Abstract
Severe fever with thrombocytopenia syndrome (SFTS) is an infectious disease caused by a tick-borne virus called severe fever with thrombocytopenia syndrome virus (SFTSV). In recent years, human infections through contact with ticks and through contact with the bodily fluids of infected dogs and cats have been reported; however, no vaccine is currently available. SFTSV has two glycoproteins (Gn and Gc) on its envelope, which are vaccine-target antigens involved in immunogenicity. In the present study, we constructed novel SFTS vaccine candidates using an adeno-associated virus (AAV) vector to transport the SFTSV glycoprotein genome. AAV vectors are widely used in gene therapy and their safety has been confirmed in clinical trials. Recently, AAV vectors have been used to develop influenza and SARS-CoV-2 vaccines. Two types of vaccines (AAV9-SFTSV Gn and AAV9-SFTSV Gc) carrying SFTSV Gn and Gc genes were produced. The expression of Gn and Gc proteins in HEK293T cells was confirmed by infection with vaccines. These vaccines were inoculated into mice, and the collected sera produced anti-SFTS antibodies. Furthermore, sera from AAV9-SFTSV Gn infected mice showed a potent neutralizing ability, similar to previously reported SFTS vaccine candidates that protected animals from SFTSV infection. These findings suggest that this vaccine is a promising candidate for a new SFTS vaccine.
Keywords: adeno-associated virus, glycoprotein, severe fever with thrombocytopenia syndrome virus, vaccine
Severe fever with thrombocytopenia syndrome (SFTS) is an emerging tick-borne infectious disease endemic to East Asia, which was first reported in China in 2012 and in Japan in 2013 [24, 33]. SFTS virus (SFTSV) is a single-stranded RNA virus belonging to the family Phenuiviridae (Bandavirus) [12] with three genomic segments: L, M, and S. The L segment contains the viral RNA-dependent RNA polymerase; the M segment contains two glycoproteins, Gn and Gc; and the S segment encodes nucleocapsid proteins (N) and nonstructural proteins (NSs) [3]. SFTSV is an arbovirus and its main vector is Haemaphysalis longicornis [14]. The clinical symptoms of SFTS include fever, thrombocytopenia, leukopenia, vomiting, diarrhea, and multiple organ failure, which are often accompanied by hemorrhage [12]. As of April 30, 2023, Japan has 835 cases, among which 97 were fatal, with a fatality rate of 11.6% [17]. In addition, the spread of tick vectors to North America has increased the likelihood of disease outbreaks beyond East Asia. In 2018, the World Health Organization (WHO) added SFTSV to its list of priority pathogens requiring immediate attention [30]. To prevent the spread of SFTS, developing an effective vaccine is necessary. According to reports, protective immunity against SFTSV in lethal mouse and ferret models has been observed when using various vaccine candidates, including recombinant vesicular stomatitis virus (rVSV) live vaccines expressing the glycoprotein (GP) of SFTSV, DNA vaccines, and vaccine candidates based on vaccinia virus [5, 12, 32].
Recently, adeno-associated viral (AAV) vectors have been used as efficient platforms for transferring target genomes into the nucleus, specifically in gene therapy. Genomes transmitted by AAV vectors are known to be stable in the nucleus and continue to express proteins encoded by the target genome for longer period in cells with low mitotic activity, such as neurons and skeletal muscles. Several drugs using AAV vectors, such as Luxturna, Zolgensma, and Hemgenix, have been approved by the FDA [2, 19, 28]. Moreover, several follow-up clinical trials have shown that AAV vectors are safer than other viral vectors, such as adenovirus vectors [20]. In addition, AAV vectors are widely used in research for antigen/antibody gene delivery in vivo against viral infections, such as human immunodeficiency virus, hepatitis B virus, hepatitis C virus, Nipah virus, Hendra virus, influenza A virus subtype H1N1, and dengue virus [4, 6, 18, 21]. AAV has several serotypes with different organ tropisms. Among them, serotype AAV9 has high protein expression capacity in muscle cells and has been used as a vaccine against influenza virus [23, 36]. AAV9, which encodes a component protein of the influenza virus, showed high immunogenicity when administered to mice.
In this study, we generated AAV9 vectors carrying genomes encoding SFTSV glycoproteins Gn and Gc and evaluated their immunogenicity in mice. In particular, AAV9-SFTSV Gn induced neutralizing titers that were considered protective against SFTSV infection after a single administration, suggesting that AAV9-SFTSV Gn is a promising candidate as a safe and effective SFTS vaccine.
MATERIALS AND METHODS.
AAV9-SFTSV vaccine design and preparation
AAV9-SFTSV vaccines (AAV9-SFTSV Gn and AAV9-SFTSV Gc) carrying the Gn and Gc genomic regions of SFTSV were prepared by reverse genetics using HEK293T cells and the three plasmids. The whole genome of YG1 strain [24] was used as Polymerase Chain Reaction (PCR) template of the SFTSV M segment (GenBank accession number is AB817987.1). Three plasmids: pAAV2/9n (pRC9), pAdDeltaF6 (pHelper), and pAAV-CAG-GFP (pAAV) were purchased from Addgene (Watertown, MA, USA). pRC9 and pHelper were used without further editing. pAAV was edited to obtain two plasmids: pAAV-CAG-Gn and pAAV-CAG-Gc. The eGFP genome of pAAV was cut out by restriction enzyme (5′ side: BamHI, 3′ side: EcoRV) and replaced with Gn and Gc sequences (including signal sequence and transmembrane region, Fig. 1A) amplified by PCR from the whole genome of SFTSV YG1 strain. Adherent HEK293T cells cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% fetal bovine serum (FBS) were seeded at 1.0 × 105 cells/cm2 one-day before transfection. Three plasmids (pAAV-CAG-Gn or pAAV-CAG-Gc, pRC9, pHelper at a weight ratio of 1:1:1, 0.5 µg/105 cells) mixed with the same weight of PEI-PRO (Polyplus-transfection, Illkirch, France) in phosphate-buffered saline (PBS) solution was added to the medium for transfection and incubated in 5% CO2 incubator at 37°C for 96 hr. One-tenth volume of Lysis Buffer (1% Triton-X, 200 mM Tris, 20 mM MgCl2, pH 7.2) and 50 µ/mL of Benzonase (Merck, Burlington, MA, USA) were added to the culture medium. The mixture was incubated at 37°C with shaking for 1 hr. After removing the debris by centrifugation (10,000 × g/10 min), the culture supernatant containing AAV9-SFTSV Gn and AAV9-SFTSV Gc was concentrated using MWCO 100 kDa of Amicon (Merck). The solution was purified by ultracentrifugation according to Application Sheet V14 [22] using an OptiPrep (Serumwerk Bernburg AG, Bernburg, Germany). A 40% OptiPrep fraction containing full capsid AAV9-SFTSV vaccine was collected. Finally, the solutions were concentrated and diluted in Formulation Buffer (20 mM Tris, 150 mM NaCl, 2 mM MgCl2, 5% sucrose, 0.05% Pliuronic F-68, pH 8.0) using Amicon (MWCO 100 kDa). The resulting AAV9-SFTSV vaccine solutions were aliquoted and stored at −80°C.
Fig. 1.
Design of adeno-associated virus 9-severe fever with thrombocytopenia syndrome virus vaccines and confirmation of protein expression. (A) Schematic diagram of severe fever with thrombocytopenia syndrome virus (SFTSV) Gn and Gc genome. (B) Schematic diagram of the adeno-associated virus (AAV) 9-SFTSV vaccine. The AAV9-SFTSV vaccine contains the capsid protein of wild-type AAV9 and the Gn or Gc segments of the SFTSV YG1 strain as the Gene of Interest (GOI). The CAG promoters were placed upstream of each other. (C) Western blotting was performed using cell lysates infected with the AAV9-SFTSV vaccine in HEK293T cells. Expression of anti-SFTSV Gn- or anti-SFTSV Gc-specific proteins was observed at approximately 60 kDa (arrow) and 220 kDa (arrowhead). 1. Marker, 2. AAV9-SFTSV Gn or Gc Infected HEK293T Pellet, 3. Non infected HEK293T Pellet. (D) Immunofluorescence staining was performed using HEK293T cells infected with the AAV9-SFTSV vaccine. The expression of anti-SFTSV Gn- or anti-SFTSV Gc-specific proteins was observed in infected cells.
Quantification of AAV9 by real-time PCR
The copy number of the AAV9-SFTSV vaccine vector genome were determined by real-time PCR targeting the inverted terminal repeats (ITRs) of AAV. The residual genome in the samples was removed by DNase I (Fujifilm Wako Pure Chemical Corp., Osaka, Japan) treatment (37°C for 15 min and 95°C for 10 min in the attached DNase I Buffer). The AAV9 capsid protein was disassembled using Protease K (Fujifilm Wako Pure Chemical Corporation) treatment (50°C for 1 hr and 95°C for 10 min in Proteinase K Buffer; 100 mM Tris pH 8.0, 50 mM EDTA, 1% SDS). The primer set (Table 1) was used under the same conditions as in a previous study [1]. AAV9 (37825-AAV9; Addgene) was used as a standard with a known vector genome concentration, and the concentration in the samples was measured by comparing it to a calibration curve (linearity of 2.4 × 104–108 vg/mL was confirmed beforehand).
Table 1. Sequence of primers and probes used in this study.
| Target | Primer | Genome sequence |
|---|---|---|
| ITRs | Forward | GGAACCCCTAGTGATGGAGTT |
| Reverse | CGGCCTCAGTGAGCGA | |
| Probe | CACTCCCTCTCTGCGCGCTCG | |
| SFTSV Gn | Forward | TTCCTGGGCCTTCATACAAG |
| Reverse | TCTCTTCAGGGATGGGTGTC | |
| Probe | CGGCCAACCTTTGATGGATA | |
| SFTSV Gc | Forward | ACTTCACAGCACCAGGGAGT |
| Reverse | GACCAGCCCTGTCCATTTTA | |
| Probe | TTTCGTTCCAGATGCTCGGT | |
ITRs: inverted terminal repeats, SFTSV: severe ever with thrombocytopenia syndrome virus.
Western blot
Western blotting was used to confirm the expression of target proteins in cells infected with AAV9-SFTSV vaccines. Adherent HEK293T cells cultured in 5% FBS/DMEM were seeded at 1.25 × 105 cells/cm2 one-day before infection and infected with AAV9-SFTSV Gn and AAV9-SFTSV Gc, respectively, at MOI 1 × 106. After 7 days of infection, the culture medium was removed and cells were lysed in Sample Buffer (Fujifilm Wako Pure Chemical Corp.) diluted 1 × with water and subjected to SDS-PAGE (c-PAGEL HR, ATTO, Tokyo, Japan) and membrane transfer (Trans-Blot Turbo; BIO-RAD, Hercules CA, USA) according to the manufacturer’s recommended protocol. Primary antibodies (Rabbit Anti-SFTS Gn poly, Rabbit Anti-SFTS Gc poly; NOVUS Biologicals, Centennial, CO, USA) were diluted in Solution 1 (Toyobo, Osaka, Japan) and incubated for 2 hr at room temperature. After washing three times with TBS-T, the secondary antibody (Anti Rabbit IgG HRP Conjugate; Promega Corp., Madison, WI, USA) was diluted with Solution 2 (Toyobo, Osaka, Japan) and reacted for 1 hr at room temperature. After washing three times with TBS-T, the samples were luminesced with Super Signal West Femto Maximum Sensitive Substrate (Thermo Fischer Scientific, Waltham MA, USA) and detected using ImageQuant 800 (Cytiva, Marlborough, MA, USA).
Immunofluorescence staining (IF)
IF was used to detect target protein expression in AAV9-SFTSV vaccine-infected cells. Adherent HEK293T cells were infected in the same manner as for western blotting. After 7 days of infection, the culture medium was removed, and the cells were fixed with methanol, blocked with blocking solution (1% NDS, 1% BSA, 0.1% Triton/PBS), and then the same antibody as Western Blot was used as the primary blotting. Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody Alexa Fluor 594 (Thermo Fischer Scientific) was used as the secondary antibody. The antibodies were diluted in a staining solution (1% NDS/PBS). Nuclei were stained with Hoechst stain (Dojin Chemical Laboratory, Kumamoto, Japan) and observed under a fluorescence microscope (ZOE Fluorescence Cell Imager; BIO-RAD). PBS was used as the washing solution for each step.
Immunity testing of mice with the AAV9-SFTSV vaccines
Mice were purchased from the Japan SLC Corporation and bred at the animal facility of the Tokyo University of Agriculture and Technology (Approval No. R03-4). Six to eight-week-old male C57BL/6NCrSlc mice were divided into three groups of six mice each. Each group was inoculated intramuscularly with AAV9-SFTSV Gn, AAV9-SFTSV Gc, and Formulation Buffer (mock group). A dose of 2 × 1011 vg/animal (1 × 1013 vg/mL, 50 µL/animal) was used. Weighing was performed before and every week after inoculation. Four weeks after inoculation, the mice were euthanized by whole blood collection under anesthesia, and the serum was separated. The liver, spleen, muscles (inoculation site), and cerebral cortex were collected.
Nucleic acid extraction from mouse organs and quantification of specific mRNA or DNA using real-time PCR
Real-time PCR was used to confirm the biodistribution and mRNA expression of glycoproteins after inoculation with AAV9-SFTSV vaccines. To extract nucleic acids from mouse organs, magLEAD6gC (Precision System Science Co., Ltd., Chiba, Japan) for DNA extraction and the RNeasy Mini Kit (Qiagen, Venlo, Netherlands) for RNA extraction were used according to the recommended protocols of the manufacturer. To quantify the amounts of Gn and Gc genomes in the extracted DNA and RNA, real-time PCR with the One Step PrimeScript RT-PCR Kit (Takara Bio Inc., Kusatsu, Japan) was performed following the recommended protocol of the manufacturer. The reaction temperature and time were set according to the same protocol. However, reverse transcription was not performed because a reverse transcription reagent was not added when measuring the DNA. Additionally, the RNA assay was performed without reverse transcriptase to avoid the influence of residual DNA. The primer set used for quantifying Gn and Gc genomes is shown in Table 1, and primers targeting beta-actin (Mm02619580_g1; Thermo Fischer Scientific) were used to standardize nucleic acid amounts. We used the ΔΔCq method [13] to compare the expression level of nucleic acids. The amplification efficiencies of all primers were confirmed beforehand (data not shown). To calculate the amount of DNA and RNA, the following calculations were performed: These calculations pertained specifically to the Gn genome; however, the same equation was used for Gc.
DNA:
ΔCq Gn=(Cq of Gn-injected mouse organs, using Gn primer set)−(Cq of Gn-injected mouse organs, using beta-actin primer set)
ΔCq mock=(Cq of mock mouse organ using Gn primer set)−(Cq of mock mouse organ using beta-actin primer set)
ΔCq mock average=Average of ΔCq mock for each organ.
ΔΔCq of each mouse=ΔCq Gn−ΔCq mock average
DNA amount=2 ^ (−ΔΔCq)
RNA:
ΔCq Gn=[(Cq of Gn-injected mouse organ using Gn primer set, reverse transcriptase+)−(Cq of Gn-injected mouse organ using Gn primer set, reverse transcriptase−)]−[(Cq of Gn-injected mouse organ using beta-actin primer set, reverse transcriptase+)−(Cq of Gn-injected mouse organ using beta-actin primer set, reverse transcriptase−)]
ΔCq mock=[(Cq of mock mouse organ, using Gn primer set, reverse transcriptase+)−(Cq of mock mouse organ, using Gn primer set, reverse transcriptase−)]−[(Cq of mock mouse organ, using beta-actin primer set, reverse transcriptase+)−(Cq of mock mouse organ, using beta-actin primer set, reverse transcriptase−)]
ΔCq mock average=Average of ΔCq mock for each organ.
ΔΔCq of each mouse=ΔCq Gn−ΔCq mock average
RNA amount=2 ^ (−ΔΔCq)
Enzyme-linked immuno sorbent assay (ELISA)
The titer of SFTSV-specific antibodies in AAV9-infected mouse serum was determined using ELISA. Coat the wells of 96-well plates with the SFTSV-infected Huh7 cell lysate (provided by the National Institute of Infectious Diseases) as antigen by incubating at 4°C overnight. As a negative control, lysates of SFTSV-uninfected Huh7 cells were fixed in the same way. After washing once with TBS-T, cells were blocked with 20% Blocking One (nacalai tesque, Kyoto, Japan) at room temperature for 1 hr. After washing once with TBS-T, infected mouse serum diluted 100–409,600 times in 4-fold increments with 20% Blocking One was added and left at 37°C for 2 hr. After washing three times with TBS-T, a secondary antibody (Purified Recomb Protein A/G Peroxidase Conjugated; Thermo Fischer Scientific) diluted 20,000 times with 20% Blocking One/TBS-T was added and left at 37° C for 1 hr. After washing three times with TBS-T, the ELISA POD Substrate TMB Kit (nacalai tesque) was added and allowed to develop color (room temperature for 30 min). The reaction was stopped by adding dilute sulfuric acid. For each dilution rate, the OD405 value of the lysate of infected cells minus the OD405 value of the lysate of uninfected cells was used as the measurement value, and the cut-off value was set by adding twice the standard deviation to the mean value measured in the 100-fold diluted sera of the mock group. The maximum dilution rate that exceeded the cut-off value in the sera from each AAV9-inoculated individual was defined as the limiting dilution rate. Sera from each individual were assayed in triplicates.
Neutralizing assay
Recombinant VSV SFTS pseudovirus (rVSV-SFTSV) expressing the SFTSV glycoprotein on its envelope was used to measure neutralizing ability, as described in a previous paper [25, 26]. Sera from mice inoculated with the AAV9-SFTSV vaccine were diluted in PBS in 2-fold steps from 5–320 times. The diluted sera were mixed with equal volumes of the rVSV-SFTSV solution and incubated at 37°C for 1 hr. A mixture of serum and rVSV-SFTSV (20 µL/well) was added to the culture medium (Eagle’s minimal essential medium, E-MEM/5% FBS, 100 µL/well) of Vero9013 cells prepared at 70–80% semi-confluency in 96-well plates (three wells per condition). After 2 hr at 37°C, the culture medium was removed, washed once with fresh culture medium, and 100 µL/well of fresh culture medium was added again and incubated at 37°C for 24 hr. The luciferase reaction was performed using the recommended protocol of the luciferase reaction reagent (Bright-Glo; Promega), and images were captured using ImageQuant 800. Relative reaction intensities were calculated using ImageQuant TL and the average reaction intensities of mock sera (six mice, three wells/cell) at the same dilution rate were set to 100. The mean of the response intensities at each dilution rate in the mock group minus two standard deviations was set as the cut-off value, and the maximum dilution rate below the cut-off value in the serum obtained from each AAV9 inoculated individual was set as the limiting dilution rate.
Statistical analysis
Dunnett’s test was performed for each measurement point to determine the change in mouse body weight gain rate after vaccination with AAV9-SFTSV. The Wilcoxon test was used to compare genomic levels in each organ between the SFTSV Gn- and Gc-inoculated groups. The Kruskal-Walls test followed by a Steel-Dwass test was used to compare genomic levels between organs within each vaccination group. The Wilcoxon test was used to compare antibody levels in each organ.
RESULTS
Design and preparation of the AAV9-SFTSV vaccines
AAV9-SFTSV Gn and AAV9-SFTSV Gc were created as SFTS vaccine candidates using AAV9, wherein the SFTS glycoproteins Gn and Gc were loaded on AAV9 (Fig. 1B). The vaccines were designed to carry the sequence of each glycoprotein, including the transmembrane site, from the M segment of the YG1 strain, which was the first SFTSV isolated in Japan. A CAG promoter was placed upstream of the SFTSV Gn and Gc genomes to promote the strong expression of each glycoprotein in mammalian cells.
AAV9-SFTSV vaccines were produced using reverse genetics technology, wherein three types of plasmids were transfected into HEK293T cells. Moreover, cell lysates expressing the vaccines were purified by ultracentrifugation to obtain the full capsids of AAV9-SFTSV Gn and AAV9-SFTSV Gc.
Expression of SFTSV glycoprotein by infection of HEK293T cells with the AAV9-SFTSV vaccines
We confirmed the in vitro expression of the SFTSV glycoprotein by infecting HEK293T cells with AAV9-SFTSV Gn and AAV9-SFTSV Gc using Western Blotting. Rabbit polyclonal anti-SFTSV Gn or Gc antibodies were used as the primary antibodies, and the proteins were expressed at approximately 60 kDa (arrow) in both Gn and Gc cells (Fig. 1C). SFTSV Gn and Gc expressed by AAV9-SFTSV infection were detected, because the theoretical molecular weights of SFTSV Gn and Gc monomers calculated from the amino acid sequence were 58.9 kDa and 57.8 kDa, respectively. Anti-Gc polyclonal antibody-specific proteins with molecular weights greater than 220 kDa (arrowhead) were identified in cells infected with AAV9-SFTSV Gc in HEK293T.
The expression of SFTSV Gn and Gc was confirmed by immunostaining. HEK293T cells infected with AAV9-SFTSV Gn or AAV9-SFTSV Gc were fixed with methanol and stained with rabbit polyclonal anti-SFTSV Gn or Gc antibodies as the primary antibody. In contrast to AAV9-uninfected cells (Negative Control), AAV9-SFTSV Gn or AAV9-SFTSV Gc treated cells expressed proteins specific to anti-Gn or anti-Gc polyclonal antibodies (Fig. 1D). These results suggested that the constructed AAV9-SFTSV vaccines were capable of expressing the target proteins, SFTSV Gn and Gc, in mammalian cells.
Evaluation of the immunogenicity of the AAV9-SFTSV vaccines by immunization test of normal mice
Impact on the rate of weight gain: We conducted an immunization study in normal mice to confirm the effectiveness of AAV9-SFTSV Gn and AAV9-SFTSV Gc as anti-SFTS vaccines. We compared the results with those of the mock group, which received only the Formulation Buffer as an inoculation. An increase in body weight was observed over time after inoculation with AAV9-SFTSV Gn or AAV9-SFTSV Gc (Fig. 2A). A comparison of the rate of increase between the inoculated and mock groups at 1, 2, 3, and 4-week post-inoculation revealed no significant differences (P>0.05) at any of the time points. These suggest that AAV9-SFTSV injection did not significantly affect the physical condition of the mice.
Fig. 2.
Inoculation of mice with the adeno-associated virus 9-severe fever with thrombocytopenia syndrome virus vaccine. (A) Percentage of body weight gain (%) over time in mice inoculated with the adeno-associated virus (AAV) 9-severe fever with thrombocytopenia syndrome virus (SFTSV) vaccine (average value of six mice per group). Error bar shows the ± standard error. Dunnett’s test for the mock group was performed at each weekly measurement point, and no significant differences were detected. (B) DNA extracts from each organ were diluted to a concentration of 2 ng/µL and used for 2 ng/Polymerase Chain Reaction (PCR). Real-time PCR was performed with primer sets for Gn, Gc, and Reference (beta-actin), and the number of copies of Gn or Gc per reference was calculated using the ΔΔCq method. The mean ± standard error are shown in the figure (n=6). Wilcoxon test, Kruskal-Walls test, and Steel-Dwass test were performed to assess significance between the groups using the mean values of three repeated measurements, employing DNA extracted separately from each individual and organ (Table 2). Gray highlight indicates P<0.05; bold indicates P≤0.01. (C) RNA extracts from each organ were diluted to 10 ng/µL and used for the 10 ng/PCR. Real-time PCR was performed with primer sets for Gn, Gc, and Reference (beta-actin), and the number of copies of Gn or Gc per reference was calculated by ΔΔCq method. The mean ± standard error was shown in the figure. Wilcoxon test, Kruskal-Walls test, and Steel-Dwass test were performed between groups using the mean values of three repeated measurements of mRNA extracted from each individual and organ (Table 3). Gray highlight indicates P<0.05.
Transmission of SFTSV Gn, Gc DNA to various organs: To confirm the organ distribution after inoculation with AAV9-SFTSV Gn and AAV9-SFTSV Gc by intramuscular injection, we quantified Gn and Gc DNA levels in each organ (Fig. 2B, Table 2). The levels of Gn DNA in the liver and spleen were relatively high, with more than 1 × 104 copies of relative DNA. However, these levels were lower in the muscle (P=0.063) than those in the spleen. In the cerebral cortex, Gn DNA levels were significantly lower than 1/100 of those in the liver (P<0.05), spleen (P<0.05), and muscles (P<0.05). The Gc-inoculated group showed a trend similar to that of Gn. The levels of Gc DNA in the liver, spleen, and muscle were relatively high, with more than 1 × 103 copies of the relative DNA. In the cerebral cortex, the levels were lower than 1/100 of those in the liver (P=0.187), spleen (P=0.187), and muscles (P=0.187). When Gn and Gc DNA levels were compared in each organ, no significant differences were observed, except in the spleen (P<0.01). These findings indicate that the AAV9-SFTSV vaccines are efficiently delivered to the muscle where they are administered. However, they also spread to the liver and spleen.
Table 2. Wilcoxon test and Steel-Dwass test results (P value) of amount of DNA in each organ.
mRNA Expression in various organs: We compared the Gn and Gc mRNA levels in each organ after AAV9-SFTSV vaccination (Fig. 2C, Table 3). The liver and muscle of both the Gn- and Gc-inoculated groups showed relatively high mRNA expression levels. The mRNA expression level in the cerebral cortex was lower than that in the muscle: 1/77 in Gn (P<0.05) and 1/26 in Gc. The spleen showed the lowest mRNA expression levels in these organs: 1/2,313 in Gn (P<0.05) and 1/98 in Gc (P=0.187), compared to that in the muscle.
Table 3. Wilcoxon test and Steel-Dwass test results (P value) of amount of mRNA in each organ.
When comparing the mRNA expression levels in each organ between Gn and Gc, we found that Gn had higher expression levels in the liver, muscle (P<0.05), and cortex. DNA expression levels were nearly identical between Gn and Gc, as shown previously. These findings indicated that the mRNA expression efficiency of DNA delivered by AAV9-SFTSV vaccines was greater for Gn than for Gc.
Production of anti-SFTSV antibodies with neutralizing ability against SFTSV pseudovirus: The expression of anti-SFTSV antibodies after AAV9-SFTSV vaccination was quantified using ELISA. To determine the levels of anti-SFTSV antibodies in the serum, limiting serum dilution was performed, and the results are shown in Fig. 3A. The average antibody production in the Gn-inoculated group was 2,350-fold dilution; however, considerable variations were observed among individuals. In two of the six Gn-inoculated mice, anti-SFTSV antibodies were not detected, even at 100-fold, the lowest dilution in the assay. In contrast, the average antibody production in the Gc-inoculated group was 55,200-fold dilution. All six mice showed a >4,800-fold dilution, which was significantly higher than that in the Gn vaccination group (P<0.05).
Fig. 3.
Quantification of anti-severe fever with thrombocytopenia syndrome virus antibodies and neutralizing antibodies of adeno-associated virus 9-severe fever with thrombocytopenia syndrome virus vaccine inoculated mice sera. (A) Antibody levels in the sera from mice 4 weeks after vaccination were determined using Enzyme-Linked Immuno Sorbent Assay (ELISA). Antibody levels for each individual are plotted as circles (●). The mean ± standard error of the antibody level of all individuals is shown as a bar graph, and individuals whose antibody production could not be detected at 100-fold dilution in any of the three repeat measurements were excluded from the plot but considered in the calculation of the mean value as 0 antibody level. The Wilcoxon test was performed to compare the Gn- and Gc-inoculated groups. (B) Neutralizing titers were measured in the sera of mice at 4 weeks after vaccination. Neutralizing titers of each individual are plotted as ●. Three of the six individuals in both the adeno-associated virus (AAV) 9-severe fever with thrombocytopenia syndrome virus (SFTSV) Gn and Gc vaccination groups were excluded from the plot because neutralizing titers could not be detected, even at a 5-fold dilution. The mean ± standard error of the antibody titers for all individuals is shown as a bar graph, and individuals for whom no neutralizing titer was detected at the 5× dilution were counted as zero in the mean calculation. (C) The antibody levels and neutralizing titers (Table 4) for each mouse at 4 weeks after vaccination were plotted on a scatter plot to obtain a linear correlation function. Each individual of Gn- and Gc-inoculated group are plotted as circles (●) and triangle (▲) respectively. (D) The antibody levels and DNA levels of each tissue for each mouse at 4 weeks after vaccination were plotted on a scatter plot to obtain a correlation function. Both x-axis and y-axis are displayed in a log scale, and the correlation was obtained by power approximation. (E) The antibody levels and mRNA levels of each tissue for each mouse at 4 weeks after vaccination were plotted on a scatter plot to obtain a correlation function. Both x-axis and y-axis are displayed in a log scale, and the correlation was obtained by power approximation.
To confirm the neutralizing ability of the anti-SFTSV antibodies against SFTSV, a neutralization test using rVSV-SFTSV was conducted (Fig. 3B). The average neutralizing titer in the Gn-inoculated group was 36.7-fold, and some individuals showed neutralizing ability even at a 160-fold dilution. Individual analysis (Fig. 3C, Table 4) showed a clear positive correlation (R2>0.95) between the amount of anti-SFTSV antibody and the neutralizing titer. In contrast, the average neutralizing titer in the Gc-inoculated group was 5.0-fold higher. Although the Gc-inoculated group had a considerably higher amount of anti-SFTSV antibodies than that of the Gn-inoculated group, an inverse correlation between the neutralizing titers of the Gc- and Gn-inoculated groups were observed. These results indicate that inoculation with AAV9-SFTSV Gc induced strong anti-SFTSV antibody expression; nevertheless, the neutralizing capacity of the expressed antibodies was low. In contrast, inoculation with AAV9-SFTSV Gn resulted in limited expression of anti-SFTSV antibodies; however, the developed antibodies had a strong neutralizing ability.
Table 4. Neutralization and antibody titer of individual mouse.
| Individual | Neutralization titer | Antibody titer | |
|---|---|---|---|
| Gn | 1 | 40 | 800 |
| 2 | <5 | 200 | |
| 3 | <5 | <100 | |
| 4 | <5 | <100 | |
| 5 | 160 | 12,800 | |
| 6 | 20 | 300 | |
| Gc | 1 | <5 | 12,800 |
| 2 | 10 | 25,600 | |
| 3 | 10 | 102,400 | |
| 4 | 10 | 102,400 | |
| 5 | <5 | 11,200 | |
| 6 | <5 | 76,800 | |
DISCUSSION
Although vaccination is the most effective method of preventing infectious diseases, no SFTS vaccine is currently approved for animals or humans. Gn and Gc are key antigens in SFTS vaccine research because they possess neutralizing antibody induction sites [31]. In this study, we evaluated the immunogenicity of the AAV9-SFTSV vaccine as a candidate using an AAV vector to transfer the genomic information of Gn and Gc into the body.
When the AAV9-SFTSV vaccines infected HEK293T cells, both the results of Western blotting analysis and immunostaining revealed the expression of anti-SFTSV Gn and Gc antibody-specific proteins. Western blotting analysis showed a protein of approximately 60 kDa, matching the theoretical molecular weight of Gn and Gc. This study uncovered that Gc-infected HEK293T cells contained anti-SFTSV antibody-specific proteins exceeding 220 kDa. The glycoproteins in various viruses of the order Bunyavirales to which SFTSV belongs are recognized for forming multimeric structures [8]. Additionally, SFTSV Gc is reported to form a trimer as the intracellular pH decreases, indicating that some Gc expressed during AAV9-SFTSV infection may form a trimer or higher-order configurations [7].
AAV9-SFTSV vaccines were administered to healthy mice to evaluate their efficacy and safety. After vaccination, no significant difference in weight gain between the vaccinated and mock groups were observed. None of the vaccination groups showed any typical symptoms associated with adverse reactions, such as depression or decreased vitality. Moreover, the major organs exhibited no pathological symptoms during autopsy (data not shown).
Although AAV vectors are generally known as safer than other utilized adenoviral vectors for in vivo gene therapy, previous studies and clinical trials have evaluated the safety of AAV vectors for clinical application [9, 11, 29]. AAV9 is highly directed towards the liver, and its effect on liver function is of concern. In the present study, no adverse effects, such as weight loss or pathological changes in various organs, were observed, although the AAV9 vector genome dose (1 × 1013 vg/kg) was higher than that in previous studies using AAV9 as a delivery tool for vaccine antigens [23]. However, this was a single-dose, short-term (4-week) study, and the evaluation method was limited to checking body weight and visual confirmation of various organs. Therefore, conducting additional tests on the safety of AAV9-SFTSV vaccines at higher doses and for longer durations is necessary.
The biodistribution of Gn and Gc DNA in normal mice after intramuscular injection of AAV9-SFTSV vaccine showed relatively high DNA levels in the liver, spleen, and muscles. The liver and muscles have been reported to be the organs to which AAV9 is more strongly directed than the other AAV serotypes [36]. In proportion to DNA distribution, Gn and Gc mRNA expression levels in the liver and muscle were higher than those in other organs. In contrast, the amount of DNA in the cerebral cortex was lower in the Gn- and Gc-inoculated groups than in the liver and muscle, and the same was observed for mRNA expression. AAV9 is used to treat neurological genetic disorders, such as Zolgensma, because of its high efficiency of DNA transfer to the central nervous system compared with other serotypes [36]. When AAV9 is used as a vaccine, its ability to transmit antigens to the nervous system is low from a safety viewpoint because antigen transmission to neurons may trigger adverse effects. With this regard, the lower DNA and mRNA expression in the cerebral cortex supports the safety of AAV9-SFTSV vaccines.
The Gn and Gc DNA levels in the spleen were not significantly different from those in the liver and muscle. The results of the present study support those of a previous study evaluating the post-inoculation biodistribution of AAV9 following the localization of AAV-derived DNA after intravenous or intramuscular inoculation [34]. This study showed that AAV-derived DNA was observed in the spleen after both intravenous and intramuscular inoculation and that AAV DNA was highly concentrated in the germinal center of the spleen, where B cells are found. Additionally, AAV capsids are reported to accumulate in germinal centers too. Historically, B cells have been considered an AAV transduction-resistant cell type [15]. In this study, the mRNA levels in the spleen were lower than those in the liver and muscle unlike DNA. These results, together with those of previous studies, suggest that AAV reaching the spleen infects a group of cells, mainly B cells, but does not transcribe mRNA or express target proteins.
We observed that mice that received the AAV9-SFTSV vaccine had significantly higher levels of anti-SFTSV antibodies in their serum, with the Gc group showing higher levels than the Gn group. However, the Gn group exhibited a greater ability to neutralize. The DNA expression levels of Gn and Gc SFTSV in mice were comparable when inoculated with AAV9-SFTSV Gn and AAV9-SFTSV Gc, respectively. This is because the vector genomes of the inoculated AAV vectors were the same, and the amounts of DNA in various organs were almost identical between the Gn- and Gc-inoculated groups (except for expression in the spleen). However, Gn mRNA expression levels in various organs were higher than those in Gc. These findings suggest that SFTSV Gn is a better antigen for the SFTS vaccine, because it can induce high mRNA expression and neutralizing ability, whereas SFTS Gc has a high ability to produce antibodies with low neutralizing ability. Although both SFTSV Gn and Gc have been reported to be capable of inducing neutralizing antibodies, the presence of multiple neutralizing epitopes on SFTSV Gn has been confirmed [16, 31]; however, those on Gc have not yet been reported. The difference in the number of neutralizing epitopes between SFTSV Gn and Gc may explain these results.
The mice group that received the Gn vaccination had an average neutralizing titer of 36.7-fold dilution and a maximum of 160-fold dilution. Previous studies have shown that vaccinated mice have a mean neutralizing titer ranging from 16-to 160-fold, providing protection against SFTSV [5, 10, 27, 32, 35]. Therefore, we inferred that vaccination with the AAV9-SFTSV Gn vaccine increased neutralizing titers to protect mice from the SFTSV. On the other hand, in three of the six mice inoculated with AAV9-SFTSV Gn did not show the expression of neutralizing antibodies even at 5-fold dilution, the lowest dilution rate evaluated in the neutralization test. Individual analysis of the Gn inoculation groups showed a clear positive correlation (R2 >0.95) between the amount of anti-SFTSV antibody and neutralizing titer (Fig. 3C, Table 4). The correlation between the amount of SFTSV Gn genome (DNA and mRNA expression levels) in each organ and the amount of anti-SFTSV antibody was also evaluated (Fig. 3Dand 3E). Supprisingly, both DNA and mRNA expression levels in the liver showed a negative correlation (R2>0.5) against anti-SFTSV antibody titer while no correlation was observed in muscle and spleen. These findings suggested that individual differences in AAV infection or DNA preservation in the liver occur in the Gn-inoculated group, and that individuals with lower levels of DNA and mRNA expression are more prone to generating anti-SFTSV and neutralizing antibodies.
Further investigation is needed to determine the cause of the individual differences in the Gn-inoculated group. No correlation between mRNA expression in muscle and the anti-SFTSV antibody levels suggested that the intramuscular inoculation of AAV9-SFTSV Gn occurred without any issues in all mice. However, AAV9-SFTSV Gn that reached the liver from the muscle may have changed due to slight variations in the angle and depth of needle entry during inoculation or the flow velocity during injection. Further studies are necessary to investigate the relationship between decreased mRNA expression in the liver and the increased production of anti-SFTSV antibodies as well as neutralizing antibodies. The liver is also involved in immune function, and Kupffer cells have phagocytic, antigen-presenting, and cytokine-producing abilities. SFTSV Gn expressed in the liver should normally function as an immunogen and promote the expression of anti-SFTSV antibodies, but for some reason, we speculate that the regulatory function of the immune response is activated and the production of anti-SFTSV antibodies is suppressed. In the future, it is deemed necessary to collect organs related to the immune system, such as the liver, lymph nodes, and spleen, from individuals in the Gn-inoculated group with varying levels of anti-SFTSV antibodies, and to evaluate them histologically and molecularly.
Vaccines using various modalities have been used to develop SFTS vaccines, such as plasmid DNA [12], recombinant vesicular stomatitis virus (rVSV) [5], vaccinia virus [32], rhabdovirus [27], and adenovirus [35] have been reported as representative examples. All previous studies have reported the expression of neutralizing antibodies and the protection of mice from SFTSV challenge, suggesting that the vaccines are effective. However, challenges associated with each of these modalities exist. Plasmid DNA vaccines require multiple inoculations to ensure efficacy, and nuclear transfer of plasmid DNA must be accelerated by electroporation during inoculation. The development of pharmaceuticals using similar modalities for rVSV, vaccinia virus, and rhabdovirus is limited and the establishment of manufacturing methods is expected to be a major challenge for their commercialization. Adenoviruses are highly immunogenic when inoculated as viral vectors, and their adverse reactions are an issue. AAV vectors can overcome these limitations. Moreover, they do not require special inoculations such as electroporation, and long-term immunization is presumed to be achievable with only one inoculation. Several drugs using AAV vectors have already been approved, and more clinical trials are being conducted worldwide than with the other modalities described above. Therefore, the challenges to commercialization are minimal. Moreover, another advantage of AAV vector lies in their enhanced safety profile compared to alternative viral vectors and resulting in fewer adverse reactions during inoculation.
These findings suggested that AAV9-SFTSV Gn, in particular, exhibits a high level of safety and effectiveness. Results in this study are in line with previous clinical trials using AAV9. This efficacy can be inferred from the ability of AAV9-SFTSV Gn to induces neutralizing titers comparable to those reported in previous studies. Furthermore, AAV9-SFTSV Gn showed the same efficacy as a single intramuscular inoculation, which was a more convenient approach compared to previous studies that required multiple inoculations or electroporation. In the future, optimization of the Gn sequence and promoter as well as evaluation of efficacy by simultaneous loading of other antigen genomes, including Gc, should be conducted to enhance the usefulness of the AAV9-SFTSV vaccine.
CONFLICT OF INTEREST
This study was funded by Kyoritsu Seiyaku Corporation.
Acknowledgments
This work was supported by Kyoritsu Seiyaku Corporation. We gratefully acknowledge Ms. Natsuko Teshima and Yuka Nunomura for their technical support. This study was conducted as part of the Frontier One Health Nexus project promoted by TUAT.
REFERENCES
- 1.Aurnhammer C, Haase M, Muether N, Hausl M, Rauschhuber C, Huber I, Nitschko H, Busch U, Sing A, Ehrhardt A, Baiker A. 2012. Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. Hum Gene Ther Methods 23: 18–28. doi: 10.1089/hgtb.2011.034 [DOI] [PubMed] [Google Scholar]
- 2.Blair HA. 2022. Onasemnogene Abeparvovec: A review in spinal muscular atrophy. CNS Drugs 36: 995–1005. doi: 10.1007/s40263-022-00941-1 [DOI] [PubMed] [Google Scholar]
- 3.Chen L, Chen T, Li R, Xu Y, Xiong Y. 2023. Recent advances in the study of the immune escape mechanism of SFTSV and its therapeutic agents. Viruses 15: 940. doi: 10.3390/v15040940 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Demminger DE, Walz L, Dietert K, Hoffmann H, Planz O, Gruber AD, von Messling V, Wolff T. 2020. Adeno-associated virus-vectored influenza vaccine elicits neutralizing and Fcγ receptor-activating antibodies. EMBO Mol Med 12: e10938. doi: 10.15252/emmm.201910938 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Dong F, Li D, Wen D, Li S, Zhao C, Qi Y, Jangra RK, Wu C, Xia D, Zhang X, Deng F, Chandran K, Zou Z, Yuan F, Zheng A. 2019. Single dose of a rVSV-based vaccine elicits complete protection against severe fever with thrombocytopenia syndrome virus. NPJ Vaccines 4: 5. doi: 10.1038/s41541-018-0096-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Du L, He Y, Wang Y, Zhang H, Ma S, Wong CKL, Wu SHW, Ng F, Huang JD, Yuen KY, Jiang S, Zhou Y, Zheng BJ. 2006. Recombinant adeno-associated virus expressing the receptor-binding domain of severe acute respiratory syndrome coronavirus S protein elicits neutralizing antibodies: Implication for developing SARS vaccines. Virology 353: 6–16. doi: 10.1016/j.virol.2006.03.049 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Halldorsson S, Behrens AJ, Harlos K, Huiskonen JT, Elliott RM, Crispin M, Brennan B, Bowden TA. 2016. Structure of a phleboviral envelope glycoprotein reveals a consolidated model of membrane fusion. Proc Natl Acad Sci USA 113: 7154–7159. doi: 10.1073/pnas.1603827113 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hulswit RJG, Paesen GC, Bowden TA, Shi X. 2021. Recent advances in bunyavirus glycoprotein research: Precursor processing, receptor binding and structure. Viruses 13: 1–30. doi: 10.3390/v13020353 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Jiang H, Lillicrap D, Patarroyo-White S, Liu T, Qian X, Scallan CD, Powell S, Keller T, McMurray M, Labelle A, Nagy D, Vargas JA, Zhou S, Couto LB, Pierce GF. 2006. Multiyear therapeutic benefit of AAV serotypes 2, 6, and 8 delivering factor VIII to hemophilia A mice and dogs. Blood 108: 107–115. doi: 10.1182/blood-2005-12-5115 [DOI] [PubMed] [Google Scholar]
- 10.Kang JG, Jeon K, Choi H, Kim Y, Kim HI, Ro HJ, Seo YB, Shin J, Chung J, Jeon YK, Kim YS, Lee KH, Cho NH. 2020. Vaccination with single plasmid DNA encoding IL-12 and antigens of severe fever with thrombocytopenia syndrome virus elicits complete protection in IFNAR knockout mice. PLoS Negl Trop Dis 14: e0007813. doi: 10.1371/journal.pntd.0007813 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kaplitt MG, Feigin A, Tang C, Fitzsimons HL, Mattis P, Lawlor PA, Bland RJ, Young D, Strybing K, Eidelberg D, During MJ. 2007. Safety and tolerability of gene therapy with an adeno-associated virus (AAV) borne GAD gene for Parkinson’s disease: an open label, phase I trial. Lancet 369: 2097–2105. doi: 10.1016/S0140-6736(07)60982-9 [DOI] [PubMed] [Google Scholar]
- 12.Kwak JE, Kim YI, Park SJ, Yu MA, Kwon HI, Eo S, Kim TS, Seok J, Choi WS, Jeong JH, Lee H, Cho Y, Kwon JA, Jeong M, Maslow JN, Kim YE, Jeon H, Kim KK, Shin EC, Song MS, Jung JU, Choi YK, Park SH. 2019. Development of a SFTSV DNA vaccine that confers complete protection against lethal infection in ferrets. Nat Commun 10: 3836. doi: 10.1038/s41467-019-11815-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Δ Δ C(T)) Method. Methods 25: 402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
- 14.Luo LM, Zhao L, Wen HL, Zhang ZT, Liu JW, Fang LZ, Xue ZF, Ma DQ, Zhang XS, Ding SJ, Lei XY, Yu XJ. 2015. Haemaphysalis longicornis ticks as reservoir and vector of severe fever with thrombocytopenia syndrome virus in China. Emerg Infect Dis 21: 1770–1776. doi: 10.3201/eid2110.150126 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.McCarty DM. 2008. Self-complementary AAV vectors; advances and applications. Mol Ther 16: 1648–1656. doi: 10.1038/mt.2008.171 [DOI] [PubMed] [Google Scholar]
- 16.Moming A, Shi S, Shen S, Qiao J, Yue X, Wang B, Ding J, Hu Z, Deng F, Zhang Y, Sun S. 2021. Fine mapping epitope on Glycoprotein-Gn from severe fever with thrombocytopenia syndrome virus. PLoS One 16: e0248005. doi: 10.1371/journal.pone.0248005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.National Institute of Infectious Diseases.2023. Sever fever with thrombocytopenia virus. https://www.niid.go.jp/niid/ja/sfts/3143-sfts.html [accessed on Aug 5, 2023].
- 18.Nieto K, Salvetti A. 2014. AAV vectors vaccines against infectious diseases. Front Immunol 5: 5. doi: 10.3389/fimmu.2014.00005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Patel U, Boucher M, de Léséleuc L, Visintini S. 2016. Voretigene neparvovec: an emerging gene therapy for the treatment of inherited blindness. CADTH Horizon Scans 169: 1–11. [PubMed] [Google Scholar]
- 20.Peng J, Zou WW, Wang XL, Zhang ZG, Huo R, Yang L. 2023. Viral-mediated gene therapy in pediatric neurological disorders. World J Pediatr.doi: 10.1007/s12519-022-00669-4 [DOI] [PubMed] [Google Scholar]
- 21.Ploquin A, Szécsi J, Mathieu C, Guillaume V, Barateau V, Ong KC, Wong KT, Cosset FL, Horvat B, Salvetti A. 2013. Protection against henipavirus infection by use of recombinant adeno-associated virus-vector vaccines. J Infect Dis 207: 469–478. doi: 10.1093/infdis/jis699 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Serumwerk Bernburg AG. 2021. OptiPrep Application Sheet V14. https://diagnostic.serumwerk.com/wp-content/uploads/2021/05/V14-Serumwerk.pdf. [accessed on August 5, 2023].
- 23.Sipo I, Knauf M, Fechner H, Poller W, Planz O, Kurth R, Norley S. 2011. Vaccine protection against lethal homologous and heterologous challenge using recombinant AAV vectors expressing codon-optimized genes from pandemic swine origin influenza virus (SOIV). Vaccine 29: 1690–1699. doi: 10.1016/j.vaccine.2010.12.037 [DOI] [PubMed] [Google Scholar]
- 24.Takahashi T, Maeda K, Suzuki T, Ishido A, Shigeoka T, Tominaga T, Kamei T, Honda M, Ninomiya D, Sakai T, Senba T, Kaneyuki S, Sakaguchi S, Satoh A, Hosokawa T, Kawabe Y, Kurihara S, Izumikawa K, Kohno S, Azuma T, Suemori K, Yasukawa M, Mizutani T, Omatsu T, Katayama Y, Miyahara M, Ijuin M, Doi K, Okuda M, Umeki K, Saito T, Fukushima K, Nakajima K, Yoshikawa T, Tani H, Fukushi S, Fukuma A, Ogata M, Shimojima M, Nakajima N, Nagata N, Katano H, Fukumoto H, Sato Y, Hasegawa H, Yamagishi T, Oishi K, Kurane I, Morikawa S, Saijo M. 2014. The first identification and retrospective study of Severe Fever with Thrombocytopenia Syndrome in Japan. J Infect Dis 209: 816–827. doi: 10.1093/infdis/jit603 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Tani H, Kawachi K, Kimura M, Taniguchi S, Shimojima M, Fukushi S, Igarashi M, Morikawa S, Saijo M. 2019. Identification of the amino acid residue important for fusion of severe fever with thrombocytopenia syndrome virus glycoprotein. Virology 535: 102–110. doi: 10.1016/j.virol.2019.06.014 [DOI] [PubMed] [Google Scholar]
- 26.Tani H, Shimojima M, Fukushi S, Yoshikawa T, Fukuma A, Taniguchi S, Morikawa S, Saijo M. 2016. Characterization of glycoprotein-mediated entry of severe fever with thrombocytopenia syndrome virus. J Virol 90: 5292–5301. doi: 10.1128/JVI.00110-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Tian L, Yan L, Zheng W, Lei X, Fu Q, Xue X, Wang X, Xia X, Zheng X. 2021. A rabies virus vectored severe fever with thrombocytopenia syndrome (SFTS) bivalent candidate vaccine confers protective immune responses in mice. Vet Microbiol 257: 109076. doi: 10.1016/j.vetmic.2021.109076 [DOI] [PubMed] [Google Scholar]
- 28.U.S. Food and Drug Administration.2023. HEMGENIX. https://www.fda.gov/vaccines-blood-biologics/vaccines/hemgenix [accessed on Aug 5, 2023].
- 29.Wagner JA, Messner AH, Moran ML, Daifuku R, Kouyama K, Desch JK, Manley S, Norbash AM, Conrad CK, Friborg S, Reynolds T, Guggino WB, Moss RB, Carter BJ, Wine JJ, Flotte TR, Gardner P. 1999. Safety and biological efficacy of an adeno-associated virus vector-cystic fibrosis transmembrane regulator (AAV-CFTR) in the cystic fibrosis maxillary sinus. Laryngoscope 109: 266–274. doi: 10.1097/00005537-199902000-00017 [DOI] [PubMed] [Google Scholar]
- 30.World Health Organization. 2018. WHO Research and Development Blueprint −2018 Annual review of diseases prioritized under the Research and Development Blueprint. World Health Organization 1–17.
- 31.Wu Y, Zhu Y, Gao F, Jiao Y, Oladejo BO, Chai Y, Bi Y, Lu S, Dong M, Zhang C, Huang G, Wong G, Li N, Zhang Y, Li Y, Feng WH, Shi Y, Liang M, Zhang R, Qi J, Gao GF. 2017. Structures of phlebovirus glycoprotein Gn and identification of a neutralizing antibody epitope. Proc Natl Acad Sci USA 114: E7564–E7573. doi: 10.1073/pnas.1705176114 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Yoshikawa T, Taniguchi S, Kato H, Iwata-Yoshikawa N, Tani H, Kurosu T, Fujii H, Omura N, Shibamura M, Watanabe S, Egawa K, Inagaki T, Sugimoto S, Phanthanawiboon S, Harada S, Yamada S, Fukushi S, Morikawa S, Nagata N, Shimojima M, Saijo M. 2021. A highly attenuated vaccinia virus strain LC16m8-based vaccine for severe fever with thrombocytopenia syndrome. PLoS Pathog 17: e1008859. doi: 10.1371/journal.ppat.1008859 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Yu XJ, Liang MF, Zhang SY, Liu Y, Li JD, Sun YL, Zhang L, Zhang QF, Popov VL, Li C, Qu J, Li Q, Zhang YP, Hai R, Wu W, Wang Q, Zhan FX, Wang XJ, Kan B, Wang SW, Wan KL, Jing HQ, Lu JX, Yin WW, Zhou H, Guan XH, Liu JF, Bi ZQ, Liu GH, Ren J, Wang H, Zhao Z, Song JD, He JR, Wan T, Zhang JS, Fu XP, Sun LN, Dong XP, Feng ZJ, Yang WZ, Hong T, Zhang Y, Walker DH, Wang Y, Li DX. 2011. Fever with thrombocytopenia associated with a novel bunyavirus in China. N Engl J Med 364: 1523–1532. doi: 10.1056/NEJMoa1010095 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zhao J, Yue Y, Patel A, Wasala L, Karp JF, Zhang K, Duan D, Lai Y. 2020. High-resolution histological landscape of AAV DNA distribution in cellular compartments and tissues following local and systemic injection. Mol Ther Methods Clin Dev 18: 856–868. doi: 10.1016/j.omtm.2020.08.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Zhao Z, Zheng W, Yan L, Sun P, Xu T, Zhu Y, Liu L, Tian L, He H, Wei Y, Zheng X. 2020. Recombinant human adenovirus type 5 co-expressing RABV G and SFTSV Gn induces protective immunity against rabies virus and severe fever with thrombocytopenia syndrome virus in mice. Front Microbiol 11: 1473. doi: 10.3389/fmicb.2020.01473 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zincarelli C, Soltys S, Rengo G, Rabinowitz JE. 2008. Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection. Mol Ther 16: 1073–1080. doi: 10.1038/mt.2008.76 [DOI] [PubMed] [Google Scholar]





