Abstract
Epigenetics is an emerging field of research because of its involvement in susceptibility to diseases and aging. Hypoxia and hyperoxia are known to be involved widely in various pathophysiologies. Here, we compared the differential epigene expression pattern between Pleurodeles waltl and Mus musculus (commonly known as Iberian ribbed newt and mouse, respectively) exposed to hypoxia and hyperoxia. Adult healthy newts and mice were exposed to normobaric hypoxia (8% O2) and hyperoxia (80% O2) for 2 hours. We collected the lungs and analyzed the expression of hypoxia-inducible factor 1 alpha (Hif1α) and several key epigenes from DNA methyltransferase (DNMT) family, histone deacetylase (HDAC) family, and methyl-CpG binding domain (MBD) family. The exposure to hypoxia significantly increased the mRNA levels of DNA methyltransferase 3 alpha (Dnmt3α), methyl-CpG binding domain protein 2 (Mbd2), Mbd3, and histone deacetylase 2 (Hdac2) in lungs of newts, but decreased the mRNA levels of DNA methyltransferase 1 (Dnmt1) and Dnmt3α in lungs of mice. The exposure to hyperoxia did not significantly change the expression of any gene in either newts or mice. The differential epigene expression pattern in response to hypoxia between newts and mice may provide novel insights into the prevention and treatment of disorders developed due to hypoxia exposure.
Introduction
Epigenetics represents the machinery that regulates transcription of genes and is the result of addition or deletion of epigenetic modifications [1]. The most basic epigenetic modifications are methylation to DNA and core histone proteins. Beside methylation (addition of methyl groups to the arginine or lysine residues), the histone proteins are also vulnerable to different modifications including acetylation (incorporation of an acetyl group to lysine molecules residing in the protruding tails), phosphorylation (addition of phosphate group to serine, threonine, and tyrosine amino acid usually in the N-terminal tails), SUMOylation (covalently linking a small ubiquitin-like modifier SUMO to a specific lysine amino acid), and ubiquitination (transportation of ubiquitin protein to the core histone). The aforementioned modifications regulate chromatin accessibility to transcription factors and enzymes that are responsible for transcription initiation [1]. Epigenetics is known to play key roles in the development of organisms and diseases [2]. Environmental cues including temperature, oxygen level, chemical pollutants, etc. have impact on epigenetics and disease susceptibility [3–5].
Hypoxia, the supply of lower amount of oxygen compared to required level, is detrimental for most of the vertebrates, as it dramatically impairs cellular metabolic demand. Almost all animals have the chance of being exposed to environmental hypoxia as it is a widely existing environmental condition. On the other hand, hyperoxia is the supply of elevated level of oxygen compared to the normal level. Supply of excess oxygen is common for patients undergoing surgery after general anesthesia and those who are suffering from acute or life-threatening illness. Both of the hypoxia and hyperoxia induce severe oxidative stress in the lung [6–8]. Hypoxia induces pulmonary hypertension, interstitial pulmonary fibrosis, acute respiratory distress syndrome, and chronic obstructive pulmonary disease [7,9]. Elevated oxygen supply to preterm infant induces bronchopulmonary dysplasia (BPD) [10]. Hyperoxia-induced BPD has been reported due to acetylation of histone H3 lysine 27 (H3K27) and the subsequent transcription activation of Cdkn1α [11]. Effective and rapid therapeutic intervention is an urgent need to get rid of the pathophysiological complication induced by hypoxia and hyperoxia. As epigenetic modifications are reversible, targeting epigenetic landmarks involved in a disease process may offer novel approach to planning effective and rapid therapies. For example, intermittent hypoxia-induced hypermethylation of CpG near the transcription start site of superoxide dismutase 2 (Sod2) gene suppresses its expression in mice and mitigation of this transcription inhibition by treating with DNA methyltransferase (DNMT) inhibitor decitabine has been reported [12]. Therefore, studying the epigenetics of hypoxia and hyperoxia tolerant animals may offer clues to develop preventive measures or treatment options to get rid of hypoxia- and hyperoxia-induced pathological conditions in human.
Compared to mammals, the ectothermic vertebrates (e.g. amphibians, fishes, and reptiles) are more tolerant to hypoxia and hyperoxia [13–15]. Some fishes (Astronotus ocellatus, Carassius carassius and Hemiscyllium ocellatum) and turtles (Chrysemys picta and Trachemys scripta elegans) can survive for several hours to days without any amount of oxygen [15–18]. For instance, adult A. ocellatus can survive approximately 6 hours without oxygen [16], while Chrysemys turtle can tolerate anoxia for more than 60 hours [17].
Pleurodeles waltl, member of Salamandridae family, is an ectothermic animal with excellent organ regeneration capacity. P. waltl is generally called as newt. The regeneration capacity of newts is age independent [19]. Another interesting property of newts is resistance to carcinogenesis [20,21]. As they are semiaquatic animals, their life cycle follows three developmental stages, such as larvae (aquatic) stage, juvenile (terrestrial) stage, and adult (semiaquatic) stage [22]. Similar to having different developmental phases and habitats, they have different ways of breathing. At larvae stage, they use their feathery gills to breathe under water. Following metamorphosis, the larvae turn into juvenile stage and develop legs and lungs for surviving on land. This respiratory transition process is unique to amphibians [23]. They live on land from months to years to become adult from juvenile phase. After being adult, they can live both on land and in water, representing them as semiaquatic. Except the lungless newts, the adult one uses lungs for breathing on surface and commonly they follow cutaneous respiration in water.
In a previous article by our group, increased acetylation to histone H3 lysine 9 (H3K9), H3K14, and H3K27 has been reported in the regenerating tail tissue of P. waltl [24]. It has been reported that semiaquatic freshwater turtle T. scripta elegans develops tolerance to oxygen starvation by harboring DNA hypermethylation and subsequent global transcription inhibition [18]. Thus, we hypothesized that the epigenetics in salamander is different than in mammal and we designed this study to compare the differential epigene expression pattern in lungs of newts and mice in response to hypoxia and hyperoxia exposures.
Materials and methods
Animal care
Iberian ribbed newts (P. waltl) and C57BL/6 mice (CLEA, Japan) were used in this study. Newts were obtained from the Tottori University [25] and the Hiroshima University Amphibian Research Center through a National BioResource Project (NBRP) of the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan. Nine male adult newts (4 to 5 years old) and nine male adult mice (12 to 14 weeks old) were used for this experiment. Newts were kept in a temperature controlled room (25 ± 1.5°C) with 12:12-h light–dark cycle. They were housed in polypropylene cage filled with tap-water and equipped with continuous air supply into the water. Water was changed three times in a week after feeding them catfish pellet food (Kyorin Food Industry Co., Ltd., Japan). Mice were housed in a pathogen-free and temperature controlled room with 12:12-h light–dark cycle. Mice were accessed to food and water ad libitum. Approval of this study was taken from Institutional Animal Care and Use Committee, Nagasaki University (memo no. 2017–1). All animal procedures were executed according to the institutional and national guidelines.
Exposing animals to hypoxia and hyperoxia
Newts and mice were exposed to modified oxygen in air. The incubators were maintained at 25 ± 0.5°C temperature with 5% CO2 supply. Animals were exposed to 20% O2 (normoxia), 8% O2 (hypoxia), and 80% O2 (hyperoxia) for 2 hours. Exposing animals to modified oxygen was performed individually following three replications. Then, they were sacrificed following cervical dislocation and their lungs were collected and stored immediately at -80°C.
Reverse transcription-quantitative polymerase chain reaction
RNA was isolated from lung tissue using Direct-zol™ RNA MiniPrep Kits (Zymo Research, USA) following steps described in manufacturer’s protocol. Quality and quantity of RNA was evaluated using a NanoDrop™ 2000/2000c spectrophotometer (Thermo Scientific). The isolated RNA (2 μg) was reverse-transcribed using SuperScript™ VILO™ MasterMix (Invotrogen, USA) in 20 μL reaction mixture. Quantitative polymerase chain reaction (qPCR) was performed using THUNDERBIRD™ SYBR® qPCR Mix (TOYOBO, Japan) on a Bio-Rad CFX96 real-time PCR detection system (Bio-Rad, USA). Complementary DNA (cDNA) equivalent to 50 ng RNA (except 12.5 ng for Hif1α and corresponding Gapdh in case of mice) was used in each 20 μL PCR reaction. Efficiency of PCR was confirmed based on parallelism of the geometric slops on the amplification plot. The melt curve analysis was performed according to the set program on Bio-Rad CFX96 real-time PCR detection system (Bio-Rad, USA). Primers (Table 1) used in this study were synthesized by Hokkaido System Science Co., Ltd. (Japan). Of note, the primers for newt were designed based on the transcript database iNewt (http://www.nibb.ac.jp/imori/main/) developed by Matsunami et al. [26]. We used the basic local alignment search tool (BLAST) of that database using the corresponding transcript FASTA sequence of mouse against the transcript dataset “Trinity_Pwal_v2.fasta” to find out the target transcript. Thereafter, the best matched FASTA sequences were downloaded and used to design primers utilizing the National Center for Biotechnology Information (NCBI) primer designing tool. However, normalized fold change calculation was performed using endogenous glyceraldehyde 3-phosphate dehydrogenase (Gapdh) gene based on ΔΔCq method [27].
Table 1. List of primers.
| Genes | Primers | Sequences (5’-3’) | |
|---|---|---|---|
| Newt | Mouse | ||
| Hif1α | Forward | GGTGAAGACCGAGCCAAGAA | ACCTTCATCGGAAACTCCAAAG |
| Reverse | CGAACTGTCGCTGGTGTTTG | CTGTTAGGCTGGGAAAAGTTAGG | |
| Dnmt1 | Forward | TGCTTACTGCGACCACTACC | CCGTGGCTACGAGGAGAAC |
| Reverse | AGAGAACGCTACCAAACGCA | TTGGGTTTCCGTTTAGTGGGG | |
| Dnmt3α | Forward | AACCCTACGTTCACGCAAGT | GGCCGAATTGTGTCTTGGTG |
| Reverse | TTATTGGGGACTGGGCTAGG | CCATCTCCGAACCACATGAC | |
| Dnmt3β | Forward | GCTGGATTGGGCATTTGGAG | AGCGGGTATGAGGAGTGCAT |
| Reverse | GTCGTTTAGGGAGTGGGCAG | GGGAGCATCCTTCGTGTCTG | |
| Mbd1 | Forward | GCACTTCCTCAGGAGCCAAT | AAAGTTGAGCTGACTCGGTACT |
| Reverse | AGAGCCCTACTGGGGAGAAG | TCTTGGCTGGTTTAGAAGGCT | |
| Mbd2 | Forward | ATCTCGACAACTGGGGCTTG | AGAACAAGGGTAAACCAGACCT |
| Reverse | CGGCAAAAGCGATGTCTACT | ACTTCACCTTATTGCTCGGGT | |
| Mbd3 | Forward | TGGTATATGGCGAAGAATGTTGC | CCCCAGCGGGAAGAAGTTC |
| Reverse | AGCCGTGTGCACTTCATTCA | CGGAAGTCGAAGGTGCTGAG | |
| Mecp2 | Forward | ACCAATCGTCAGGGGAGAGA | ATGGTAGCTGGGATGTTAGGG |
| Reverse | AGTGTGCAGTTCCAAGGCTC | TGAGCTTTCTGATGTTTCTGCTT | |
| Hdac1 | Forward | TGGAACTTGGCCTGGATTAGG | TGAAGCCTCACCGAATCCG |
| Reverse | TGCAGTTCAAGTCGTCTGGT | GGGCGAATAGAACGCAGGA | |
| Hdac2 | Forward | ACTGACCAACCCAGTAACCCA | GCTTGCCATCCTCGAATTACT |
| Reverse | GGCCAGTTCCGCTCACTACA | GTCATCACGCGATCTGTTGTAT | |
| Gapdh | Forward | CGGAATCAACGGATTTGG | TGGCCTTCCGTGTTCCTAC |
| Reverse | GCGTCCATGGGTAGAGTCAT | GAGTTGCTGTTGAAGTCGCA | |
| α-actin | Forward | TGGTCGTGACCTGACTGAT | - |
| Reverse | TCACGGACAATCTCACGTTC | - | |
| β-actin | Forward | AAGAAGGTTGGAAGAGCGCC | - |
| Reverse | TCTGGACTTCGAGCAGGAGA | - | |
| Taf6 | Forward | TTCACGAGCTGTCTGTGGAG | - |
| Reverse | CCTGGGAAGCATTTGGTAGA | - | |
| Ef1α | Forward | AACATCGTGGTCATCGGCCAT | - |
| Reverse | GGAGGTGCCAGTGATCATGTT | - | |
| mtRNA16s | Forward | CGTGCAGAAGCGGAGATAA | - |
| Reverse | TGTCGGGCTGTTGTAGGG | - | |
Statistical analysis
The results in this study are presented as the mean ± SD (standard deviation). The one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison test was performed on GraphPad Prism (version 8) software.
Results
Hypoxia does not affect expression of hypoxia-inducible factor 1 alpha (Hif1α) in newts and mice
Firstly, we checked expression of hypoxia-inducible factor 1 alpha (Hif1α) mRNA. Though the change of Hif1α mRNA expression was not significant compared to normoxia, we observed an increasing trend only in newts at hypoxia (Fig 1A). The level of Hif1α mRNA was not changed among groups in mice (Fig 1B).
Fig 1.
Effect of hypoxia and hyperoxia on expression of Hif1α gene in newts (A) and mice (B). Data are presented as mean ± SD. Experiments were done in triplicate.
Hypoxia up-regulates DNA methyltransferases (DNMTs) in newts, but conversely down-regulates in mice
According to our results, DNA methyltransferase 1 (Dnmt1) expression was not changed significantly at any condition of oxygen treatment in newts (Fig 2A). On the other hand, expression of Dnmt1 was decreased significantly (p<0.05) in mice at hypoxia, but not changed at hyperoxia (Fig 2D). At hypoxic condition, expression of DNA methyltransferase 3 alpha (Dnmt3α) was increased significantly (p<0.01) in newts (Fig 2B), but decreased significantly (p<0.01) in mice (Fig 2E). Dnmt3α expression was not affected in any species due to hyperoxia exposure (Fig 2B and 2E). No significant change was observed in Dnmt3β expression in any animal exposed to hypoxia or hyperoxia (Fig 2C and 2F).
Fig 2.
Effect of hypoxia and hyperoxia on genes that encode DNA methyltransferases (DNMTs) in newts (A, B, and C) and mice (D, E, and F). A and D = DNA methyltransferase 1 (Dnmt1), B and E = DNA methyltransferase 3 alpha (Dnmt3α), C and F = DNA methyltransferase 3 beta (Dnmt3β). Data are presented as mean ± SD. Experiments were done in triplicate. *p<0.05, **p<0.01.
Hypoxia up-regulates methyl-CpG binding domains (MBDs) in newts, but not in mice
No significant change was observed in methyl-CpG binding domain 1 (Mbd1) expression both in newts and mice exposed to hypoxia or hyperoxia (Fig 3A and 3E). Expression of methyl-CpG binding domain protein 2 (Mbd2) was increased significantly (p<0.01) by 1.60±0.17 fold in newts exposed to hypoxia (Fig 3B). However, hyperoxia did not affect expression of Mbd2 in newts (Fig 3B). On the other hand, Mbd2 expression was not changed in mice exposed to hypoxia and hyperoxia (Fig 3F). Methyl-CpG binding domain protein 3 (Mbd3) mRNA expression was also elevated by 1.69±0.35 fold in newts only at hypoxia (p<0.05 vs. normoxia, Fig 3C), but was not changed in mice (Fig 3G). The expression of methyl-CpG binding protein 2 (Mecp2) mRNA was not changed in both newts and mice exposed to hypoxia or hyperoxia (Fig 3D and 3H).
Fig 3.
Effect of hypoxia and hyperoxia on genes that encode methylated CpG binding domain proteins (MBDs) in newts (A, B, C, and D) and mice (E, F, G, and H). A and E = methyl-CpG binding domain protein 1 (Mbd1), B and F = methyl-CpG binding domain protein 2 (Mbd2), C and G = methyl-CpG binding domain protein 3 (Mbd3), D and H = methyl-CpG binding protein 2 (Mecp2). Data are presented as mean ± SD. Experiments were done in triplicate. *p<0.05, **p<0.01.
Hypoxia up-regulates histone deacetylases (HDACs) in newts, but not in mice
We did not find change in expression of histone deacetylase 1 (Hdac1) in either newts or mice exposed to hypoxia and hyperoxia (Fig 4A and 4C). However, histone deacetylase 2 (Hdac2) mRNA level was increased significantly (p<0.01) only in newts at hypoxia (Fig 4B and 4D).
Fig 4.

Effect of hypoxia and hyperoxia on genes that encode histone deacetylases (HDACs) in newts (A and B) and mice (C and D). A and C = histone deacetylase 1 (Hdac1), B and D = histone deacetylase 2 (Hdac2). Data are presented as mean ± SD. Experiments were done in triplicate. **p<0.01.
Hypoxia causes transcription inhibition in newts
Our prior results regarding normalized fold change of genes including Dnmt3α, Mbd2, Mbd3, and Hdac2 elevation suggest increased de novo methylation and subsequent transcription inhibition in newt lungs. Thus, we recalculated our data for evaluating relative (to control) expression of genes and found that all transcripts in newts were decreased dramatically but the extent of suppression is different (Fig 5A). In contrast, the relative gene expression in mice (Fig 5B) showed trends similar to normalized fold change.
Fig 5.
Relative (to control) mRNA level in lungs of newts (A) and mice (B) after hypoxia exposure. Data are presented as mean ± SD. Experiments were done in triplicate.
Discussion
Although we conducted a comparative study between newts and mice after exposing them to hypoxia and hyperoxia, we found differences in epigene expression patterns only under hypoxic condition. Hypoxia is detrimental to most animals and stimulates a complex tissue-specific microenvironment for oxygen homeostasis. Oxygen homeostasis under hypoxic condition is regulated by hypoxia-inducible factor 1 (HIF1) proteins [28]. There are two HIF1 subunits: HIF1α and HIF1β. Under normoxic and hyperoxic conditions, HIF1 proteins are degraded by prolyl hydroxylases (PHDs) [29]. Hypoxia protects HIF1 from degradation by PHDs. Thus, HIF1 proteins become stabilized and start its function as a transcription factor. This protein induces transcription of more than 60 genes which are involved in numerous pathways including but not limited to amino acid metabolism, angiogenesis, apoptosis, cell proliferation, cell survival, cytoskeletal structure remodeling, drug resistance, epithelial homeostasis, erythropoiesis, extracellular matrix metabolism, glucose metabolism, maintenance of vascular tone, motility of cells, nucleotide metabolism, and pH regulation [30]. Hypoxia not only stabilizes HIF1 protein but also induces expression of mRNA [31–33], which is later translated into protein to compensate for degraded protein for oxygen homeostasis. Here, we found an insignificant but slight elevation in mRNA level of Hif1α in newts exposed to hypoxia, but no change was observed in mice. Wiener et al. [31] showed that Hif1α mRNA synthesis was maximized in mouse at 1 hour and returned to basal level at 4 hours of exposure to 7% O2. In this study, we exposed mice to 8% O2 for 2 hours and did not find an elevation of Hif1α mRNA. We speculate that the mRNA level returned to basal state within 2 hours. This reversion of Hif1α mRNA to the basal level might be due to the stabilization of enough HIF1α proteins.
Generally, HIF1α, as a transcription factor, begins its role upon binding to the hypoxia response elements (HREs) on DNA. The core HRE sequence on DNA is CGTG, where methylation of cytosine occurs and initiates subsequent epigenetic regulation in response to hypoxia [34]. Upon binding to the HREs, HIF1α recruits histone acetyltransferases and promotes transcription of target genes [34]. Additionally, HIF1α proteins promote the upregulation of histone demethylase enzymes and cooperatively control gene expression [34].
However, the elevated expression of DNA methyltransferase 3 alpha (Dnmt3α) suggests increased de novo methylation at CpG sites on DNA in newts exposed to hypoxia [18,35]. Elevated DNA methylation is an indication of tolerance to oxygen starvation [18]. Methylated CpG sites at the promoter region directly hinder transcription factors from bind to the promoter region and impair transcription [18]. The methylated CpG sites attract nucleosome remodeling and histone deacetylation (NuRD) complex molecules, inducing subsequent transcription inhibition [18,36,37]. Interestingly, we found enhanced expression of NuRD complex protein-coding genes, including methyl-CpG binding domain protein 2 (Mbd2), Mbd3, and histone deacetylase 2 (Hdac2), in the lungs of newts exposed to hypoxia. MBD2 and MBD3 inhibit transcription indirectly by binding to methylated CpG sites at the promoter regions [18], while HDAC2 participates in removing acetyl groups from histones to form heterochromatin and negatively regulates transcription of certain genes [37]. Strikingly, enhanced Hdac2 expression supports hypoxia tolerance [38] since it attenuates inflammation [39,40].
On the other hand, we found a reduction in Dnmt1 and Dnmt3α mRNA in mice exposed to hypoxia. Reduced DNMTs expression resembles reduced methylation on DNA [41]. According to growing evidence, hypoxia decreases Dnmt1 expression in mammals [41,42]. Loss of Dnmt1 indicates a loss of control in maintaining the pre-existing physiological methylation pattern, leading to cell death at mitosis stage and genome instability [18,43]. It has been reported that deletion of Dnmt3α is lethal [44]. Collectively, the decreased expression of Dnmt1 and Dnmt3α due to hypoxia is detrimental for mice [18,35,43,44].
Of note, using Gapdh as an internal control might be questionable as Gapdh itself is known as a target of HIF1α. Previous studies have shown that Gapdh expression in alveolar epithelial cells remains stable even after three hours at 0% O2 [45,46]. It has also been reported that Gapdh is not involved in hypoxia habituation in lung fibroblasts or smooth muscle cells [46]. In this study, hypoxia (8% O2) treatment for two hours did not affect Gapdh expression in mice lung (S1 Table), which is consistent with prior reports [45,46]. However, we observed unstable Gapdh expression (larger Cq values) in newts after exposure to hypoxia (S1 Table), which seems unusual compared to observations in mammals. The Cq values for the target epigenes were also unstable but parallel to the Cq values of Gapdh. Thus, we used Gapdh as an internal control because the data normalized by Gapdh showed the smallest individual variation. We also checked several other housekeeping genes, such as α-actin, β-actin, elongation factor 1 alpha (Ef1α), mitochondrial RNA 16S (mtRNA16s), and TATA-box binding protein associated factor 6 (Taf6), which are well-used as internal controls; however, all of them resulted in expression trends similar to Gapdh. Additionally, the Cq values for the later-mentioned housekeeping genes were also unstable but had parallelism to Cq value of Gapdh of the corresponding sample (S1 Table) and yielded higher individual variation among the data points.
To our surprise, the consecutive enhanced expression of Dnmt3α, Mbd2, Mbd3, and Hdac2 suggests global transcription inhibition in lungs of newts [18]. Wijenayake and Storey [18] reported DNA hypermethylation and subsequent transcription inhibition in a tissue-specific manner in the semiaquatic turtle T. scripta elegans after exposure to anoxia. Due to anoxia exposure, enhanced DNMT1, DNMT2, MBD1, and MBD2 in liver and DNMT3α, DNMT3β, and MBD1 in white muscle of T. scripta elegans were observed [18]. Recently, global hypermethylation and subsequent transcription inhibition in brain and heart of goldfish due to chronic hypoxia exposure have also been reported [47]. Therefore, to prove the hypothesis of global transcription inhibition in lungs of our newt model, we performed relative (to control) gene expression analysis and found a dramatic decrease in all transcripts in newts. Transcription is one of the energetically expensive processes and requires a certain amount adenosine triphosphate (ATP). Inhibited mtRNA16s indicates suppression of oxidative phosphorylation (OXPHOS) [48]. As a consequence, a metabolic switch from OXPHOS to glycolysis is expected for energy homeostasis. Interestingly, we found a dramatic decrease in Gapdh mRNA, a glycolytic gene, instead of its elevation. Therefore, the decreased expression of mtRNA16s and Gapdh suggests metabolic suppression in newts. Additionally, the suppressed expression of a transcription factor Taf6 is an indication of transcription inhibition. Such transcriptional inhibition in newt lungs indicates metabolic suppression, suggesting an adaptive mechanism for efficient hypoxia survival [13,18,47].
The limitation of this study lies in the fact that we did not optimize the ideal hypoxic condition for P. waltl by subjecting them to varying oxygen level, as mice from the same cohort used in this experiment died when exposed to less than 8% oxygen (data not shown). Strikingly, Sheafore et al. [49] studied the effects of hypoxia on Desmognathus fuscus, a lungless salamander species. They observed increased buccal activity in D. fuscus exposed to oxygen levels ranging from 5 to 8%, while there was no change in groups exposed to 10% or even 2% oxygen supply [49]. Though heart rate significantly increased at 10, 8, 6.5, and 5% oxygen exposure conditions, 2% oxygen exposure did not affect heart rate [49]. In addition to the heart rate, the apnea period was not impaired at 2% oxygen exposure, while apnea period was shortened in all other conditions (10, 8, 6.5, and 5% oxygen) [49]. Based on the findings by Sheafor et al. [49], optimizing an ideal hypoxia condition for newt might be challenging. Therefore, we chose to create a hypoxic environment at 8% oxygen based on findings by Sheafor et al. [49] and considering the hypoxia tolerance threshold (8% oxygen) observed in the mice from the same cohort.
In conclusion, we found opposite epigene expression patterns in lungs of newts and mice after hypoxia exposure. In the case of newts, the transcription inhibition or metabolic suppression in response to hypoxia might be another excellence of salamanders in addition to regeneration [24,50] and resistance to long-term starvation stress [51], senescence [52], and carcinogens [20,21] which are not well developed in adult mice. To make this differential epigene expression pattern clinically translational, further study to elucidate the specific mechanism of action involved in hypoxia tolerance of P. waltl is a prerequisite.
Supporting information
(XLSX)
Acknowledgments
We express our sincere gratitude to the Mombukagakusho: MEXT Scholarship Program for supporting study of the first author Md. Mahmudul Hasan in the Nagasaki University Graduate School of Biomedical Sciences. We are grateful to the Hiroshima University Amphibian Research Center for providing P. waltl through a National BioResource Project (NBRP) of the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan.
Data Availability
All relevant data are within the manuscript and its Supporting Informationk files.
Funding Statement
The Ministry of Education, Science, Sports, Culture and Technology, Japan (Grant number: 21K19533) and the Program of the Network-type Joint Usage/Research Center for Radiation Disaster Medical Science of Hiroshima University, Nagasaki University, and Fukushima Medical University were the funding source for this research work. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Handy DE, Castro R, Loscalzo J. Epigenetic modifications: basic mechanisms and role in cardiovascular disease. Circulation. 2011;123(19):2145–56. doi: 10.1161/CIRCULATIONAHA.110.956839 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Portela A, Esteller M. Epigenetic modifications and human disease. Nat Biotechnol. 2010;28(10):1057–68. doi: 10.1038/nbt.1685 [DOI] [PubMed] [Google Scholar]
- 3.Feil R, Fraga MF. Epigenetics and the environment: emerging patterns and implications. Nat Rev Genet. 2012;13(2):97–109. doi: 10.1038/nrg3142 [DOI] [PubMed] [Google Scholar]
- 4.Nakamura N, Shi X, Darabi R, Li Y. Hypoxia in Cell Reprogramming and the Epigenetic Regulations. Front Cell Dev Biol. 2021;9:609984. doi: 10.3389/fcell.2021.609984 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Jirtle RL, Skinner MK. Environmental epigenomics and disease susceptibility. Nat Rev Genet. 2007;8(4):253–62. doi: 10.1038/nrg2045 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Singer M, Young PJ, Laffey JG, Asfar P, Taccone FS, Skrifvars MB, et al. Dangers of hyperoxia. Crit Care. 2021;25(1):440. doi: 10.1186/s13054-021-03815-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Siques P, Brito J, Pena E. Reactive Oxygen Species and Pulmonary Vasculature During Hypobaric Hypoxia. Front Physiol. 2018;9:865. doi: 10.3389/fphys.2018.00865 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Carvalho CR, de Paula Pinto Schettino G, Maranhão B, Bethlem EP. Hyperoxia and lung disease. Curr Opin Pulm Med. 1998;4(5):300–4. doi: 10.1097/00063198-199809000-00010 [DOI] [PubMed] [Google Scholar]
- 9.Voelkel NF, Mizuno S, Bogaard HJ. The role of hypoxia in pulmonary vascular diseases: a perspective. Am J Physiol Lung Cell Mol Physiol. 2013;304(7):L457–65. doi: 10.1152/ajplung.00335.2012 [DOI] [PubMed] [Google Scholar]
- 10.Giusto K, Wanczyk H, Jensen T, Finck C. Hyperoxia-induced bronchopulmonary dysplasia: better models for better therapies. Dis Model Mech. 2021;14(2):dmm047753. doi: 10.1242/dmm.047753 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Coarfa C, Grimm SL, Katz T, Zhang Y, Jangid RK, Walker CL, et al. Epigenetic response to hyperoxia in the neonatal lung is sexually dimorphic. Redox Biol. 2020;37:101718. doi: 10.1016/j.redox.2020.101718 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Nanduri J, Makarenko V, Reddy VD, Yuan G, Pawar A, Wang N, et al. Epigenetic regulation of hypoxic sensing disrupts cardiorespiratory homeostasis. Proc Natl Acad Sci U.S.A. 2012;109(7):2515–2520. doi: 10.1073/pnas.1120600109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bickler PE, Buck LT. Hypoxia tolerance in reptiles, amphibians, and fishes: life with variable oxygen availability. Annu Rev Physiol. 2007;69:145–70. doi: 10.1146/annurev.physiol.69.031905.162529 [DOI] [PubMed] [Google Scholar]
- 14.Nilsson GE, Renshaw GM. Hypoxic survival strategies in two fishes: extreme anoxia tolerance in the North European crucian carp and natural hypoxic preconditioning in a coral-reef shark. J Exp Biol. 2004;207(Pt 18):3131–9. doi: 10.1242/jeb.00979 [DOI] [PubMed] [Google Scholar]
- 15.Barja de Quiroga G, Lopez-Torres M, Gil P. Hyperoxia decreases lung size of amphibian tadpoles without changing GSH-peroxidases or tissue peroxidation. Comp Biochem Physiol A Comp Physiol. 1989;92(4):581–8. doi: 10.1016/0300-9629(89)90369-1 [DOI] [PubMed] [Google Scholar]
- 16.Almeida-Val VM, Val AL, Duncan WP, Souza FC, Paula-Silva MN, Land S. Scaling effects on hypoxia tolerance in the Amazon fish Astronotus ocellatus (Perciformes: Cichlidae): contribution of tissue enzyme levels. Comp Biochem Physiol B Biochem Mol Biol. 2000;125(2):219–26. doi: 10.1016/s0305-0491(99)00172-8 [DOI] [PubMed] [Google Scholar]
- 17.Nilsson GE, Lutz PL. Anoxia tolerant brains. J Cereb Blood Flow Metab. 2004;24(5):475–86. doi: 10.1097/00004647-200405000-00001 [DOI] [PubMed] [Google Scholar]
- 18.Wijenayake S, Storey KB. The role of DNA methylation during anoxia tolerance in a freshwater turtle (Trachemys scripta elegans). J Comp Physiol B. 2016;186(3):333–42. doi: 10.1007/s00360-016-0960-x [DOI] [PubMed] [Google Scholar]
- 19.Tanaka HV, Ng NCY, Yang Yu Z, Casco-Robles MM, Maruo F, Tsonis PA, et al. A developmentally regulated switch from stem cells to dedifferentiation for limb muscle regeneration in newts. Nat Commun. 2016;7:11069. doi: 10.1038/ncomms11069 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Ingram AJ. The lethal and hepatocarcinogenic effects of dimethylnitrosamine injection in the newt Triturus helveticus. Br J Cancer. 1972;26(3):206–15. doi: 10.1038/bjc.1972.28 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Okamoto M. Simultaneous demonstration of lens regeneration from dorsal iris and tumour production from ventral iris in the same newt eye after carcinogen administration. Differentiation. 1997;61(5):285–92. doi: 10.1046/j.1432-0436.1997.6150285.x [DOI] [PubMed] [Google Scholar]
- 22.Fontaine SS, Mineo PM, Kohl KD. Changes in the gut microbial community of the eastern newt (Notophthalmus viridescens) across its three distinct life stages. FEMS Microbiol Ecol. 2021;97(3):fiab021. doi: 10.1093/femsec/fiab021 [DOI] [PubMed] [Google Scholar]
- 23.Burggren W. Transition of respiratory processes during amphibian metamorphosis: from egg to adult. In: Seymour RS, editor. Respiration and metabolism of embryonic vertebrates. Dordrecht: Springer; 1984. pp. 31–53. [Google Scholar]
- 24.Wu JW, Zhang X, Sekiya R, Aoyagi K, Li TS. Immunohistochemical Analysis of Histone H3 Modification in Newt Tail Tissue Cells following Amputation. Stem Cells Int. 2021;2021:8828931. doi: 10.1155/2021/8828931 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hayashi T, Takeuchi T. Gene manipulation for regenerative studies using the Iberian ribbed newt, Pleurodeles waltl. In: Kumar A, Simon A, editors. Salamanders in Regeneration Research. Methods Mol Biol. New York: Humana Press; 2015. pp. 297–305. [DOI] [PubMed] [Google Scholar]
- 26.Matsunami M, Suzuki M, Haramoto Y, Fukui A, Inoue T, Yamaguchi K, et al. A comprehensive reference transcriptome resource for the Iberian ribbed newt Pleurodeles waltl, an emerging model for developmental and regeneration biology. DNA Res. 2019;26(3):217–229. doi: 10.1093/dnares/dsz003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT Method. Methods. 2001;25(4):402–8. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
- 28.Hong WX, Hu MS, Esquivel M, Liang GY, Rennert RC, McArdle A, et al. The Role of Hypoxia-Inducible Factor in Wound Healing. Adv Wound Care. 2014;3(5):390–399. doi: 10.1089/wound.2013.0520 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Huang LT, Chou HC, Chen CM. Roxadustat attenuates hyperoxia-induced lung injury by upregulating proangiogenic factors in newborn mice. Pediatr Neonatol. 2021;62(4):369–378. doi: 10.1016/j.pedneo.2021.03.012 [DOI] [PubMed] [Google Scholar]
- 30.Lee JW, Bae SH, Jeong JW, Kim SH, Kim KW. Hypoxia-inducible factor (HIF-1) alpha: its protein stability and biological functions. Exp Mol Med. 2004;36(1):1–12. doi: 10.1038/emm.2004.1 [DOI] [PubMed] [Google Scholar]
- 31.Wiener CM, Booth G, Semenza GL. In vivo expression of mRNAs encoding hypoxia-inducible factor 1. Biochem Biophys Res Commun. 1996;225(2):485–8. doi: 10.1006/bbrc.1996.1199 [DOI] [PubMed] [Google Scholar]
- 32.Ladoux A, Frelin C. Cardiac expressions of HIF-1 alpha and HLF/EPAS, two basic loop helix/PAS domain transcription factors involved in adaptative responses to hypoxic stresses. Biochem Biophys Res Commun. 1997;240(3):552–6. doi: 10.1006/bbrc.1997.7708 [DOI] [PubMed] [Google Scholar]
- 33.Wenger RH, Kvietikova I, Rolfs A, Gassmann M, Marti HH. Hypoxia-inducible factor-1 alpha is regulated at the post-mRNA level. Kidney Int. 1997;51(2):560–3. doi: 10.1038/ki.1997.79 [DOI] [PubMed] [Google Scholar]
- 34.Brown CJ, Rupert JL. Hypoxia and environmental epigenetics. High Alt Med Bio. 2014;15(3):323–330. doi: 10.1089/ham.2014.1016 [DOI] [PubMed] [Google Scholar]
- 35.Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell. 1999;99(3):247–57. doi: 10.1016/s0092-8674(00)81656-6 [DOI] [PubMed] [Google Scholar]
- 36.Du Q, Luu PL, Stirzaker C, Clark SJ. Methyl-CpG-binding domain proteins: readers of the epigenome. Epigenomics. 2015;7(6):1051–73. doi: 10.2217/epi.15.39 [DOI] [PubMed] [Google Scholar]
- 37.Delcuve GP, Khan DH, Davie JR. Roles of histone deacetylases in epigenetic regulation: emerging paradigms from studies with inhibitors. Clin Epigenetics. 2012;4(1):5. doi: 10.1186/1868-7083-4-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Krivoruchko A, Storey KB. Epigenetics in anoxia tolerance: a role for histone deacetylases. Mol Cell Biochem. 2010;342(1–2):151–61. doi: 10.1007/s11010-010-0479-5 [DOI] [PubMed] [Google Scholar]
- 39.Charron CE, Chou PC, Coutts DJC, Kumar V, To M, Akashi K, et al. Hypoxia-inducible factor 1 alpha induces corticosteroid-insensitive inflammation via reduction of histone deacetylase-2 transcription. J Biol Chem. 2009;284(52):36047–36054. doi: 10.1074/jbc.M109.025387 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Lai T, Wu M, Zhang C, Che L, Xu F, Wang Y, et al. HDAC2 attenuates airway inflammation by suppressing IL-17A production in HDM-challenged mice. Am J Physiol Lung Cell Mol Physiol. 2019;316(1):L269–L279. doi: 10.1152/ajplung.00143.2018 [DOI] [PubMed] [Google Scholar]
- 41.Skowronski K, Dubey S, Rodenhiser D, Coomber B. Ischemia dysregulates DNA methyltransferases and p16INK4a methylation in human colorectal cancer cells. Epigenetics. 2010;5(6):547–556. doi: 10.4161/epi.5.6.12400 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Hsiao KY, Wu MH, Chang N, Yang SH, Wu CW, Sun HS, et al. Coordination of AUF1 and miR-148a destabilizes DNA methyltransferase 1 mRNA under hypoxia in endometriosis. Mol Hum Reprod. 2015;21(12):894–904. doi: 10.1093/molehr/gav054 [DOI] [PubMed] [Google Scholar]
- 43.Goll MG, Bestor TG. Eukaryotic cytosine methyltransferases. Annu Rev Biochem. 2005; 74:481–514. doi: 10.1146/annurev.biochem.74.010904.153721 [DOI] [PubMed] [Google Scholar]
- 44.Liberti DC, Zepp JA, Bartoni CA, Liberti KH, Zhou S, Lu M, et al. Dnmt1 is required for proximal-distal patterning of the lung endoderm and for restraining alveolar type 2 cell fate. Dev Biol. 2019;454(2):108–117. doi: 10.1016/j.ydbio.2019.06.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Escoubet B, Planès C, Clerici C. Hypoxia increases glyceraldehyde-3-phosphate dehydrogenase transcription in rat alveolar epithelial cells. Biochem Biophys Res Commun. 1999;266(1):156–161. doi: 10.1006/bbrc.1999.1798 [DOI] [PubMed] [Google Scholar]
- 46.Graven KK, Zimmerman LH, Dickson EW, Weinhouse GL, Farber HW. Endothelial cell hypoxia associated proteins are cell and stress specific. J Cell Physiol. 1993;157(3):544–554. doi: 10.1002/jcp.1041570314 [DOI] [PubMed] [Google Scholar]
- 47.Farhat E, Talarico GGM, Grégoire M, Weber JM, Mennigen JA. Epigenetic and post-transcriptional repression support metabolic suppression in chronically hypoxic goldfish. Sci Rep. 2022;12(1):5576. doi: 10.1038/s41598-022-09374-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Arroyo JD, Jourdain AA, Calvo SE, Ballarano CA, Doench JG, Root DE, et al. A Genome-wide CRISPR Death Screen Identifies Genes Essential for Oxidative Phosphorylation. Cell Metab. 2016;24(6):875–885. doi: 10.1016/j.cmet.2016.08.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Sheafor EA, Wood SC, Tattersall GJ. The effect of graded hypoxia on the metabolic rate and buccal activity of a lungless salamander (Desmognathus fuscus). J Exp. Biol. 2000;203:3785–3793. doi: 10.1242/jeb.203.24.3785 [DOI] [PubMed] [Google Scholar]
- 50.Arenas Gomez CM, Echeverri K. Salamanders: The molecular basis of tissue regeneration and its relevance to human disease. Curr Top Dev Biol. 2021;145: 235–275. doi: 10.1016/bs.ctdb.2020.11.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Peng ZL, Yin BX, Ren RM, Liao YL, Cai H, Wang H. Altered metabolic state impedes limb regeneration in salamanders. Zool Res. 2021;42(6):772–782. doi: 10.24272/j.issn.2095-8137.2021.186 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Hasan MM, Sekiya R, Li T-S. Ex vivo expansion of primary cells from limb tissue of Pleurodeles waltl. Dev Growth Differ. 2023;65(5):255–265. doi: 10.1111/dgd.12866 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(XLSX)
Data Availability Statement
All relevant data are within the manuscript and its Supporting Informationk files.




