Abstract
Ticks are vectors for transmitting tick-borne pathogens (TBPs) in animals and humans. Therefore, tick identification is necessary to understand the distribution of tick species and the pathogens they carry. Unfortunately, data on dog ticks and the TBPs they harbor in Malawi are incomplete. This study aimed to identify dog ticks and the TBPs they transmit in Malawi. One hundred thirty-two ticks were collected from 87 apparently healthy but infested domestic dogs in four districts of Malawi, which were pooled into 128 tick samples. The ticks were morphologically identified under a stereomicroscope using identification keys, and species identification was authenticated by polymerase chain reaction (PCR) through the amplification and sequencing of 12S rRNA and cytochrome c oxidase subunit I (CO1) genes. The tick species identified were Rhipicephalus sanguineus sensu lato (58.3%), Haemaphysalis elliptica (32.6%), and Hyalomma truncatum (9.1%). Screening for TBPs using species-specific PCR assays revealed that 48.4% of the ticks were infected with at least one TBP. The TBP detection rates were 13.3% for Anaplasma platys, 10.2% for Babesia rossi, 8.6% for B. vogeli, 6.3% for Ehrlichia canis, 3.9% for A. phagocytophilum, 3.1% for B. gibsoni, 2.3% for B. canis and 0.8% for Hepatozoon canis. Co-infections of up to three pathogens were observed in 48.4% of the positive samples. This is the first study to identify dog ticks and the TBPs they harbor in Malawi. These findings provide the basis for understanding dog tick distribution and pathogens they carry in Malawi. This study necessitates the examination of ticks from more study locations to have a better picture of tick challenge, and the development of ticks and tick-borne disease control methods in Malawi.
Keywords: 12S rRNA, cytochromecoxidase subunit I, dog, Malawi, tick distribution
Ticks are obligate blood-sucking arthropods of animals and are second only to mosquitoes in terms of sucking blood worldwide [18, 53]. They carry and transmit a wide range of pathogens, such as protozoa, viruses, bacteria, and Rickettsia, posing significant challenges to humans and animals they parasitize [12, 16, 56]. Globally, more than 900 tick species have been identified, with about 40 of them recognized in Europe alone [24, 30]. Ten tick genera (seven hard tick genera and three soft tick genera) have been accurately identified, documented, and precisely confirmed to cause substantial economic losses in the livestock industry in South Africa [30, 38]. Ticks and tick-borne diseases (TTBDs) cause significant economic damage in many resource-limited African countries, where resources are essentially channeled toward poverty and hunger reduction rather than fighting TTBDs [21, 46, 57].
Compared with other domesticated animals, dogs have relatively unrestricted movement throughout the globe. During the free movements, ticks are transmitted and propagate a variety of pathogens. The infectious agents transmitted by ticks to dogs have negative repercussions due to treatment costs for pet owners, decreased productivity in terms of security where dogs are kept for these reasons, and, most importantly, the danger of zoonoses [47, 62].
At least eighty percent of the global population is at risk of TBDs due to ticks [41]. In Africa, emphasis has been placed on studies of the ticks and tick-borne pathogens (TTBPs) of cattle and small ruminants, thereby neglecting domesticated dogs, which exist in large numbers, live in close contact with humans, and are potential hosts and reservoirs for various pathogens. In Malawi, three tick genera, Amblyomma, Hyalomma, and Rhipicephalus, have been morphologically identified in cattle [10, 11, 48, 61]. On the other hand, TBPs of genera Anaplasma, Babesia, Ehrlichia, and Hepatozoon have also been found in dog blood in Malawi [3, 15].
Despite several studies on the identification and distribution of ticks in livestock, very few studies have focused on TTBPs in dogs in Africa, and this has contributed to a loss in the fight against TBDs in animals and humans alike. Apart from South Africa [40, 44, 66, 67] and Nigeria [2], where dog TTBPs have been extensively studied, a few publications from the Cape Verde islands [23], Zimbabwe [33], Sudan [55], and Zambia [51, 52] have also been recorded.
In the past decades, remarkable advances in tick species identification and population genetic characterization using DNA techniques and other sequence evaluations have been determined [41], and different markers on coding as well as non-coding genes have also been reported [8]. These advances in tick species identification are still useful today and offer meaningful results in this field. Among the coding genes used in tick phylogenetic analyses, the mitochondrial 12S rRNA gives more resolution from the genus to the species level [8, 49, 50]. In contrast, the intraspecific variation within species has been successfully determined using the mitochondrial cytochrome c oxidase subunit 1 (CO1) gene [17, 32]. Further, the internal transcribed spacers (ITS1 and ITS2), non-coding loci of nuclear rDNA sequences, have also been used, although they have failed to distinguish species from the same tick platform [14, 45].
In most sub-Saharan African countries, such as Malawi, high levels of rainfall as well as dry to warm climatic conditions, coupled with increased numbers of stray and neglected dogs roaming around in search of food, contribute to favorable conditions for tick spread and development [15, 20]. Malawi has 866,222 dogs, one-third of which are neglected and do not receive proper supervision [48].
Therefore, this study aimed to identify dog ticks and detect TBPs of veterinary and public health importance from those ticks in Malawi using morphological and molecular diagnostic techniques to come up with recommendations, further future study suggestions, and gaps leading to the creation of possible distribution maps of TTBPs.
MATERIALS AND METHODS
Study location
Malawi is a landlocked country located in sub-Saharan Africa. It shares boundaries with Mozambique to the south and east, Zambia to the west, and Tanzania to the north. It has three administrative regions, namely southern, central, and northern regions, and has 28 districts. Tick samples were collected from four districts: Chikwawa (16.0438° S, 34.8017° E) in the southern region, Ntchisi (13.2842° S, 33.8858° E) and Kasungu (13.0357° S, 33.4720° E) in the central region, and Mzimba (11.8992° S, 33.5924° E) in the northern region (Fig. 1). The southern region of Malawi is characterized by a mild to warm climate with temperatures ranging from 25°C to 40°C and a dry period approximately from May to November, while December to April is the rainy period. The central and northern regions have mild to cold climates with temperatures ranging from 10°C to 35°C and rains from January to April.
Fig. 1.
Map of Malawi showing sampling sites. The colored areas indicate different locations for sample collection. The numbers indicate ticks collected and number of dogs sampled per location.
Ethical clearance
Sampling permission number DAHLD 002/2022 was granted by the Ministry of Agriculture, Irrigation and Water Development in Malawi (MoAIWD) through the Department of Animal Health and Livestock Development (DAHLD) for sampling in this study. Ticks were collected based on the ethical guidelines stipulated by Obihiro University of Agriculture and Veterinary Medicine, Hokkaido, Japan (animal experiment approval ID numbers: 22-23).
Tick collection and morphological identification
One hundred thirty-two ticks from 87 apparently healthy but infested domesticated dogs were collected between October 2021 and March 2022 during rabies vaccination campaigns in the study sites, most of which were in rural areas where veterinary services such as dipping and other tick control measures are unavailable. All the sampled dogs were owned with minimum supervision and care by the owners. Some of the sampled dogs were used for hunting in the surrounding bushes. In Chikwawa district, 43 tick samples from 27 dogs were collected. In Ntchisi district, 29 tick samples from 22 dogs were collected while in Kasungu district, 28 tick samples from 19 dogs were collected, and in Mzimba district, 32 tick samples from 19 dogs were collected (Fig. 1). The ticks were collected from body sites of tick visibility and abundance, which included abdominal areas, the head, ears, and perineum. The collected tick species from one host were stored in one vial containing 70% ethanol for preservation and refrigerated until further processing. Ticks were individually examined and identified to determine their genus, species, developmental stage, and sex using taxonomic keys under a stereomicroscope (Olympus SZX16, Tokyo, Japan) [65].
Tick DNA extraction
Ticks preserved in 70% ethanol were washed with sterile distilled water and air-dried to ensure no impurities were included. Genomic DNA was extracted from individual adults and nymphs, while 2–3 larvae were pooled based on host dog and location. The ticks were frozen in liquid nitrogen for easy crushing using a sterile pestle, and DNA extraction was done using a Nucleospin® Tissue DNA extraction kit according to the protocol provided by the manufacturer (Macherey-Nagel, Duren, Germany). DNA was eluted with 30 µL of elution buffer, and the concentration was checked by NanoDrop™ spectrophotometer (Thermo Fisher Scientific, Delaware, DE, USA). The extracted DNA was stored at −30°C until screening for various pathogens.
Molecular identification of ticks and tick-borne pathogens
For molecular confirmation of the tick species, tick DNA was subjected to PCR amplification and sequencing based on 12S rRNA and CO1, using the primers presented in Table 1. Tick-borne pathogens were screened using previously established species-specific PCR assays (Table 1). The PCR assays were performed in a mixture of 10 µL comprising 0.2 µL of each 10 µM primer, 2 µL of a 5× Standard buffer, 0.2 µL of 10 mM deoxynucleotide triphosphate mix (dNTPs), 0.05 µL of Taq polymerase (New England Biolabs, Ipswich, UK), 2 µL of template DNA sample, and 5.35 µL of UltraPure™ water (Invitrogen, Waltham, MA, USA). The PCR reactions were performed in a thermal cycler (VeritiPro™, Applied Biosystems, Foster City, CA, USA), with conditions obtained from previous studies (Table 1). The PCR products were then run on 1.5% agarose gel, stained in ethidium bromide solution, and viewed on a UV transilluminator.
Table 1. The primers used in tick identification and tick-borne pathogen detection in this study.
| Target organisms (gene) | Assay | 5′-3′ | An. Temp. (°C) | Reference |
|---|---|---|---|---|
| Babesia canis (18S rRNA) | PCR | GCATCTGGAATAGCTAGTGC | 68 | [4] |
| TGGAAATGACCTACAACATAC | ||||
| B. vogeli (18S rRNA) | PCR | GCATCTGGAATAGCTAGTGC | 68 | [4] |
| CTGCTTCTAAACCAGAAGTG | ||||
| B. gibsoni (18S rRNA) | nPCR | CGTTTATTAGTTCTAAACCTCC | 58 | [29] |
| GACAAGGCAAGTAGCCGAG | ||||
| Anaplasma phagocytophilum (16S rRNA) | PCR | GCTGAATGTGGGGATAATTTAT | 58 | [28] |
| ATGGCTGCTTCCTTTCGGTTA | ||||
| A. platys (groEL) | nPCR | TTTGTCGTAGCTTGCTATG | 50 | [9] |
| GAGTTTGCCGGGACTTCTTCT | ||||
| Tick (CO1) | PCR | CTTCAGCCATTTTACCGCGA | 50 | [37] |
| CTCCGCCTGAAGGGTCAAA | ||||
| Ehrlichia canis (gltA) | PCR | GATGATGTCTGAAGATATGAAACA | 58 | [57] |
| CTGCTCGTCTATTTTACTTCTTAA | ||||
| Hepatozoon canis (18S rRNA) | PCR | ATACATGAGCAAAATCTCAAC | 55 | [27] |
| CTTATTATTCCATGCTGCAG | ||||
| Tick (12S rRNA) | PCR | AAACTAGGATTAGATACCCTATTA | 50 | [47] |
| CTATGTAACGACTTATCTTAATAA | ||||
| Rickettsia spp. (gltA) | PCR | AGAACGAACGCTGGCGGCAAGCC | 50 | [13] |
| CGTATTACCGCGGCTGCTGGCA | ||||
| Coxiella burnetii (16S rRNA) | PCR | ACTCAACGCACTGGAACCGC | 54 | [49] |
| TAGCTGAAGCCAATTCGCC | ||||
| B. rossi (18S rRNA) | PCR | GGAAGGAGAAGTCGTAACAAGGT | 68 | [4] |
| CTCAGAACTTCAGGCCATCCAAAG |
PCR=polymerase chain reaction; nPCR=Nested PCR; An. Temp.=annealing temperature.
The PCR bands were cut from the gel and purified using Nucleospin® Gel and PCR Clean-up kit (Macherey-Nagel, Düren, Germany) following the manufacturer’s instructions. The purified PCR products were sequenced directly using a BigDye™ Terminator Cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) and ABI Prism 3100 Genetic Analyzer (Applied Biosystems). Codon Code Aligner version 9 software (Codon Code Corporation, Centerville, MA, USA) was used for trimming, assembling, and generating the consensus sequences for the reads. The BLASTn analysis was performed to confirm the identity of the sequences. In the case of the tick sequences, the best chromatogram sequences from one of the two genes in tick identification were considered for assembly.
Accession numbers
All sequences in the GenBank with a 96–100% similarity score were considered relevant. Consensus sequences were deposited in GenBank, and the following accession numbers were assigned: OQ727052–OQ727055 (B. canis), OQ727056–OQ727057 (B. gibsoni), OQ727058–OQ727061 (B. rossi), OQ727063–OQ727065 (B. vogeli), OQ727066–OQ727067 (H. canis), OQ727068–OQ727069 (A. phagocytophilum), OQ786049–OQ786051 (A. platys), OQ849998–OQ850001 (E. canis), OQ786828–OQ786829 (Ha. elliptica), OQ776914–OQ776918 (Hy. truncatum), and OQ778741–OQ778744 (R. sanguineus sensu lato).
Phylogenetic analysis and detection rate calculation
The CO1 and 12S rRNA genes were used each on the selected PCR amplicons, and the clearer gene sequence was opted for; thus, CO1 or 12S rRNA genes were not exclusively used (each gene was used to confirm the tick species identified, and the gene that gave best chromatogram was trimmed, assembled and generated into final consensus sequence). The nucleotide sequences from the tick species (CO1 for Hy. truncatum and 12S rRNA for R. sanguineus sensu lato and Ha. elliptica) and the TBPs were assembled by using Clustal W multiple alignments in MEGA X software [63]. Additionally, maximum likelihood (ML) trees were constructed for the sequences generated herein, along with those previously deposited in the GenBank, to understand the evolutionary relationships. The TTBP prevalence was calculated using the formula: P (%)=number of detected pathogens (TBP) or identified ticks divided by the total number of samples analyzed multiplied by 100. Thus, P (%)=TTBP/Total samples × 100.
RESULTS
Tick collection and species identification
One hundred thirty-two dog tick samples from four study locations were properly examined in this study using a stereomicroscope and taxonomic keys. Of these tick samples, 43 were individual male adults and 77 were individual female adults, five were individual nymphs, and seven larvae were pooled into three samples. After the pooling of samples, DNA were prepared from a total of 128 pools.
Three tick species, namely R. sanguineus sensu lato (n=77; 58.3%), Ha. elliptica (n=43; 32.6%), and Hy. truncatum (n=12; 9.1%), were identified in this study. All the larvae identified belonged to R. sanguineus sensu lato and nymphs belonged to Ha. elliptica. In addition, all three species were identified in all four study areas (Table 2). The Hy. truncatum sequences in this study based on the CO1 gene (OQ776914–OQ776918) showed 96–100% identity with those already deposited in the GenBank. The phylogenetic analysis indicated that OQ776914 clustered in an isolated subclade together with AJ437087 from a dog in Ethiopia. Sequences OQ776915, OQ776917, and OQ776918 showed a 97% similarity and were closely related to OQ457675 from Kenya. While, sequence OQ776916 was included in a subclade along with OK576097 from Cameroon, which is a sister to the subclade formed by isolates from Kenya and Malawi (Fig. 2). On the other hand, the phylogenetic analysis of tick sequences based on the 12S rRNA gene showed that R. sanguineus sensu lato sequences OQ778741–OQ778744 (96–100% identity) clustered in the same clade with the sequences from Colombia (KC018072), Senegal (KU255856), Angola (MF425971 and MF425979), South Africa (MK158973), and the USA (OM985379). Furthermore, a Ha. elliptica sequence (OQ786828) was most closely related to HM068953 (identified from a dog in South Africa), while OQ786829 grouped with MZ351125 from Eswatini and AF150035 from Zimbabwe (Fig. 3).
Table 2. Morphological identification of ticks based on the study sites.
| Tick species | Ticks per site | Total (%) | |||
|---|---|---|---|---|---|
| Chikwawa | Kasungu | Mzimba | Ntchisi | ||
| Ha. elliptica | 13 | 8 | 11 | 11 | 43 (32.6) |
| Hy. truncatum | 1 | 4 | 3 | 4 | 12 (9.1) |
| R. sanguineus sl | 29 | 16 | 18 | 14 | 77 (58.3) |
| Total (%) | 43 (32.6) | 28 (21.2) | 32 (24.2) | 29 (22.0) | 132 (100) |
Ha. elliptica=Haemaphysalis elliptica; Hy. truncatum=Hyalomma truncatum; R. sanguineus sl=Rhipicephalus sanguineus sensu lato.
Fig. 2.
Hyalomma truncatum phylogenetic analysis based on the cytochrome c oxidase subunit I gene. MEGA X software was used in constructing the tree based on the maximum likelihood method and Kimura 2-parameter model. The sequences in red are those obtained in this study. KX000641 (Hyalomma rufipes) was used as an outgroup.
Fig. 3.
Rhipicephalus sanguineus sensu lato and Haemaphysalis elliptica phylogenetic analysis based on the 12S rRNA gene. MEGA X software was used in constructing the tree based on the maximum likelihood method and Hasegawa-Kishino Yano model. The sequences in red are those obtained in this study. LC612441 (Amblyomma variegatum) was used as an outgroup.
Pathogen detection rates in tick samples
A total of 62 (48.4%) tick samples were positive for at least one of the detected pathogens, whereas 66 ticks (51.6%) were free from the screened pathogens. On the other hand, 34.9% (15/43) of male ticks and 37.7% (29/77) of female tick samples were positive for one or more pathogens. Concerning the developmental stages, 36.7% (44/120) adults and 20.0% (1/5) nymphs were infected with at least one TBP, while no larval tick samples were infected with any TBP.
Of the 43 Ha. elliptica ticks identified, 30.2% (13/43) were positive for B. rossi, and 7.0% (3/43) were positive for B. canis (Table 3). The detected pathogens in R. sanguineus sensu lato ticks included A. platys (23.3%; 17/73), E. canis (8.2%; 6/73), A. phagocytophilum (6.8%; 5/73), B. gibsoni (1.4%; 1/73), B. vogeli (11.0%; 8/73), and H. canis (1.4%; 1/73). On the other hand, 25.0% (3/12), 25.0% (3/12), and 16.7% (2/12) of Hy. truncatum ticks were positive for B. gibsoni, B. vogeli, and E. canis, respectively (Table 3).
Table 3. Summary of detection rates of pathogens per tick species.
| Tick species | Tick-borne pathogen (%) | Total | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| A. phago | A. platys | B. canis | B. gibsoni | B. rossi | B. vogeli | H. canis | E. canis | C. burnetii | Rickettsia spp. | ||
| Ha. elliptica (n=43) | nd | nd | 3 (7.0) | nd | 13 (30.2) | nd | nd | nd | nd | nd | 16 |
| Hy. truncatum (n=12) | nd | nd | nd | 3 (25.0) | nd | 3 (25.0) | nd | 2 (16.7) | nd | nd | 8 |
| R. sanguineus sl (n=73) | 5 (6.8) | 17 (23.3) | nd | 1 (1.4) | nd | 8 (11.0) | 1 (1.4) | 6 (8.2) | nd | nd | 38 |
| Total (n=128) | 5 (3.9) | 17 (13.3) | 3 (2.3) | 4 (3.1) | 13 (10.2) | 11 (8.6) | 1 (0.8) | 8 (6.3) | nd | nd | 62 |
Ha. elliptica=Haemaphysalis elliptica; Hy. truncatum=Hyalomma truncatum; R. sanguineus sl=Rhipicephalus sanguineus sensu lato; A. phago=Anaplasma phagocytophilum; A. platys=Anaplasma platys; B. canis=Babesia canis; B. gibsoni=Babesia gibsoni; B. rossi=Babesia rossi; B. vogeli=Babesia vogeli; H. canis=Hepatozoon canis; E. canis=Erlichia canis; C. burnetii=Coxiella burnetii; nd=not detected.
TBPs were detected from the ticks in all four study locations in this study. A. phagocytophilum was detected in ticks from Kasungu, Mzimba, and Ntchisi. B. canis was detected in ticks from Chikwawa, Kasungu, and Mzimba, while B. gibsoni was detected in ticks from Chikwawa, Kasungu, and Ntchisi. Interestingly, H. canis was only detected in a lone tick sample from Chikwawa. Meanwhile, A. platys, B. rossi, B. vogeli, and E. canis were detected from all the study locations (Table 4).
Table 4. Pathogen detection rates in tick pools per study location in Malawi.
| Pathogen | Chikwawa (%) | Kasungu (%) | Mzimba (%) | Ntchisi (%) | Total (n=29) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Hae (n=13) | Hyt (n=1) | Rssl (n=25) | Total (n=39) | Hae (n=8) | Hyt (n=4) | Rssl (n=16) | Total (n=28) | Hae (n=11) | Hyt (n=3) | Rssl (n=18) | Total (n=32) | Hae (n=11) | Hyt (n=4) | Rssl (n=14) | |||
| Anaplasma platys | nd | nd | 4 (16.0) | 4 (10.3) | nd | nd | 1 (6.3) | 1 (3.6) | nd | nd | 9 (50.0) | 9 (28.1) | nd | nd | 3 (21.4) | 3 (10.3) | |
| A. phagocytophilum | nd | nd | nd | nd | nd | nd | 2 (12.5) | 2 (7.1) | nd | nd | 1 (5.6) | 1 (3.1) | nd | nd | 2 (14.3) | 2 (6.9) | |
| Babesia canis | 1 (7.7) | nd | nd | 1 (2.6) | 1 (12.5) | nd | nd | 1 (3.6) | 1 (9.1) | nd | nd | 1 (3.1) | nd | nd | nd | nd | |
| B. gibsoni | nd | 1 (100.0) | nd | 1 (2.6) | nd | 2 (50.0) | nd | 2 (7.1) | nd | nd | nd | nd | nd | nd | 1 (7.1) | 1 (3.4) | |
| B. rossi | 3 (23.1) | nd | nd | 3 (7.7) | 4 (50.0) | nd | nd | 4 (14.3) | 2 (18.2) | nd | nd | 2 (6.3) | 4 (36.4) | nd | nd | 4 (13.8) | |
| B. vogeli | nd | 1 (100.0) | 3 (12.0) | 4 (10.3) | nd | 2 (50.0) | nd | 2 (7.1) | nd | nd | 2 (11.1) | 2 (6.3) | nd | nd | 3 (21.4) | 3 (10.3) | |
| Ehrlichia canis | nd | nd | 1 (4.0) | 1 (2.6) | nd | 2 (50) | 1 (6.3) | 3 (10.7) | nd | nd | 3 (16.7) | 3 (9.4) | nd | nd | 1 (7.1) | 1 (3.5) | |
| Rickettsia spp. | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | |
| Coxiella burnetii | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | |
| Hyalomma canis | nd | nd | 1 (4.0) | 1 (2.6) | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | nd | |
Hae: Haemaphysalis elliptica; Hyt: Hyalomma truncatum; Rs sl: Rhipicephalus sanguineus sensu lato; nd: not detected; n: total number of tick samples.
Pathogens of up to three infections were detected in the positive samples in this study. Single infection was found in the majority (25.0%; 32/128) of ticks, whereas those with dual and triple infections were observed in 14.1% (18/128) and 9.4% (12/128) ticks, respectively (Supplementary Table 1). Among the co-infections, the B. vogeli and A. platys combination was the most frequent (n=4), followed by the combination of A. platys and A. phagocytophilum (n=2) (Supplementary Table 1).
The TBP sequences based on the 18S rRNA gene revealed that B. vogeli, B. rossi, B. gibsoni, and B. canis had 96–99%, 98%, 96–99%, and 97–100% identity with the reference sequences in the GenBank, respectively. Phylogenetic analysis for B. rossi sequences in this study (OQ727058–OQ727061) clustered in a clade formed by those from Zambia (LC331056), Sudan (DQ111760), China (MH727061), and Turkey (MK918601) (Supplementary Fig. 1). Similarly, the B. vogeli sequences generated in this study (OQ727063–OQ727065) clustered in the clade formed by those from Zambia (LC331058), Malawi (LC556376), China (HM590440), Brazil (AY371196), and Myanmar (LC602475). The B. canis sequences obtained herein (OQ727052–OQ727055) clustered in one clade together with those from Croatia (AY072926), Estonia (KT008057), Romania (MW939359), Italy (KX839231), and Turkey (KF499115). However, OQ727052 was more closely located in the B. vogeli clade. In the phylogenetic tree inferred from the 18S rRNA gene sequences of B. gibsoni and H. canis, B. gibsoni sequences (OQ727056–OQ727057) grouped with MN134506 and KC461261 from India, AB118032 from Japan, and MT752610 from Italy (Fig. 4). Likewise, H. canis sequences generated from this study were included in a clade formed by those from the GenBank with an identity of 97–99% (Fig. 4).
Fig. 4.
Babesia gibsoni and Hepatozoon canis phylogenetic analyses based on the 18S rRNA gene. MEGA X software was used to construct the tree based on the maximum likelihood method and Kimura 2-parameter model. The sequences in red are those obtained in this study. M19172 (Plasmodium falciparum) was used as an outgroup.
Anaplasma platys and A. phagocytophilum sequences had 97–100% and 99% similarity with sequences from GenBank, respectively. The groEL gene sequences of A. platys clustered in one clade along with most of those previously deposited in the GenBank (Fig. 5). A. phagocytophilum 16S rRNA sequences were most closely related to the MK814410 isolate from a dog in South Africa (Supplementary Fig. 2). Meanwhile, gltA gene sequences of E. canis had 99–100% similarity to those in the GenBank and formed two subclades, with OQ849998–OQ850000 clustering with sequences previously obtained from Thailand (MW382940), the Philippines (JN391409), Zambia (LC373038), Malawi (LC556380), and Myanmar (LC545960), and the sequence OQ850001 was closely related to sequences from China (OL907288 and KX987357) (Supplementary Fig. 3). Although Coxiella burnetii and Rickettsia spp. were screened from the ticks in this study, none of these pathogens were detected.
Fig. 5.
Anaplasma platys phylogenetic analysis based on the groEL gene. MEGA X software was used to construct the tree based on the maximum likelihood method and Jukes-Cantor model. The sequences in red are those obtained in this study. U96733 (Rickettsia rickettsia) was used as an outgroup.
DISCUSSION
The TBPs of genera Anaplasma, Babesia, Ehrlichia, and Hepatozoon cause economically and clinically important canine diseases. However, the challenge of such TBPs in Malawi is worsened by the small number of qualified veterinarians coupled with rural communities with limited knowledge of controlling tick vectors and related TBDs.
There is a knowledge gap in the identification and distribution of dog ticks in Malawi, which presents challenges to TTBD control and prevention. Information on dog tick identification is scarce in Africa, with just a few studies conducted in South Africa [25, 67] and Lesotho [40]. A lot of studies have put much focus on dog blood for TBP screening in most African countries, namely Zambia [53, 63, 66], Zimbabwe [35], Malawi [3, 15], Lesotho [42], South Africa [27,28,29, 43, 60, 67], Ethiopia [35], and Sudan [55]. Increasing knowledge about dog ticks, the common pathogens they carry, and the potential risks they pose to their hosts is one step in the fight against TBDs. Understanding tick distribution, with the goal of proper management of such ticks, is a significant milestone in the fight against them.
The present study reports the presence of R. sanguineus sensu lato, Hy. truncatum, and Ha. elliptica in domestic dogs in Malawi for the first time. The three tick species herein were identified in all four study locations: Chikwawa, Mzimba, Kasungu, and Ntchisi. This finding indicates that dog ticks are widely distributed in Malawi despite geographical and climatic condition differences.
The phylogenetic analyses, based on the CO1 and 12S rDNA genes, showed that the Malawian dog ticks have a higher genetic diversity among them due to the introduction of ticks from bordering countries. The CO1 gene sequences of Hy. truncatum obtained in this study clustered in different subclades with other sequences from African countries such as Cameroon, Kenya, and Ethiopia, indicating that the Hy. truncatum from Malawian dogs are descended from genetically different lineages. Similarly, analysis of 12S rRNA gene sequences for R. sanguineus sensu lato species in this study showed that they clustered in a clade, where OQ778742 and OQ778743 formed a subclade within the main clade. This suggests that the R. sanguineus sensu lato ticks parasitizing dogs in Malawi may have been from similar lineages. Moreover, the Ha. elliptica sequences were clustered in two different subclades, suggesting two lineages of Ha. elliptica ticks are prevalent in dogs in Malawi. This might be due to the introduction of ticks to Malawi along with imported dogs from other neighboring countries. The introduced ticks might further propagate and expand their populations, yielding descendants of multiple lineages.
We also report TBPs B. gibsoni, B. vogeli, and E. canis detected from Hy. truncatum ticks and B. canis and B. rossi from Ha. elliptica ticks. Moreover, A. platys, A. phagocytophilum, B. gibsoni, B. vogeli, E. canis, and H. canis were detected from R. sanguineus sensu lato ticks. These findings agree with previous literature on the known ticks to transmit the TBPs [26, 36, 42, 51].
Canine anaplasmosis, babesiosis, ehrlichiosis, and hepatozoonosis are common TBDs worldwide, some of which are zoonotic [64]. Anaplasma platys and A. phagocytophilum cause anaplasmosis in dogs and are usually transmitted by tick vectors R. sanguineus and Ixodes spp., respectively [39, 64]. Recently, A. platys and A. phagocytophilum have been reported to pose public health concerns [5]. In this study, we reported detection rates of 13.3% for A. platys and 3.9% for A. phagocytophilum, which were detected only in R. sanguineus sensu lato ticks from dogs in Malawi. The detection rate of A. platys in this study is higher than that of 6.5% from India [1], 2.4% previously reported in dog blood samples in Malawi [15], 2.5% in Italy [38], 1.9% in Nigeria [31], and 1% in Zambia [61, 64]. However, the detection rate in this study is lower than that of Thailand (13.9%) [20] and Kenya (14.3%) [54]. This might be due to differences in pathogen sources between the blood samples in other studies and the tick samples in this study. These variations might also be attributed to differences in the climatic conditions in these study areas. The phylogenetic analysis of A. platys based on the groEL gene showed that the sequences are clustered in one clade, suggesting that this gene is highly conserved among A. platys isolates in canine ticks in Malawi.
On the other hand, A. phagocytophilum, a causative agent of human and canine granulocytic anaplasmosis, is a zoonotic parasite and may lead to acute and subclinical disease with fever, central nervous system dysfunction, anorexia, and lameness in the animal host [28]. The A. phagocytophilum detection rate in this study is lower than that in South Africa (7.0%) [49]. This might be due to differences in climatic conditions that affect the survival and maintenance of ticks and pathogens in these study areas. The phylogenetic analysis based on the 16S rRNA gene showed that the sequences clustered in the same subclade, suggesting a single genotype of A. phagocytophilum is prevalent in Malawian dog ticks.
Babesiosis in dogs is caused by Babesia species such as B. canis, B. gibsoni, B.rossi, B. negevi, B. vogeli, and B. conradae. The disease is characterized by thrombocytopenia, anemia, high fever, and shock [7], leading to high economic losses by pet owners through treatments and decreased productivity [46]. Haemaphysalis elliptica is the principal tick vector implicated in its transmission [58]. In most studies of dog blood samples, B. rossi is detected the most, as compared to B. vogeli [2, 43, 44, 55, 61]. We report detection rates of 10.2% for B. rossi, 8.6% for B. vogeli, and 2.3% for B. canis from dog ticks in this study. Interestingly, B. gibsoni and B. vogeli were detected in Hy. truncatum ticks. The detection of B. gibsoni and B. vogeli DNA in Hy. truncatum does not necessarily mean that this tick is a biological vector as Ha. elliptica and R. sanguineus sensu lato are known biological vectors in Africa [43]. Phylogenetic analysis for B. rossi sequences in this study clustered in the same clade along with those previously isolated from Malawi, Zambia, Sudan, and Turkey. Similarly, sequences for B. vogeli clustered in the same clade with those from Venezuela, Zambia, Malawi, China, Brazil, and Myanmar. Furthermore, B. canis sequences obtained herein also clustered in one clade, together with those from Croatia, Estonia, Romania, and Turkey. The 18S rRNA gene sequences of B. gibsoni obtained in this study also clustered in one clade together with isolates from India, Japan, and Italy. These findings suggest that only one genotype for each of the Babesia species is circulating in Malawian dog ticks.
Hepatozoon canis causes clinical illness in dogs by affecting hemolymphatic tissues, leading to anemia, loss of body condition, lethargy, and wasting in immunocompromised patients [6]. Rhipicephalus sanguineus sensu lato is responsible for transmitting H. canis to dogs in Africa [34, 47, 65]. The detection rate of H. canis in this study was 0.8% in dog ticks in Malawi, which was lower than that of a previous report (19.1%) from dog blood samples in Malawi [15]. This variation might be due to differences in the pathogen source, ticks in this study, and blood in the previous study. Differences in geographical areas of sampling, number of dogs sampled and the target gene may also be reasons for the difference observed. In the phylogenetic analysis, the sequences of H.canis obtained in this study were clustered in the same clade formed by those from Italy, Cuba, Zambia, South Africa, and Sudan, showing that H. canis in dog ticks in Malawi are highly similar to those present in other countries.
Ehrlichia canis causes canine ehrlichiosis [22, 49], and human ehrlichiosis [59]. Herein, we report a detection rate of 6.3% for E. canis in Hy. truncatum and R. sanguineus s. l. ticks. The gltA gene sequences of E. canis obtained from this study clustered in different subclades, showing a high diversity of the gltA gene in dog ticks in Malawi. This suggests that there might be multiple strains circulating in Malawian dog ticks.
Moreover, this study screened for Coxiella burnetii and Rickettsia spp. from the dog ticks, but none of the pathogens were detected. This may be due to the fact that these pathogens are not common in dog ticks in Africa.
This study also reports the detection of more than one pathogen in almost half (30/62, 48.4%) of the positive samples, signifying a possible increased risk of dogs in Malawi contracting multiple infections at once [19, 37]. The co-infections of Babesia spp. and H. canis in dogs have been documented to have altered the clinical presentation of the canine disease [61]. In areas where tick vectors have an overlapping distribution, it is very common to find co-infections, as compared with areas where there is no tick–vector overlap [44].
The study is an eye opener on the need to plan for control measures in areas where ticks were not known to be available. However, more studies need to be conducted to have a clearer picture of the tick distribution maps in Malawi.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
Supplementary Material
Acknowledgments
This work was supported by a Grant-in-Aid for Scientific Research and the Japan Society for the Promotion of Science (JSPS) (18KK0188): Core-to-Core program, from the Ministry of Education, Culture, Sports, Science, and Technology of Japan, and a grant from the Strategic International Collaborative Research Project, promoted by the Ministry of Agriculture, Forestry, and Fisheries of Japan (JPJ008837). We thank Nathan Kamanga, Dallion Stopher, Wanangwa Mhonjo, Joe Magombo, and all dog owners for the crucial roles they played in this study.
REFERENCES
- 1.Abd Rani PA, Irwin PJ, Coleman GT, Gatne M, Traub RJ. 2011. A survey of canine tick-borne diseases in India. Parasit Vectors 4: 141. doi: 10.1186/1756-3305-4-141 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Adamu M, Troskie M, Oshadu DO, Malatji DP, Penzhorn BL, Matjila PT. 2014. Occurrence of tick-transmitted pathogens in dogs in Jos, Plateau State, Nigeria. Parasit Vectors 7: 119. doi: 10.1186/1756-3305-7-119 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Alvåsen K, Johansson SM, Höglund J, Ssuna R, Emanuelson U. 2016. A field survey on parasites and antibodies against selected pathogens in owned dogs in Lilongwe, Malawi. J S Afr Vet Assoc 87: e1–e6. doi: 10.4102/jsava.v87i1.1358 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Annoscia G, Latrofa MS, Cantacessi C, Olivieri E, Manfredi MT, Dantas-Torres F, Otranto D. 2017. A new PCR assay for the detection and differentiation of Babesia canis and Babesia vogeli. Ticks Tick Borne Dis 8: 862–865. doi: 10.1016/j.ttbdis.2017.07.002 [DOI] [PubMed] [Google Scholar]
- 5.Arraga-Alvarado CM, Qurollo BA, Parra OC, Berrueta MA, Hegarty BC, Breitschwerdt EB. 2014. Case report: Molecular evidence of Anaplasma platys infection in two women from Venezuela. Am J Trop Med Hyg 91: 1161–1165. doi: 10.4269/ajtmh.14-0372 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Attipa C, Hicks CAE, Barker EN, Christodoulou V, Neofytou K, Mylonakis ME, Siarkou VI, Vingopoulou EI, Soutter F, Chochlakis D, Psaroulaki A, Papasouliotis K, Tasker S. 2017. Canine tick-borne pathogens in Cyprus and a unique canine case of multiple co-infections. Ticks Tick Borne Dis 8: 341–346. doi: 10.1016/j.ttbdis.2016.12.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Baneth G. 2011. Perspectives on canine and feline hepatozoonosis. Vet Parasitol 181: 3–11. doi: 10.1016/j.vetpar.2011.04.015 [DOI] [PubMed] [Google Scholar]
- 8.Beati L, Keirans JE. 2001. Analysis of the systematic relationships among ticks of the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on mitochondrial 12S ribosomal DNA gene sequences and morphological characters. J Parasitol 87: 32–48. doi: 10.1645/0022-3395(2001)087[0032:AOTSRA]2.0.CO;2 [DOI] [PubMed] [Google Scholar]
- 9.Ben Said M, Belkahia H, El Mabrouk N, Saidani M, Alberti A, Zobba R, Cherif A, Mahjoub T, Bouattour A, Messadi L. 2017. Anaplasma platys-like strains in ruminants from Tunisia. Infect Genet Evol 49: 226–233. doi: 10.1016/j.meegid.2017.01.023 [DOI] [PubMed] [Google Scholar]
- 10.Berggren SA. 1978. Cattle ticks in Malawi. Vet Parasitol 4: 289–297. doi: 10.1016/0304-4017(78)90055-9 [DOI] [Google Scholar]
- 11.Black WC, 4th, Klompen JSH, Keirans JE. 1997. Phylogenetic relationships among tick subfamilies (Ixodida: Ixodidae: Argasidae) based on the 18S nuclear rDNA gene. Mol Phylogenet Evol 7: 129–144. doi: 10.1006/mpev.1996.0382 [DOI] [PubMed] [Google Scholar]
- 12.Boulanger N, Boyer P, Talagrand-Reboul E, Hansmann Y. 2019. Ticks and tick-borne diseases. Med Mal Infect 49: 87–97. doi: 10.1016/j.medmal.2019.01.007 [DOI] [PubMed] [Google Scholar]
- 13.Çetinkaya H, Matur E, Akyazi İ, Ekiz EE, Aydin L, Toparlak M. 2016. Serological and molecular investigation of Ehrlichia spp. and Anaplasma spp. in ticks and blood of dogs, in the Thrace Region of Turkey. Ticks Tick Borne Dis 7: 706–714. doi: 10.1016/j.ttbdis.2016.02.021 [DOI] [PubMed] [Google Scholar]
- 14.Chao LL, Wu WJ, Shih CM. 2011. Species identification of Ixodes granulatus (Acari: Ixodidae) based on internal transcribed spacer 2 (ITS2) sequences. Exp Appl Acarol 54: 51–63. doi: 10.1007/s10493-010-9419-z [DOI] [PubMed] [Google Scholar]
- 15.Chatanga E, Kainga H, Razemba T, Ssuna R, Swennen L, Hayashida K, Sugimoto C, Katakura K, Nonaka N, Nakao R. 2021. Molecular detection and characterization of tick-borne hemoparasites and Anaplasmataceae in dogs in major cities of Malawi. Parasitol Res 120: 267–276. doi: 10.1007/s00436-020-06967-y [DOI] [PubMed] [Google Scholar]
- 16.Chitimia L, Lin RQ, Cosoroaba I, Wu XY, Song HQ, Yuan ZG, Zhu XQ. 2010. Genetic characterization of ticks from southwestern Romania by sequences of mitochondrial cox1 and nad5 genes. Exp Appl Acarol 52: 305–311. doi: 10.1007/s10493-010-9365-9 [DOI] [PubMed] [Google Scholar]
- 17.Dabert M, Witalinski W, Kazmierski A, Olszanowski Z, Dabert J. 2010. Molecular phylogeny of acariform mites (Acari, Arachnida): strong conflict between phylogenetic signal and long-branch attraction artifacts. Mol Phylogenet Evol 56: 222–241. doi: 10.1016/j.ympev.2009.12.020 [DOI] [PubMed] [Google Scholar]
- 18.de la Fuente J, Estrada-Pena A, Venzal JM, Kocan KM, Sonenshine DE. 2008. Overview: ticks as vectors of pathogens that cause disease in humans and animals. Front Biosci 13: 6938–6946. doi: 10.2741/3200 [DOI] [PubMed] [Google Scholar]
- 19.Diuk-Wasser MA, Vannier E, Krause PJ. 2016. Coinfection by Ixodes tick-borne pathogens: ecological, epidemiological, and clinical consequences. Trends Parasitol 32: 30–42. doi: 10.1016/j.pt.2015.09.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Do T, Phoosangwalthong P, Kamyingkird K, Kengradomkij C, Chimnoi W, Inpankaew T. 2021. Molecular detection of tick-borne pathogens in stray dogs and Rhipicephalus sanguineus sensu lato ticks from Bangkok, Thailand. Pathogens 10: 561. doi: 10.3390/pathogens10050561 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Estrada-Peña A, de la Fuente J. 2014. The ecology of ticks and epidemiology of tick-borne viral diseases. Antiviral Res 108: 104–128. doi: 10.1016/j.antiviral.2014.05.016 [DOI] [PubMed] [Google Scholar]
- 22.Gallego MM, Triana-Chávez O, Mejia-Jaramillo AM, Jaimes-Dueñez J. 2023. Molecular characterization of Ehrlichia canis and Babesia vogeli reveals multiple genogroups associated with clinical traits in dogs from urban areas of Colombia. Ticks Tick Borne Dis 14: 102111. doi: 10.1016/j.ttbdis.2022.102111 [DOI] [PubMed] [Google Scholar]
- 23.Götsch S, Leschnik M, Duscher G, Burgstaller JP, Wille-Piazzai W, Joachim A. 2009. Ticks and haemoparasites of dogs from Praia, Cape Verde. Vet Parasitol 166: 171–174. doi: 10.1016/j.vetpar.2009.08.009 [DOI] [PubMed] [Google Scholar]
- 24.Guglielmone A, Richad R, Apanaskevich D, Petney T, Estrada-Pena A, Horak IG. 2010. The Argasidae, Ixodidae and Nuttalliellidae (Acari: Ixo- dida) of the world: a list of valid species names. Zootaxa 2528: 1–28. doi: 10.11646/zootaxa.2528.1.1 [DOI] [Google Scholar]
- 25.Horak IG, Emslie FR, Spickett AM. 2001. Parasites of domestic and wild animals in South Africa. XL. Ticks on dogs belonging to people in rural communities and carnivore ticks on the vegetation. Onderstepoort J Vet Res 68: 135–141. [PubMed] [Google Scholar]
- 26.Horak IG, Fourie LJ, Heyne H, Walker JB, Needham GR. 2002. Ixodid ticks feeding on humans in South Africa: with notes on preferred hosts, geographic distribution, seasonal occurrence and transmission of pathogens. Exp Appl Acarol 27: 113–136. doi: 10.1023/A:1021587001198 [DOI] [PubMed] [Google Scholar]
- 27.Inokuma H, Okuda M, Ohno K, Shimoda K, Onishi T. 2002. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet Parasitol 106: 265–271. doi: 10.1016/S0304-4017(02)00065-1 [DOI] [PubMed] [Google Scholar]
- 28.Inokuma H, Oyamada M, Kelly PJ, Jacobson LA, Fournier PE, Itamoto K, Okuda M, Brouqui P. 2005. Molecular detection of a new Anaplasma species closely related to Anaplasma phagocytophilum in canine blood from South Africa. J Clin Microbiol 43: 2934–2937. doi: 10.1128/JCM.43.6.2934-2937.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Inokuma H, Yoshizaki Y, Matsumoto K, Okuda M, Onishi T, Nakagome K, Kosugi R, Hirakawa M. 2004. Molecular survey of Babesia infection in dogs in Okinawa, Japan. Vet Parasitol 121: 341–346. doi: 10.1016/j.vetpar.2004.03.012 [DOI] [PubMed] [Google Scholar]
- 30.Jongejan F, Uilenberg G. 2004. The global importance of ticks. Parasitology 129Suppl: S3–S14. doi: 10.1017/S0031182004005967 [DOI] [PubMed] [Google Scholar]
- 31.Kamani J, Baneth G, Mumcuoglu KY, Waziri NE, Eyal O, Guthmann Y, Harrus S. 2013. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria. PLoS Negl Trop Dis 7: e2108. doi: 10.1371/journal.pntd.0002108 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Kawazoe K, Kawakita A, Kameda Y, Kato M. 2008. Redundant species, cryptic host-associated divergence, and secondary shift in Sennertia mites (Acari: Chaetodactylidae) associated with four large carpenter bees (Hymenoptera: Apidae: Xylocopa) in the Japanese island arc. Mol Phylogenet Evol 49: 503–513. doi: 10.1016/j.ympev.2008.07.024 [DOI] [PubMed] [Google Scholar]
- 33.Kennedy MA, Thompson RE, McRee Bakker A, Fung C, Dawson J, Parry R, Foggin C, Odoi A. 2021. Detection and analysis of tick-borne infections in communal dogs of northwest Zimbabwe. J S Afr Vet Assoc 92: e1–e4. doi: 10.4102/jsava.v92i0.2096 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol 35: 1547–1549. doi: 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Kumsa B, Laroche M, Almeras L, Mediannikov O, Raoult D, Parola P. 2016. Morphological, molecular and MALDI-TOF mass spectrometry identification of ixodid tick species collected in Oromia, Ethiopia. Parasitol Res 115: 4199–4210. doi: 10.1007/s00436-016-5197-9 [DOI] [PubMed] [Google Scholar]
- 36.Latrofa MS, Dantas-Torres F, Giannelli A, Otranto D. 2014. Molecular detection of tick-borne pathogens in Rhipicephalus sanguineus group ticks. Ticks Tick Borne Dis 5: 943–946. doi: 10.1016/j.ttbdis.2014.07.014 [DOI] [PubMed] [Google Scholar]
- 37.Leutenegger CM, Pusterla N, Mislin CN, Weber R, Lutz H. 1999. Molecular evidence of coinfection of ticks with Borrelia burgdorferi sensu lato and the human granulocytic ehrlichiosis agent in Switzerland. J Clin Microbiol 37: 3390–3391. doi: 10.1128/JCM.37.10.3390-3391.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Madder M,, Horak I, Stoltsz H. 2010. Ticks: tick identification. pp. 1-48. University of Pretoria, Faculty of Veterinary Science, Pretoria.
- 39.Maggi RG, Mascarelli PE, Havenga LN, Naidoo V, Breitschwerdt EB. 2013. Co-infection with Anaplasma platys, Bartonella henselae and Candidatus Mycoplasma haematoparvum in a veterinarian. Parasit Vectors 6: 103. doi: 10.1186/1756-3305-6-103 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Mahlobo-Shwabede SIC, Zishiri OT, Thekisoe OMM, Bakkes D, Bohloa L, Molomo M, Makalo MJR, Mahloane GR, Mtshali MS. 2022. Ticks of domestic animals in Lesotho: Morphological and molecular characterization. Vet Parasitol Reg Stud Rep 29: 100691. [DOI] [PubMed] [Google Scholar]
- 41.Mangold AJ, Bargues MD, Mas-Coma S. 1998. Mitochondrial 16S rDNA sequences and phylogenetic relationships of species of Rhipicephalus and other tick genera among Metastriata (Acari: Ixodidae). Parasitol Res 84: 478–484. doi: 10.1007/s004360050433 [DOI] [PubMed] [Google Scholar]
- 42.Martínez-García G, Santamaría-Espinosa RM, Lira-Amaya JJ, Figueroa JV. 2021. Challenges in Tick-Borne Pathogen Detection: The Case for Babesia spp. Identification in the Tick Vector. Pathogens 10: 2. doi: 10.3390/pathogens10020092 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Matjila PT, Leisewitz AL, Jongejan F, Penzhorn BL. 2008. Molecular detection of tick-borne protozoal and ehrlichial infections in domestic dogs in South Africa. Vet Parasitol 155: 152–157. doi: 10.1016/j.vetpar.2008.04.012 [DOI] [PubMed] [Google Scholar]
- 44.Matjila PT, Penzhorn BL, Bekker CPJ, Nijhof AM, Jongejan F. 2004. Confirmation of occurrence of Babesia canis vogeli in domestic dogs in South Africa. Vet Parasitol 122: 119–125. doi: 10.1016/j.vetpar.2004.03.019 [DOI] [PubMed] [Google Scholar]
- 45.McLain DK, Wesson DM, Oliver JH, Jr, Collins FH. 1995. Variation in ribosomal DNA internal transcribed spacers 1 among eastern populations of Ixodes scapularis (Acari: Ixodidae). J Med Entomol 32: 353–360. doi: 10.1093/jmedent/32.3.353 [DOI] [PubMed] [Google Scholar]
- 46.Meltzer MI, Norval RA, Donachie PL. 1995. Effects of tick infestation and tick-borne disease infections (heartwater, anaplasmosis and babesiosis) on the lactation and weight gain of Mashona cattle in south-eastern Zimbabwe. Trop Anim Health Prod 27: 129–144. doi: 10.1007/BF02248956 [DOI] [PubMed] [Google Scholar]
- 47.Michelet L, Delannoy S, Devillers E, Umhang G, Aspan A, Juremalm M, Chirico J, van der Wal FJ, Sprong H, Boye Pihl TP, Klitgaard K, Bødker R, Fach P, Moutailler S. 2014. High-throughput screening of tick-borne pathogens in Europe. Front Cell Infect Microbiol 4: 103. doi: 10.3389/fcimb.2014.00103 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.MoAIWD DAHLD.2022. Third round agricultural production estimates (APES) 2021/2022 fiscal year. Ministry of agriculture irrigation and water development (MoAIWD), department of animal health and livestock development (DAHLD). Lilongwe, Malawi. [Google Scholar]
- 49.Mtshali K, Khumalo Z, Nakao R, Grab DJ, Sugimoto C, Thekisoe O. 2016. Molecular detection of zoonotic tick-borne pathogens from ticks collected from ruminants in four South African provinces. J Vet Med Sci 77: 1573–1579. doi: 10.1292/jvms.15-0170 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Murrell A, Campbell NJ, Barker SC. 1999. Mitochondrial 12S rDNA indicates that the Rhipicephalinae (Acari: Ixodida) is paraphyletic. Mol Phylogenet Evol 12: 83–86. doi: 10.1006/mpev.1998.0595 [DOI] [PubMed] [Google Scholar]
- 51.Nalubamba KS, Hankanga C, Mudenda NB, Masuku M. 2011. The epidemiology of canine Babesia infections in Zambia. Prev Vet Med 99: 240–244. doi: 10.1016/j.prevetmed.2010.12.006 [DOI] [PubMed] [Google Scholar]
- 52.Nalubamba KS, Mudenda NB, Namwila MM, Mulenga CS, Bwalya EC, M’kandawire E, Saasa N, Hankanga C, Oparaocha E, Simuunza M. 2015. A study of naturally acquired canine babesiosis caused by single and mixed Babesia species in Zambia: Clinicopathological findings and case management. J Parasitol Res 2015: 985015. doi: 10.1155/2015/985015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Nyangiwe N, Harrison A, Horak IG. 2013. Displacement of Rhipicephalus decoloratus by Rhipicephalus microplus (Acari: Ixodidae) in the Eastern Cape Province, South Africa. Exp Appl Acarol 61: 371–382. doi: 10.1007/s10493-013-9705-7 [DOI] [PubMed] [Google Scholar]
- 54.Omondi D, Masiga DK, Fielding BC, Kariuki E, Ajamma YU, Mwamuye MM, Ouso DO, Villinger J. 2017. Molecular detection of tick-borne pathogen diversities in ticks from livestock and reptiles along the shores and adjacent Islands of Lake Victoria and Lake Baringo, Kenya. Front Vet Sci 4: 73. doi: 10.3389/fvets.2017.00073 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Oyamada M, Davoust B, Boni M, Dereure J, Bucheton B, Hammad A, Itamoto K, Okuda M, Inokuma H. 2005. Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clin Diagn Lab Immunol 12: 1343–1346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Papa A, Tsioka K, Kontana A, Papadopoulos C, Giadinis N. 2017. Bacterial pathogens and endosymbionts in ticks. Ticks Tick Borne Dis 8: 31–35. doi: 10.1016/j.ttbdis.2016.09.011 [DOI] [PubMed] [Google Scholar]
- 57.Parola P, Raoult D. 2001. Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clin Infect Dis 32: 897–928. doi: 10.1086/319347 [DOI] [PubMed] [Google Scholar]
- 58.Pegram RG, Keirans JE, Clifford CM, Walker JB. 1987. Clarification of the Rhipicephalus sanguineus group (Acari, Ixodoidea, Ixodidae). I. R. sulcatus Neumann, 1908 and R. turanicus Pomerantsev, 1936. Syst Parasitol 10: 3–26. doi: 10.1007/BF00009099 [DOI] [Google Scholar]
- 59.Perez M, Bodor M, Zhang C, Xiong Q, Rikihisa Y. 2006. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann N Y Acad Sci 1078: 110-117. [DOI] [PubMed] [Google Scholar]
- 60.Pretorius AM, Kelly PJ. 1998. Serological survey for antibodies reactive with Ehrlichia canis and E. chaffeensis in dogs from the Bloemfontein area, South Africa. J S Afr Vet Assoc 69: 126–128. doi: 10.4102/jsava.v69i4.840 [DOI] [PubMed] [Google Scholar]
- 61.Qiu Y, Kaneko C, Kajihara M, Ngonda S, Simulundu E, Muleya W, Thu MJ, Hang’ombe MB, Katakura K, Takada A, Sawa H, Simuunza M, Nakao R. 2018. Tick-borne haemoparasites and Anaplasmataceae in domestic dogs in Zambia. Ticks Tick Borne Dis 9: 988–995. doi: 10.1016/j.ttbdis.2018.03.025 [DOI] [PubMed] [Google Scholar]
- 62.Shaw SE, Day MJ, Birtles RJ, Breitschwerdt EB. 2001. Tick-borne infectious diseases of dogs. Trends Parasitol 17: 74–80. doi: 10.1016/S1471-4922(00)01856-0 [DOI] [PubMed] [Google Scholar]
- 63.Tamura K, Stecher G, Kumar S. 2021. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38: 3022–3027. doi: 10.1093/molbev/msab120 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Vlahakis PA, Chitanga S, Simuunza MC, Simulundu E, Qiu Y, Changula K, Chambaro HM, Kajihara M, Nakao R, Takada A, Mweene AS. 2018. Molecular detection and characterization of zoonotic Anaplasma species in domestic dogs in Lusaka, Zambia. Ticks Tick Borne Dis 9: 39–43. doi: 10.1016/j.ttbdis.2017.10.010 [DOI] [PubMed] [Google Scholar]
- 65.Walker A, Estrada-Pena A, Bouattour A, Horak IG. 2003. Ticks of domestic animals in Africa: a guide to identification of species. Bioscience Reports, Edinburgh. [Google Scholar]
- 66.Walker JB. 1991. A review of the ixodid ticks (Acari, Ixodidae) occurring in southern Africa. Onderstepoort J Vet Res 58: 81–105. [PubMed] [Google Scholar]
- 67.Wyk CV, Mtshali K, Taioe MO, Terera S, Bakkes D, Ramatla T, Xuan X, Thekisoe O. 2022. Detection of ticks and tick-borne pathogens of urban stray dogs in South Africa. Pathogens 11: 862. doi: 10.3390/pathogens11080862 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.