dietary betaine improved body gain/feed intake (G:F; Siljander-Rasi et al., 2003), reduce backfat thickness (Matthews et al., 2001), reduce the amount of energy required for heat production and maintenance (Schrama et al., 2003), and increase average daily feed intake (ADFI) and average daily gain (ADG) in growing pigs (Amer et al., 2018). Thus, betaine improves energy use in animals, and the benefits of betaine seem to be more pronounced when energy intake is limited (Cromwell et al., 2000).

Betaine has been widely studied in pig and poultry production, but its effects on production performance are inconsistent (Feng et al., 2006; Chen et al., 2018), the reasons for which may be related to the level and form of betaine addition, feeding and management conditions, and animal species, or it may be the result of different dietary Met levels. In rabbit production, dietary betaine alleviates heat stress and increases ADG, thus improving production performance (El-Moniem et al., 2016; Elsawy et al., 2017). Studies in other animals have found that betaine appears to have positive effects on animal intestinal health and function, such as enhancing intestinal barrier function (Shakeri et al., 2019; Wu et al., 2020), increasing digestive enzyme activity (Wang et al., 2020), changed intestinal morphology (Norouzian et al., 2018), and intestinal microbiota structure (Wang et al., 2018). It can be seen that betaine has the effect of improving the animal’s intestinal health and energy utilization, and we hypothesized that by adding betaine to low digestible energy (LDE) diets, betaine could improve the efficiency of energy utilization and intestinal health by influencing the intestinal structure and function of rabbits, thus improving the performance of rabbits. Therefore, this experiment aimed to research the effects of adding different levels of betaine (0, 500, and 1,000 mg/kg) on growth performance and intestinal health of rabbits fed diets containing normal digestible energy (NDE, 10.20 MJ/kg) or LDE (9.60 MJ/kg).

Materials and Methods

Ethics statement

All animal procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals prepared for Sichuan Agricultural University, and all animal protocols were approved by the Animal Care and Use Committee of Sichuan Agricultural University (Approval number: SICAU20210929).

Experimental designs, diets, and animal management

This study was conducted in the teaching and research base of Animal Nutrition Institute, Sichuan Agricultural University. A total of 144 healthy 35-d-old weaned New Zealand white rabbits with similar initial body weight (771.05 ± 41.79 g) were purchased from Hongzhan Family Farm, Jintang County, Chengdu. Rabbits were randomly divided into six treatment groups with 24 replicates per treatment group and one rabbit per replicate. Two different diets were formulated with two levels of digestible energy (normal: 10.20; low: 9.60 MJ/kg) diet with (0, 500, or 1,000 mg/kg) synthetic betaine (Yixing Tianshi Feed Co., Ltd.) in 2 × 3 factorial design (Table 1).

Table 1.

Ingredients composition and nutrients level of experimental diets (as-fed basis)

Ingredients, %	Betaine levels, mg/kg
	0	500	1,000	0	500	1,000
Corn	8.26	8.26	8.26	8.00	8.00	8.00
Corn germ meal	24.31	24.31	24.31	25.00	25.00	25.00
Soybean meal	11.35	11.35	11.35	9.19	9.19	9.19
Peanut vine	27.70	27.70	27.70	29.96	29.96	29.96
Rice bran	9.90	9.90	9.90	15.00	15.00	15.00
Rice bran and hulls	13.41	13.41	13.41	11.00	11.00	11.00
Soybean oil	3.00	3.00	3.00	—	—	—
CaCO3	0.08	0.08	0.08	0.22	0.22	0.22
CaHPO4·2H2O	0.36	0.36	0.36	—	—	—
NaCl	0.50	0.50	0.50	0.50	0.50	0.50
l-Lys HCl	0.02	0.02	0.02	0.03	0.03	0.03
l-Met	0.05	0.05	0.05	0.04	0.04	0.04
l-Thr	0.06	0.06	0.06	0.06	0.06	0.06
Premix1	1.00	1.00	1.00	1.00	1.00	1.00
Total, 100%	100.00	100.00	100.00	100.00	100.00	100.00
Nutrients level
DE, MJ/kg diet	10.20 (9.93)2	10.20 (9.93)	10.20 (9.93)	9.60 (9.50)	9.60 (9.50)	9.60 (9.50)
CP	15.07 (15.93)	15.07 (15.93)	15.07 (15.93)	15.07 (16.07)	15.07 (16.07)	15.07 (16.07)
CF	16.25 (21.50)	16.25 (21.50)	16.25 (21.50)	16.25 (20.86)	16.25 (20.86)	16.25 (20.86)
NDF	34.10 (42.94)	34.10 (42.94)	34.10 (42.94)	35.00 (43.82)	35.00 (43.82)	35.00 (43.82)
ADF	21.23 (23.17)	21.23 (23.17)	21.23 (23.17)	21.39 (23.23)	21.39 (23.23)	21.39 (23.23)
Acid detergent lignin	5.58	5.58	5.58	5.63	5.63	5.63
Calcium	0.60	0.60	0.60	0.60	0.60	0.60
Total phosphorus	0.50	0.50	0.50	0.50	0.50	0.50
Lys	0.73	0.73	0.73	0.73	0.73	0.73
Met + Cys	0.52	0.52	0.52	0.52	0.52	0.52
Thr	0.62	0.62	0.62	0.62	0.62	0.62

¹The premix provided the following per kg of diets: VA 6,000 IU; VD₃ 1,200 IU; VE 50 IU; VK₃ 2.4 mg; biotin 240 μg; choline 100 mg; pyridoxine 1.8 mg; riboflavin 3.6mg; VB12 12.5μg; nicotinamide 20 mg; pantothenic acid 12.5 mg; Fe 30 mg; Cu 6 mg; Zn 35mg; Mn 8 mg; Se 0.05 mg; Co 0.3 mg; I 0.4 mg.

²Values in parentheses are measured values.

The basal diets were formulated regarding the recommended nutritional requirements of Nutrition of the Rabbit, 3rd Edition (Blas and Wiseman, 2020) to meet the optimal nutritional requirements of rabbits. All diets were made into pellets with a diameter of 3.00 mm, and the dietary formula and nutritional levels are shown in Table 1. The rabbits were weighed on an empty stomach in the morning before the experiment, and then randomly assigned to single cages (50 cm × 50 cm × 40 cm, length × width × height) equipped with troughs and nipple drinkers, and the rabbits were offered feed and water on an ad libitum basis for a total of 36 d until the end of the experiment (61st day of age). The temperature and humidity of feeding environment were observed and recorded with a temperature and humidity meter every day prior to feeding.

Sample collection

Blood sampling

At 6 a.m. on the 15th day of the experiment, the rabbits were weighed (fasting for 12 h). Six healthy rabbits whose body weight was close to the average body weight of each treatment group were selected for heart blood collection. About 10 mL of whole blood was injected into an anticoagulant-free vacuum blood tube. After standing at room temperature for 30 min, the upper serum samples were then collected in Eppendorf tubes, and stored at −20  °C.

Visceral organs, small intestine tissue, and digesta sampling

After blood collection, the six rabbits were electricity stunned (50 V, pulsed direct current, 60 Hz for 5 s) and killed by cervical dislocation, the organs (liver, kidney, thymus, appendix, and sacculus rotundus) and intestinal segments (duodenum, jejunum, and ileum) were rapidly separated after slaughter, and the organs were weighed. The jejunal chyme was placed in 2 mL frozen tubes, snap-frozen in liquid nitrogen, and stored at −80 °C for further analysis. The isolated duodenum, jejunum, and ileum were washed with pre-cooled physiological saline (90% NaCl), and 2 cm middle tissue samples were taken in 4% paraformaldehyde solution, and stored at room temperature. Another 5 cm tissue sample from each intestinal segment was placed in a 2 mL frozen tube, snap-frozen in liquid nitrogen, and stored at −80 °C.

Feed and feces sampling

About 200 g of diet was sampled from each treatment group using the quadrant method, and the diet samples were crushed and sieved through 18 and 40 mesh sieves, respectively, and stored at −20 °C.

Digestion experiments were performed on unslaughtered rabbits on days 32 to 36 of the experiment, and the previous day’s feces were collected in the collection net at 8:00 h on the second day. Contamination was avoided during sample collection and collected feces were sprayed with 10% hydrochloric acid for nitrogen fixation, and then stored at −20 °C. At the end of the experiment, all feces collected from each treatment group were thawed and mixed thoroughly, and air-dried samples were made in an oven at 65 °C, crushed and sieved through 18 and 40 mesh sieves, respectively, and then stored at −20 °C.

Determination of indicators and testing methods

Growth performance

Daily feed provisions and feed leftovers were recorded during the experiment to determine the amount of food consumed by each rabbit. The rabbits were fasted for 12 h before weighing and weighed on days 1, 15, and 37 of the experiment, and then the ADG, ADFI, and G:F of each test rabbit for the pre-growth (days 1 to 14), late growth (days 15 to 36) and full (days 1 to 36) growth periods were calculated. The morbidity and mortality of the test rabbits in each treatment group were also recorded.

Health status

Morbidity, mortality, and health risk indices were calculated concerning the method of Gidenne et al. (2004):

$${\displaystyle \begin{array}{l}{\displaystyle \mathrm{M}\mathrm{o}\mathrm{r}\mathrm{b}\mathrm{i}\mathrm{d}\mathrm{i}\mathrm{t}\mathrm{y}(\mathrm{\%})=\frac{N_{\mathrm{m}\mathrm{o}\mathrm{r}\mathrm{b}\mathrm{i}\mathrm{d}\mathrm{i}\mathrm{t}\mathrm{y}}}{N_{\mathrm{t}\mathrm{o}\mathrm{t}\mathrm{a}\mathrm{l}}}\times 100\mathrm{\%}}\end{array}}$$

where N_morbidity is the number of rabbits with the disease in the experiment and N_total is the total number of rabbits at the beginning of the experiment.

$${\displaystyle \begin{array}{l}{\displaystyle \mathrm{M}\mathrm{o}\mathrm{r}\mathrm{t}\mathrm{a}\mathrm{l}\mathrm{i}\mathrm{t}\mathrm{y}(\mathrm{\%})=\frac{N_{\mathrm{d}\mathrm{i}\mathrm{e}\mathrm{d}}}{N_{\mathrm{t}\mathrm{o}\mathrm{t}\mathrm{a}\mathrm{l}}}\times 100\mathrm{\%}}\end{array}}$$

where N_died is the number of rabbits that died in the experiment and N_total is the total number of rabbits at the beginning of the experiment.

$${\displaystyle \begin{array}{l}{\displaystyle \mathrm{H}\mathrm{e}\mathrm{a}\mathrm{l}\mathrm{t}\mathrm{h}\mathrm{r}\mathrm{i}\mathrm{s}\mathrm{k}\mathrm{i}\mathrm{n}\mathrm{d}\mathrm{e}\mathrm{x}(\mathrm{\%})=\frac{N_{\mathrm{s}\mathrm{u}\mathrm{m}}}{N_{\mathrm{t}\mathrm{o}\mathrm{t}\mathrm{a}\mathrm{l}}}\times 100\mathrm{\%}}\end{array}}$$

where N_sum is the sum of the number of rabbits with disease and the deaths in the experiment and N_total is the total number of rabbits at the beginning of the experiment.

Organ index

The organ index was calculated by the following formula according to the weight of each organ (liver, kidney, thymus, appendix, and sacculus rotundus) and the live weight of test rabbits.

$${\displaystyle \begin{array}{l}{\displaystyle \mathrm{O}\mathrm{r}\mathrm{g}\mathrm{a}\mathrm{n}\mathrm{i}\mathrm{n}\mathrm{d}\mathrm{e}\mathrm{x}(\mathrm{\%})=\frac{\mathrm{o}\mathrm{r}\mathrm{g}\mathrm{a}\mathrm{n}\mathrm{w}\mathrm{e}\mathrm{i}\mathrm{g}\mathrm{h}\mathrm{t}(\mathrm{g})}{\mathrm{l}\mathrm{i}\mathrm{v}\mathrm{e}\mathrm{w}\mathrm{e}\mathrm{i}\mathrm{g}\mathrm{h}\mathrm{t}(\mathrm{g})}\times 100\mathrm{\%}}\end{array}}$$

Apparent total tract digestibility of nutrients

The contents of dry matter (DM, method 2001-12), crude protein (CP, method 990.03), crude fiber (CF, method 962.09), ether extract (EE, method 920.39), crude ash (Ash, method 942.05), neutral detergent fiber (NDF, method 1973), acid detergent fiber (ADF, method 973.18), acidic lignin (method 973.18), gross energy (GE, method 6300), organic matter (OM, method 934.03), n-free extract, energy, and acid insoluble ash in the feed and feces samples were determined according to the AOAC procedure (Hortwitz and Latimer, 2007). The apparent total tract digestibility (ATTD) was calculated from the nutrient content and acid insoluble ash measured in the feed and feces with the following equation (Hortwitz and Latimer, 2007):

$${\displaystyle \begin{array}{l}{\displaystyle \mathrm{A}\mathrm{T}\mathrm{T}\mathrm{D}(\mathrm{\%})=100\times [1-\left(\frac{\mathrm{a}\mathrm{c}\mathrm{i}\mathrm{d}\mathrm{i}\mathrm{n}\mathrm{s}\mathrm{o}\mathrm{l}\mathrm{u}\mathrm{b}\mathrm{l}\mathrm{e}\mathrm{a}\mathrm{s}{\mathrm{h}}_{\mathrm{f}\mathrm{e}\mathrm{e}\mathrm{d}}}{\mathrm{a}\mathrm{c}\mathrm{i}\mathrm{d}\mathrm{i}\mathrm{n}\mathrm{s}\mathrm{o}\mathrm{l}\mathrm{u}\mathrm{b}\mathrm{l}\mathrm{e}\mathrm{a}\mathrm{s}{\mathrm{h}}_{\mathrm{f}\mathrm{e}\mathrm{c}\mathrm{e}\mathrm{s}}}\right)\times \left(\frac{\mathrm{N}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}{\mathrm{t}}_{\mathrm{f}\mathrm{e}\mathrm{c}\mathrm{e}\mathrm{s}}}{\mathrm{N}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}{\mathrm{t}}_{\mathrm{f}\mathrm{e}\mathrm{e}\mathrm{d}}}\right)]}\end{array}}$$

where $\mathrm{a}\mathrm{c}\mathrm{i}\mathrm{d}\mathrm{i}\mathrm{n}\mathrm{s}\mathrm{o}\mathrm{l}\mathrm{u}\mathrm{b}\mathrm{l}\mathrm{e}\mathrm{a}\mathrm{s}{\mathrm{h}}_{\mathrm{f}\mathrm{e}\mathrm{e}\mathrm{d}}$ is the acid insoluble ash content in the feed, $\mathrm{a}\mathrm{c}\mathrm{i}\mathrm{d}\mathrm{i}\mathrm{n}\mathrm{s}\mathrm{o}\mathrm{l}\mathrm{u}\mathrm{b}\mathrm{l}\mathrm{e}\mathrm{a}\mathrm{s}{\mathrm{h}}_{\mathrm{f}\mathrm{e}\mathrm{c}\mathrm{e}\mathrm{s}}$ is the acid insoluble ash content in the feces, $\mathrm{N}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}{\mathrm{t}}_{\mathrm{f}\mathrm{e}\mathrm{c}\mathrm{e}\mathrm{s}}$ is the nutrient content in the feces, and $\mathrm{N}\mathrm{u}\mathrm{t}\mathrm{r}\mathrm{i}\mathrm{e}\mathrm{n}{\mathrm{t}}_{\mathrm{f}\mathrm{e}\mathrm{e}\mathrm{d}}$ is the nutrient content in the feed.

Intestinal morphology

The duodenum, jejunum, and ileum fixed in 4% paraformaldehyde were dehydrated, transparent, sectioned, embedded, and stained with periodic acid-Schiff. Ten visual fields with intact villi and straight to the slice were selected on the slice with a fluorescence biomicroscope. The villus height and crypt depth were measured by image processing software, and the villus–crypt ratio was calculated. At the same time, 10 intact villi were selected to determine the number of goblet cells in the villi.

Digestive enzymes activities

The activities of amylase, lipase, and trypsin in jejunum chyme were analyzed using a kit (Nanjing Institute of Jiancheng Biological Engineering, Nanjing, China) according to the manufacturer’s instructions.

Intestinal immune function

The contents of secretory immunoglobulin A and immunoglobulin M in duodenum, jejunum, and ileum were determined using ELISA kit (Shanghai Enzyme Linkage Biotechnology Co., Ltd.).

Total RNA was extracted from frozen duodenum, jejunum, and ileum using Trizol reagent (Sigma-Aldrich), and cDNA was synthesized using a kit (Takara, Dalian, China) according to the manufacturer’s instructions. The mRNA abundant of interleukin-2 (IL-2), IL-4, IL-6, IL-10, IL-1β, tumor necrosis factor-α (TNF-α), toll-like receptor 2 (TLR2), TLR4, and myeloid differentiation factor 88 (MyD88) in duodenum, jejunum, and ileum tissues were determined by real-time quantitative polymerase chain reaction (CFX-96 Real-Time Polymerase Chain Reaction System, Bio-Rad) with glyceraldehyde-3-phosphate dehydrogenase as the internal reference gene. The mRNA abundance of the target genes was calculated using the 2^−ΔΔCT formula (Schmittgen and Livak, 2008), and primers for genes are shown in Table 2.

Table 2.

Primer sequences used for real-time polymerase chain reaction

Target gene	Accession number	Primer sequence (5ʹ to 3ʹ)
ZO-1	XM_008269782.1	F: GCCACACTGTGATCCTAAAACC
		R: ACACACAGTTTGCTCCCACA
Claudin-1	NM_001089316.1	F: ACGAGGGGCTATGGATGTCT
		R: GCCAATCACCATCAAGGCAC
Occludin	XM_017344772.1	F: GGCGTCCTGGTGTTTATTGC
		R: ACGTTTTTAACCTCCTGGGGAT
JAM-2	XM_017346699.1	F: AAGCCCGAAATTCTGTCGGA
		R: ACTACGGCTGCTATGATGCC
JAM-3	XM_008248363.2	F: ACTCCAGGGTCAATCCCAGA
		R: AGTCCTCCTTGTGAACAGCG
IL-2	NM_001163180.1	F: TGCCCAAGAAGGTCACAGAA
		R: CCCCCATGAGAGTTTTTGCC
IL-4	NM_001163177.1	F: GCGACATCATCCTACCCGAA
		R: TCGGTTGTGTTCTTGGGGAC
IL-6	NM_001082064.2	F: ACTGGCGGAAGTCAATCTGC
		R: GAACTCCATCAGCCCCGAAG
IL-10	NM_001082045.1	F: AACAAGAGCAAGGCAGTGGA
		R: AAGATGTCAAACTCACTCATGGC
IL-1β	NM_001082201.1	F: TCTGCAACACCTGGGATGAC
		R: TCAGCTCATACGTGCCAGAC
TNF-α	NM_001082263.1	F: AGTCCCCAAACAACCTCCATC
		R: GAGGCTTGTCACTCAGGGC
TLR2	NM_001082781.1	F: CCTGCTGACGCTGAAAAACC
		R: TCAGCCGTCTCAACCTTTCC
TLR4	XM_008273277.2	F: AGCTTTTGAATTCTCCAGAAGGTGT
		R: GTCCCCTAGAGAGGTCAGGT
MyD88	XM_002723869.3	F: GCTGAAGCTGTGCGTGTCTG
		R: GGCAAACTTGGTCTGGAAGTC
Glyceraldehyde-3-phosphate dehydrogenase	NM_001082253.1	F: TGGTGAAGGTCGGAGTGAAC
		R: GCCGTGGGTGGAATCATACT

Intestinal barrier function

Serum d-lactic acid content and diamine oxidase activity were determined by ELISA kit (Shanghai Enzyme Linkage Biotechnology Co., Ltd.). The mRNA abundance of Occludin, claudin-1, zonula occludens-1 (ZO-1), junctional adhesion molecule-2 (JAM-2), and JAM-3 in duodenum, jejunum, and ileum was detected by real-time quantitative polymerase chain reaction, and the determination steps were similar to those described earlier, and the primers of the genes are shown in Table 2.

Statistical analysis

A two-factor ANOVA was performed on the data using SAS 9.4 to analyze the effect of betaine level and energy level on the main effect of each index and the interaction effect between them. Using duplicate individuals as statistical units, all data results were expressed as the mean and SEM. Mortality, morbidity, and health risk index were expressed as percentages, which were analyzed using weighted least squares. Multiple comparisons were performed by Tukey’s method when significant differences were observed by ANOVA. Differences at P < 0.05 were considered to be statistically significant, whereas a tendency was considered when 0.05 ≤ P < 0.10.

Results

Effects of dietary betaine supplementation and energy levels on growth performance, organ index, and health status in rabbits

The results showed that different energy levels had no effect on ADFI and ADG in rabbits, but compared with the NDE treatment group, the LDE diet decreased G:F of rabbits on days 1 to 14 and 1 to 36 (P < 0.05, Table 3). Different levels of betaine had no effect on the growth performance of rabbits. There was no interaction between energy level and betaine level on the growth performance of rabbits (P > 0.05, Table 3).

Table 3.

Effects of betaine supplementation and energy levels on growth performance of rabbits

DE	BET	1 to 14 d			15 to 36 d			1 to 36 d
		ADFI, g	ADG, g	G:F	ADFI, g	ADG, g	G:F	ADFI, g	ADG, g	G:F
NDE	0	70.07	23.15	0.33	114.89	32.21	0.28	97.32	28.77	0.29
NDE	500	69.96	23.36	0.33	118.28	32.20	0.28	99.64	28.73	0.30
NDE	1,000	68.96	22.29	0.33	116.87	32.21	0.28	97.78	28.33	0.29
LDE	0	70.24	21.57	0.31	120.15	32.61	0.27	100.96	28.41	0.28
LDE	500	70.00	21.70	0.31	117.58	31.43	0.27	98.90	27.49	0.28
LDE	1,000	70.32	21.99	0.32	115.70	30.11	0.27	98.08	26.88	0.28
SEM		0.78	0.75	0.01	1.49	1.20	0.01	1.00	0.87	0.01
Main effect
DE	NDE	69.44	22.93	0.33a	116.68	32.21	0.28	98.24	28.61	0.30a
	LDE	70.19	21.75	0.31b	117.81	31.38	0.27	99.31	27.59	0.28b
BET	0	70.16	22.36	0.32	117.52	32.41	0.27	99.14	28.59	0.29
	500	69.98	22.53	0.32	117.93	31.82	0.28	99.27	28.11	0.29
	1,000	69.30	22.14	0.32	116.28	31.16	0.28	97.93	27.60	0.29
P-value	DE	0.23	0.06	0.01	0.34	0.40	0.07	0.19	0.14	0.01
	BET	0.50	0.87	0.91	0.50	0.58	0.89	0.33	0.51	0.86
	DE × BET	0.36	0.60	0.83	0.05	0.58	0.92	0.07	0.79	0.94

Note: Data in the same column with different letters on the shoulder indicate that the difference is significant (P < 0.05).

Addition of betaine to diets with different energy levels had no effect on the organ indices of the liver, kidney, thymus, appendix, and sacculus rotundus of rabbits (P > 0.05, Table 4). Similarly, dietary betaine supplementation and energy levels had no effect on morbidity, mortality, and health risk index in rabbits (P > 0.05, Table 5).

Table 4.

Effects of betaine supplementation and energy levels on organ index of rabbits (%)

DE	BET	Liver	Kidney	Spleen	Thymus	Appendix	Sacculus rotundus
NDE	0	3.13	0.72	0.06	0.22	0.50	0.14
NDE	500	3.01	0.74	0.06	0.24	0.54	0.14
NDE	1,000	2.80	0.69	0.08	0.27	0.56	0.14
LDE	0	2.98	0.65	0.05	0.24	0.50	0.13
LDE	500	2.89	0.71	0.05	0.25	0.49	0.14
LDE	1,000	3.27	0.69	0.05	0.25	0.53	0.16
SEM		0.14	0.03	0.01	0.02	0.04	0.01
Main effect
DE	NDE	2.98	0.71	0.07	0.24	0.53	0.14
	LDE	3.05	0.68	0.05	0.24	0.51	0.14
BET	0	3.06	0.68	0.06	0.23	0.5	0.13
	500	2.95	0.72	0.06	0.24	0.51	0.14
	1,000	3.04	0.69	0.06	0.26	0.54	0.15
P value	DE	0.60	0.14	0.10	0.96	0.43	0.90
	BET	0.75	0.25	0.69	0.47	0.52	0.17
	DE × BET	0.08	0.39	0.70	0.77	0.86	0.51

Table 5.

Effects of betaine supplementation and energy levels on health status of rabbits

DE	BET	Morbidity, %	Mortality, %	Health risk index, %
NDE	0	8.33	0	8.33
NDE	500	4.17	4.17	8.33
NDE	1,000	0	0	0
LDE	0	4.17	4.17	8.33
LDE	500	4.17	4.17	8.83
LDE	1,000	4.17	4.17	8.83
SEM		—	—	—
Main effect
DE	NDE	4.17	1.37	5.56
	LDE	4.17	4.17	8.33
BET	0	2.08	4.17	8.33
	500	4.17	4.17	8.33
	1,000	2.08	2.08	4.17
P-value	DE	0.99	0.32	0.52
	BET	0.78	0.58	0.62
	DE × BET	0.78	0.63	0.69

Effects of dietary betaine supplementation and energy levels on ATTD in rabbits

The results showed that different energy levels had no effect on the ATTD of CP, EE, and DM (P > 0.05, Table 6). But compared with the NDE diet, the LDE diet reduced the ATTD of GE, OM, and CF (P < 0.05), and increased the ATTD of Ash, NDF, ADF, and n-free extract (P < 0.05, Table 6). Compared with the treatment group without betaine, the ATTD of GE, DM, ADF, and n-free extract was increased with betaine supplementation (P < 0.05, Table 6). The ATTD of DM was increased by the addition of 500 mg/kg betaine, and the ATTD of OM, Ash, and NDF was increased when betaine was added at 1,000 mg/kg (P < 0.05, Table 6). There was an interaction between energy level and betaine level on ATTD. Compared with the treatment group without betaine, adding 500 mg/kg betaine increased the ATTD of DM, OM, GE, CF, NDF, and ADF in the LDE treatment group, but decreased the ATTD of CP, CF, DM, OM, and NDF in NDE treatment group (P < 0.05, Table 6).

Table 6.

Effects of betaine supplementation and energy levels on ATTD of nutrients in rabbits (%)

DE	BET	GE	CP	CF	EE	DM	OM	Ash	NDF	ADF	N-free extract
NDE	0	55.27b	77.13ab	40.80ab	86.96	52.00d	57.18b	26.82d	25.30c	30.05c	54.69
NDE	500	55.32b	75.33b	39.96b	86.77	51.65e	56.54c	32.11c	21.60d	29.83c	59.95
NDE	1,000	58.27a	78.76a	42.60a	89.26	55.35a	58.50a	39.39a	32.82a	40.21a	64.25
LDE	0	53.44c	76.64ab	39.55b	79.93	51.96d	54.97e	37.65ab	28.75b	35.96b	62.84
LDE	500	55.32b	76.54ab	40.66ab	83.98	53.97b	56.40cd	35.44b	33.40a	40.96a	65.75
LDE	1,000	54.62b	75.48b	38.83b	88.98	52.81c	55.81d	35.85b	29.59b	34.84b	71.84
SEM		0.24	0.75	0.77	2.43	0.10	0.20	0.90	0.55	0.67	0.94
Main effect
DE	NDE	56.29a	77.07	41.18a	87.65	52.98	57.41a	32.97b	26.45b	33.36b	59.63b
	LDE	54.46b	76.22	39.67b	84.20	52.88	55.70b	36.31a	30.58a	36.60a	66.81a
BET	0	54.36c	76.89	39.96	83.63	51.98c	56.23b	32.23b	27.03b	32.85c	58.55c
	500	55.32b	75.90	40.29	89.13	54.12a	56.07b	33.68b	26.91b	35.10b	62.70b
	1,000	56.44a	77.20	40.81	85.41	52.74b	57.22a	37.71a	31.29a	36.69a	67.85a
P value	DE	<0.01	0.19	0.03	0.17	0.30	<0.01	<0.01	<0.01	<0.01	<0.01
	BET	<0.01	0.29	0.78	0.16	<0.01	<0.01	<0.01	<0.01	<0.01	<0.01
	DE × BET	<0.01	0.02	0.02	0.52	<0.01	<0.01	<0.01	<0.01	<0.01	0.63

Note: Data in the same column with different letters on the shoulder indicate that the difference is significant (P < 0.05).

Effects of dietary betaine supplementation and energy levels on intestinal morphology in rabbits

The results showed that compared with the NDE treatment group, the LDE diet increased the villus height of the duodenum and the villus height and villus–crypt ratio of the ileum (P < 0.05), but the energy level had no effect on other intestinal morphological indicators of the duodenum, jejunum, and ileum (Table 7). Compared with the treatment group without betaine, dietary betaine supplementation increased the villus height and crypt depth of the ileum, and decreased the crypt depth of the duodenum (P < 0.05, Table 7). The supplementation of 500 mg/kg betaine increased the villus–crypt ratio in the duodenum, and the supplementation of 1,000 mg/kg betaine decreased the villus–crypt ratio in the duodenum and jejunum (P < 0.05, Table 7). There was an interaction between energy level and betaine level on intestinal morphology. Compared with the treatment group without betaine, the addition of 500 mg/kg betaine increased the villus height and crypt depth of the duodenum in the LDE treatment group (P < 0.05), and decreased the villus height and crypt depth of the duodenum in the NDE treatment group, and crypt depth in the jejunum of the LDE treatment group (P < 0.05; Table 7). The addition of 1,000 mg/kg betaine increased the villus height of the duodenum in the LDE treatment group and the crypt depth of the jejunum in the NDE treatment group (P < 0.05), and decreased the villus height and crypt depth of the duodenum in the NDE treatment group (P < 0.05; Table 7). Dietary supplementation of betaine at 1,000 mg/kg also reduced the jejunal villus–crypt ratio (P < 0.05) but had no interaction with energy levels (Table 7).

Table 7.

Effects of betaine supplementation and energy levels on intestinal morphology of rabbits

DE	BET	Duodenum			Jejunum			Ileum
		Villus height, um	Crypt depth, um	Villus crypt ratio	Villus height, um	Crypt depth, um	Villus crypt ratio	Villus height, um	Crypt depth, um	Villus crypt ratio
NDE	0	630.39a	202.29a	3.37	461.69	98.51bc	4.81	300.13	100.57	3.03
NDE	500	392.71c	110.23d	3.77	488.11	104.06ab	4.84	330.13	117.14	3.01
NDE	1,000	360.13c	123.49d	3.14	465.96	112.72a	4.35	345.98	107.38	3.08
LDE	0	412.42c	132.28cd	3.39	489.94	106.19ab	4.79	311.67	96.88	3.36
LDE	500	592.71ab	170.05b	4.00	443.67	86.16c	5.42	397.74	119.08	3.36
LDE	1,000	539.88b	151.00bc	3.67	432.65	111.05ab	4.21	379.14	116.33	3.28
SEM		19.93	9.28	0.18	16.78	4.82	0.22	12.21	4.23	0.12
Main effect
DE	NDE	461.93b	145.34	3.43	455.42	105.15	4.66	325.41b	108.37	3.04b
	LDE	515.00a	151.11	3.69	471.92	101.01	4.80	362.72a	110.60	3.33a
BET	0	521.41a	167.28a	3.38b	475.81	102.35ab	4.80a	305.90b	98.73b	3.20
	500	492.71a	140.14b	3.89a	465.89	95.11b	5.13a	362.35a	118.10a	3.19
	1,000	455.14b	137.24b	3.41b	449.30	111.90a	4.28b	368.08a	111.80a	3.18
P value	DE	<0.01	0.47	0.08	0.25	0.33	0.44	<0.01	0.50	<0.01
	BET	<0.01	<0.01	<0.01	0.31	<0.01	<0.01	<0.01	<0.01	0.99
	DE × BET	<0.01	<0.01	0.38	0.08	0.04	0.22	0.08	0.35	0.81

Note: Data in the same column with different letters on the shoulder indicate that the difference is significant (P < 0.05).

Effects of dietary betaine supplementation and energy levels on digestive enzyme activities in the jejunum of rabbits

As shown in Figure 1, LDE diets reduced the activities of amylase, lipase, and trypsin activities in jejunum compared with the NDE treatment group (P < 0.05). There was no effect of betaine level on the activities of these digestive enzymes, but the addition of betaine tended to increase the activity of trypsin (P = 0.09). There was no interaction between energy level and betaine level on the activities of amylase, lipase, and trypsin in jejunum.

Figure 1.

Effects of betaine supplementation and energy levels on digestive enzyme activities in the jejunum of rabbits.

Effect of betaine supplementation and energy levels on intestinal immunoglobulins and goblet cells in rabbits

The results showed that the LDE diet increased the contents of secretory immunoglobulin A in jejunum, secretory immunoglobulin A and immunoglobulin M in ileum, as well as the number of goblet cells in duodenum and ileum, and decreased the content of immunoglobulin M in jejunum compared with the NDE treatment group (P < 0.05, Table 8). However, energy level had no effect on the content of secretory immunoglobulin A and immunoglobulin M in duodenum and the number of goblet cells in jejunum. Dietary betaine supplementation with different energy levels increased the content of immunoglobulin M and the number of goblet cells in ileum, and decreased the amount of goblet cells in duodenum (P < 0.05), and the immunoglobulin M content in jejunum showed a decreasing trend (P = 0.07, Table 8). There was an interaction between energy level and betaine level on intestinal immunoglobulin and goblet cells. Compared with the treatment group without betaine, adding 500 mg/kg betaine in the NDE treatment group increased the immunoglobulin M content in jejunum and decreased the amount of goblet cells in duodenum (P < 0.05, Table 8). Supplementation with 500 and 1,000 mg/kg betaine increased the amount of goblet cells in ileum, and decreased the amount of goblet cells in duodenum of the LDE treatment group (P < 0.05, Table 8).

Table 8.

Effect of betaine supplementation and energy levels on intestinal immunoglobulins and goblet cells of rabbits

DE	BET	Duodenum			Jejunum			Ileum
		Secretory immunoglobulin A, ug/mL	Immunoglobulin M, mg/mL	Goblet cells, pcs/villi	Secretory immunoglobulin A, ug/mL	Immunoglobulin M, mg/mL	Goblet cells, pcs/villi	Secretory immunoglobulin A, ug/mL	Immunoglobulin M, mg/mL	Goblet cells, pcs/villi
NDE	0	157.76	9.44	44.77b	162.78	10.87b	36.36	156.21	9.83bc	21.00c
NDE	500	167.58	10.70	28.26d	169.13	13.35a	39.68	181.16	9.09c	20.44c
NDE	1,000	146.99	11.66	42.40bc	152.97	10.60b	31.08	159.44	11.66ab	18.23c
LDE	0	142.42	10.44	54.30a	184.83	11.13b	35.45	186.26	11.83ab	28.38b
LDE	500	147.68	10.86	35.95c	167.33	9.84b	35.46	192.96	11.20ab	37.30a
LDE	1,000	155.16	9.69	40.73bc	171.04	9.91b	34.53	228.12	12.34a	34.67a
SEM		7.54	0.73	2.36	5.50	0.52	1.68	13.31	0.57	1.54
Main effect
DE	NDE	157.44	10.60	38.51b	161.62b	11.61a	36.70	164.19b	10.19b	19.88b
	LDE	148.42	10.33	43.66a	174.40a	10.29b	35.14	202.44a	11.79a	33.45a
BET	0	150.09	9.94	49.59a	173.80	11.00	35.90ab	171.23	10.83ab	24.68b
	500	157.63	10.78	32.15c	168.23	11.60	37.59a	187.90	10.14b	28.97a
	1,000	151.08	10.67	41.56b	162.01	10.26	32.80b	194.78	12.00a	26.45ab
P value	DE	0.19	0.68	<0.01	0.02	<0.01	0.69	<0.01	0.01	<0.01
	BET	0.61	0.52	<0.01	0.17	0.07	0.02	0.26	0.04	0.03
	DE × BET	0.21	0.18	0.04	0.14	<0.01	0.08	0.14	0.54	<0.01

Note: Data in the same column with different letters on the shoulder indicate that the difference is significant (P < 0.05).

Effect of betaine supplementation and energy levels on the abundance of intestinal inflammation-related genes in rabbits

The effects of betaine supplementation and energy levels on the abundance of intestinal inflammation-related genes are shown in Figure 2. The results showed that compared with the NDE treatment group, the LDE diet upregulated the abundance of IL-6, IL-1β, TLR4, and MyD88 in ileum (P < 0.05), but the mRNA abundance of inflammation-related genes in duodenum and jejunum were not affected by different energy levels. Compared with the treatment group without betaine, betaine supplementation downregulated the abundance of IL-2 in duodenum (P < 0.05), tended to downregulate IL-1β abundance in ileum (P = 0.06), and tended to upregulate the abundance of IL-4 in duodenum (P = 0.09) and IL-6 in ileum (P = 0.09). There was an interaction between energy level and betaine level on the mRNA abundance of intestinal inflammation-related genes in rabbits. The addition of 500 mg/kg betaine upregulated the abundance of TNF-α and TLR2 in duodenum and downregulated the abundance of IL-6 in ileum of the NDE treatment group (P < 0.05), and upregulated the abundance of IL-6 in ileum of the LDE treatment group (P < 0.05).

Figure 2.

Effect of betaine supplementation and energy levels on the abundance of intestinal (A, Duodenum; B, Jejunum; C, Ileum) inflammation-related genes in rabbits. Note: The different letters between the treatment groups represent a significant difference (P < 0.05).

Effect of betaine supplementation and energy levels on intestinal barrier integrity of rabbits

The results showed that there was no difference in serum diamine oxidase activity and d-lactic acid content between the treatment groups (Figure 3). However, there was a tendency for an interaction between different digestive energy levels and betaine levels on the serum d-lactic acid content, when betaine was added at 1,000 mg/kg, the serum d-lactic acid content increased in the LDE treatment group (P = 0.09, Figure 3).

Figure 3.

Effect of betaine supplementation and energy levels on serum diamine oxidase activity and d-lactic acid content in rabbits.

The effect of betaine supplementation and energy levels on the mRNA abundance of intestinal tight junction-related genes are shown in Figure 4. Compared with the NDE treatment group, LDE diet upregulated the abundance of JAM-3 in duodenum and Claudin-1 in jejunum (P < 0.05). Compared with the treatment group without betaine, betaine supplementation upregulated the abundance of JAM-2 and JAM-3 in duodenum (P < 0.05). There was an interaction between energy level and betaine level on intestinal barrier indexes of rabbits. Supplementation with 500 mg/kg betaine upregulated the abundance of claudin-1 and JAM-3 in duodenum and JAM-2 in ileum of the NDE treatment group (P < 0.05).

Figure 4.

Effect of betaine supplementation and energy levels on the relative abundance of intestinal (A, Duodenum; B, Jejunum; C, Ileum) barrier-related genes in rabbits. Note: The different letters between the treatment groups represent a significant difference (P < 0.05).

Discussion

The production level and efficiency of animals are affected to varying degrees by intrinsic factors (genetics, breed, physiological health, etc.) or external factors (nutritional level, environmental conditions, feeding management, etc.). ADFI, ADG, and G:F can directly reflect the feeding effect of meat rabbits. Under the same feeding and management conditions, dietary energy concentration is the main factor determining the intake of DM and therefore the intake of other major nutrients such as protein, amino acids, and CF (Blas and Wiseman, 2020). Higher digestible energy concentration had positive effects on ADFI and ADG, while lower digestible energy concentration can affect the growth performance of rabbits (García et al., 2002). Results of experiments have also shown that dietary betaine supplementation improves the growth performance of rabbits under high temperature or heat stress conditions (Hassan et al., 2011; El-Moniem et al., 2016), but in the present experiment, no effect of dietary betaine was observed on growth performance of rabbits, and the reason may be that the experimental conditions were different and the animals in this experiment were not exposed to adverse environments. In addition, betaine can partially replace the methyl donor effect of methionine and has the effect of saving methionine. It was found that after partially replacing methionine in the feed ration, betaine partially improves the growth performance of broiler chickens, but the level of replacement is too high or all of the replacements have no effect on the growth performance, or even have a negative effect (Lukic et al., 2012).

At present, mortality, morbidity, and health risk indices are commonly used to assess the health status of rabbits (Gidenne et al., 2004). In this experiment, there was no significant difference in the health status of rabbits among the treatment groups. The possible reason is that the digestible energy level of the LDE diet in this study was 9.6 MJ/kg, which was not seriously low, so it may not have had an adverse effect on the health status of rabbits; therefore, the addition of betaine had no beneficial effect. Organ index, also known as visceral-to-body ratio, is the ratio of organs weight to living body weight of test animals (Caton et al., 2009). The ratio of organs to body weight in normal animals is relatively constant, but organ weight can change when the animal’s health is abnormal. Increased organ index indicates that the organ may be congested, edema, or hypertrophy; decreased organ index indicates that viscera may exist atrophy or other degenerative change (Caton et al., 2009). In this experiment, there was no significant difference in organ index among the treatment groups, which was consistent with the results of health status in rabbits.

After feeding, animals receive a variety of nutrients from their diet to meet their own growth needs. The ATTD of nutrients can reflect the absorption and utilization of nutrients in rabbits to a certain extent. In our study, we found that feeding LDE diets reduced the ATTD of nutrients in rabbits. Zhu and Li (2004) found that the ATTD of GE, DM, OM, CP, and GE increased with increasing energy levels when the dietary DE was 9.46 to 12.46 MJ/kg, indicating that insufficient energy concentration in the diet would reduce the digestion and utilization of nutrients in meat rabbits. Although dietary betaine supplementation has produced variable results in different animals (Ahmed et al., 2018; Ratriyanto and Prastowo, 2019), this present experiment found that dietary addition of betaine increased the ATTD of the nutrients in rabbits, which was consistent with previous reports (El-Moniem et al., 2016). Betaine itself can act as a penetration protectant for certain bacteria, so it may affect the absorption and utilization of nutrients by affecting the intestinal microbial composition of meat rabbits. Results of other experiments demonstrated that betaine can be more effective when added to low-energy diets, which can save some digestible energy from feed without affecting the growth of animals (Schrama et al., 2003). In conclusion, the results of this experiment suggest that adding appropriate levels of betaine to the diet has a beneficial effect on the digestion and utilization of some nutrients in animals, especially when feeding LDE diets.

The increase of intestinal villi height can increase the contact area between intestinal tract and nutrients, while crypt depth can reflect the renewal rate of intestinal epithelial cells. Therefore, the ratio of villus height to crypt depth in the small intestine can reflect intestinal development and its ability to digest and absorb nutrients (Kiela and Ghishan, 2016). Our findings are in agreement with those of previous authors that the dietary addition of betaine improves the morphological structure of intestinal villi (Liu et al., 2019; Sun et al., 2019a). The improvement of intestinal mucosal structure by betaine may be related to its permeation properties (Kettunen et al., 2001). Betaine is abundantly deposited in cells or organelles, and when osmotic pressure changes, it can partially replace inorganic ions to regulate osmotic pressure, thus mitigating the damage of inorganic ions to enzymes and cell membranes (Lever and Slow, 2010). In addition, betaine may also indirectly affect the intestinal morphology and development of meat rabbits by influencing the microbial composition (Hooper, 2004).

In the small intestine, food is chemically digested by pancreatic juice, bile, and small intestinal juice. Digestive enzymes in the small intestine will further decompose some complex nutrients into small molecular components that animals can use, so it is one of the important factors affecting the digestion and absorption of dietary nutrients (Zhu and Li, 2004). This study found that energy deficiency may affect the digestion and absorption of nutrients by decreasing digestive enzyme activity, thus affecting the growth performance of rabbits. Although dietary betaine supplementation had no significant effect on the activities of amylase, lipase, and trypsin in jejunum, there was a tendency to increase the activity of trypsin, which is consistent with Wang’s findings (Wang et al., 2020). However, betaine supplementation significantly increased the activities of chyme amylase, lipase, and pancreatin in the small intestine of piglets (Song et al., 2021). This may be due to the difference in the amount of betaine and the types of experimental animals.

Immunoglobulin is a kind of protein that exerts antibody effects, which can protect the body from the invasion of microorganisms and “foreign objects.” It plays an important role in maintaining intestinal mucosal homeostasis, interfering with the binding of bacteria and epithelial cell receptors, and immune rejection and pathogen clearance (Schroeder and Cavacini, 2010). Goblet cells are mucus-secreting cells distributed between mucosal columnar epithelial cells, and their main function is to synthesize and secrete mucins to form a mucosal barrier to protect epithelial cells, but excessive mucus reduces the secretion of digestive enzymes and the contact time of intestinal epithelial cells with nutrients (Song et al., 2021). Our study found that dietary betaine can alleviate the adverse stimulation of intestinal goblet cells, which may be related to the permeability of betaine. Results of other experiments demonstrated that betaine increased immunoglobulin M content in intestinal tissue of challenged grass carp and secretory immunoglobulin A content in duodenal tissue of broilers challenged by coccidia (Hamidi et al., 2010; Birchenough et al., 2015). The results of our study were different from them, and it is speculated that this may be related to the animal state. Under the conditions of this experiment, there was no obvious inflammatory reaction in the intestine of meat rabbits.

TLRs are pattern recognition receptors, which induce the release of many downstream signal molecules by activating MyD88-dependent pathways, and play an important role in regulating inflammatory responses (Sun et al., 2019b). Previous studies have found that the dietary betaine supplementation can ameliorate the inflammatory damage induced by LPS challenge in mouse small intestinal tissues and IEC-18 cells by downregulating the gene and protein expression of TLR4 and MyD88 (Kawai and Akira, 2010). But the results are not similar to ours, which may be related to the fact that the rabbits in this experiment were relatively healthy and did not show significant inflammatory responses.

The intestinal epithelium is the key interface between the body cavity and the intestinal cavity, which plays an important role in the digestion and absorption of nutrients. Its epithelial cell layer forms a physical barrier to protect the body from harmful environment in the cavity (Lechuga and Ivanov, 2017). The epithelial tight junction is the most important structure in the intestinal epithelial barrier, which is mainly composed of the transmembrane proteins Occludin, Claudins, and JAM and the scaffolding protein ZO-1, 2, and 3 (Balda and Matter, 2000). When the integrity of the intestine is disrupted, intestinal leakage occurs, resulting in d-lactic acid (the end product of intestinal bacteria) and diamine oxidase (an intracellular enzyme present in the intestinal villi) entering the bloodstream. Therefore, the blood levels of diamine oxidase and d-lactic acid can be used as a measure of the degree of intestinal mucosal barrier damage (Wolvekamp and de Bruin, 1994). Betaine can maintain the permeability of intestinal cells to a certain extent, but the results of this experiment differ from those previously reported. Dietary betaine significantly increases the intestinal permeability of broilers under heat stress (Alhotan et al., 2021), which may be caused by the differences in experimental animals and conditions. It is clear that the addition of betaine to the diet may improve intestinal barrier and immune function in rabbits to some extent, but more studies are needed to elucidate its mechanism.

Conclusions

The LDE (9.60 MJ/kg) diet decreased intestinal digestive enzyme activity and nutrient digestibility, and negatively affected growth performance in rabbits. Dietary betaine supplementation has no effect on growth performance but improves intestinal morphology, nutrient digestibility, and health status of rabbits. In addition, betaine supplementation in the LDE diet improved intestinal function and nutrient digestibility of rabbits, with better results when betaine was added at an additive level of 500 mg/kg.

Glossary

Abbreviations

ADF

acid detergent fiber

ADFI

average daily feed intake

ADG

average daily gain

ATTD

apparent total tract digestibility

CF

crude fiber

CP

crude protein

DM

dry matter

G:F

body gain/feed intake

GE

gross energy

IL-10

interleukin-10

JAM-2

junctional adhesion molecule-2

LDE

low digestible energy

MyD88

myeloid differentiation factor 88

NDE

normal digestible energy

NDF

neutral detergent fiber

TLR2

toll-like receptor 2

TNF-α

tumor necrosis factor-α

Author Contributions

The contributions of Zimei Li, Junning Pu, and Gang Tian were conceptualization, methodology. Zimei Li wrote an original draft of the paper. Zimei Li and Tingxuan Zeng’s contributions were data curation and investigation. Zimei Li, Junning Pu, and Tingxuan Zeng performed the formal analysis. Junning Pu and Gang Tian performed the validation and wrote the review and editing. Zimei Li and Gang Tian performed project administration. Jingyi Cai, Gang Jia, Hua Zhao, Guangmang Liu, Qiufeng Zeng, Yuheng Luo, and Gang Tian provided resources and supervision. Gang Tian provided funding acquisition.

Conflicts of interest statement. The authors declare no competing financial interest.