Dietary sodium acetate and sodium butyrate attenuate intestinal damage and improve lipid metabolism in juvenile largemouth bass (Micropterus salmoides) fed a high carbohydrate diet by reducing endoplasmic reticulum stress

Abstract

High-carbohydrate (HC) diets decrease the intestinal levels of sodium acetate (SA) and sodium butyrate (SB) and impair the gut health of largemouth bass; however, SA and SB have been shown to enhance immunity and improve intestinal health in farmed animals. Thus, the present study was to investigate the effects of dietary SA and SB on HC diet-induced intestinal injury and the potential mechanisms in juvenile largemouth bass. The experiment set five isonitrogenous and isolipidic diets, including a low-carbohydrate diet (9% starch) (LC), a high carbohydrate diet (18% starch) (HC), and the HC diet supplemented with 2 g/kg SA (HCSA), 2 g/kg SB (HCSB) or a combination of 1 g/kg SA and 1 g/kg SB (HCSASB). The feeding experiment was conducted for 8 weeks. A total of 525 juvenile largemouth bass with an initial body weight of 7.00 ± 0.20 g were used. The results showed that dietary SA and SB improved the weight gain rate and specific growth rate (P < 0.05) and ameliorated serum parameters (alkaline phosphatase, acid phosphatase, glutamate transaminase, and glutamic oxaloacetic transaminase) (P < 0.05). And, importantly, dietary SA and SB repaired the intestinal barrier by increasing the expression levels of zonula occludens-1, occludin, and claudin-7 (P < 0.05), reduced HC-induced intestinal damage, and alleviated intestinal inflammation and cell apoptosis by attenuating HC-induced intestinal endoplasmic reticulum stress (P < 0.05). Further results revealed that dietary SA and SB reduced HC-induced intestinal fat deposition by inhibiting adipogenesis and promoting lipolysis (P < 0.05). In summary, this study demonstrated that dietary SA and SB attenuated HC-induced intestinal damage and reduced excessive intestinal fat deposition in largemouth bass.

1. Introduction

As aquaculture is rapidly developing and fish meal prices are increasing, there is a growing interest in producing affordable aquafeeds (Wang et al., 2015). Including high-value nutrients such as carbohydrates and lipids in the feed is a possible strategy for enhancing the protein-sparing effect of aquafeed. Carbohydrates are much less expensive than lipids, and a moderate amount of carbohydrates may improve economic benefits and decrease water pollution (Ali and Jauncey, 2004; Sankian et al., 2017). However, a high-carbohydrate (HC) diet can lead to impaired gut health, especially in carnivorous fish (Ding et al., 2020; Pan et al., 2022; Shi et al., 2022a). In largemouth bass, previous research has suggested that HC can disrupt the gut microbial balance, decrease the concentrations of short-chain fatty acids (acetate and butyrate), and impair gut health (Zhou et al., 2021).

The gut is a vital digestive and immune organ that acts as a vital barrier to prevent toxins and pathogens from entering the body (Kumar et al., 2005). It is noteworthy that dietary factors are the primary cause of intestinal dysfunction (Bibbò et al., 2016; Díez-Sainz et al., 2021; Wan et al., 2019). Studies have reported that intake of 17% carbohydrate induced intestinal endoplasmic reticulum stress (ERS) in largemouth bass that in turn promoted inflammation and apoptosis (Zhao et al., 2021c). High carbohydrate diets also led to lipid deposition and oxidative stress in intestinal epithelial cells (Wu et al., 2022; Zhao et al., 2020a). Interestingly, short-chain fatty acids (acetate, propionate, and butyrate) produced by microorganisms in the gut through metabolizing undigested fiber or carbohydrates have been demonstrated to regulate human, mammalian, and fish microbiota and improve gut health (McCarville et al., 2020). For example, supplementing the diet with 1 g/kg of sodium acetate (SA) can improve the microbial community structure and regulate the intestinal lipid distribution to promote intestinal health (Xun et al., 2023). In addition, supplementing the diet with acetate-forming bacteria or 1.85 g/kg of SA alleviated HC-induced metabolic disorders and intestinal inflammation and thereby improved the growth of Nile tilapia (Li et al., 2020a; Xu et al., 2022c). Similarly, supplementation with 2 g/kg of sodium butyrate (SB) improved the growth and intestinal immune function of grass carp as well as the liver function of largemouth bass fed a high-fat diet (Chen et al., 2022, Tian et al., 2017). Therefore, SA and SB may be potential supplements that can alleviate HC-induced gut health and metabolic disturbances in fish, and thus, supplementing the diet with SA and SB was set at 2 g/kg in this experiment. However, whether SA and SB can reduce HC-induced intestinal damage in juvenile largemouth bass remains to be further investigated.

Largemouth bass has become one of the most important species of farmed fish due to its tasty meat, rapid growth, and high market potential (Fan et al., 2022). Like most carnivorous fish, largemouth bass has a limited capacity for carbohydrate utilization (Li et al., 2020). Previous research has indicated that starch levels of 7% to 12% had no harmful effects on largemouth bass, whereas starch levels of 17% and above impaired gut health, disrupted the balance of the intestinal microbiota, and decreased intestinal acetate and butyrate levels (Huang et al., 2021; Zhao et al., 2022a). Hence, the purpose of this study was to assess whether the exogenous supplementation of SA and SB could ameliorate the negative effects on growth performance, intestinal health, and lipid metabolism in largemouth bass fed a HC diet. Other objectives of this study are to identify the mechanisms that may be involved and to provide a theoretical basis for the application of SA and SB.

2. Materials and methods

2.1. Animal ethics

The experiment was completed under the supervision of the Animal Care Advisory Committee of Sichuan Agricultural University (No. 2021202068). All experimental animals and animal management were approved by the China Animal Care Committee (No. 2020-AFFRI-CAAS-001). The experiment complied with the ARRIVE guidelines.

2.2. Experimental diets

Sodium acetate and SB (purity ≥ 98%) were obtained from Xinao Agriculture and Animal Husbandry Development Co., Ltd (Xiamen, Fujian, China). Five isonitrogenous (44% crude protein) and isolipidic (10% crude lipid) experimental diets were made (Table 1) (Zhao et al., 2022a), including a low carbohydrate diet (9% starch; LC), a high carbohydrate diet (18% starch; HC) and a high carbohydrate diet with supplemented 2 g/kg SA (HCSA), 2 g/kg SB (HCSB), and a combination of 1 g/kg SA and 1 g/kg SB (HCSASB). The added levels of SA and SB referred to previous studies (Chen et al., 2023, Zhou et al., 2023). The feed ingredients were crushed and sieved through 80 mesh. After the dry ingredients were thoroughly mixed, oil and water were added. Pellets of 3 mm and 4 mm diameter were produced using a pelletiser. The pellets were dried with a fan and store at −20 °C until use.

Table 1.

Formulation and chemical composition of the diets¹ (% dry matter).

Ingredients	LC	HC	HCSA	HCSB	HCSASB
Fish meal2	51	51	51	51	51
Soybean oil2	6	6	6	6	6
Wheat gluten meal2	4	4	4	4	4
Extruded-soybean2	3	3	3	3	3
Spray dried plasma protein powder2	5	5	5	5	5
α-Starch2	9	18	18	18	18
Soy protein concentrate2	4.5	4.5	4.5	4.5	4.5
Microcrystalline cellulose2	12.5	3.5	3.3	3.3	3.3
Ca(H2PO4)22	1.5	1.5	1.5	1.5	1.5
Choline chloride2	0.5	0.5	0.5	0.5	0.5
Yeast hydrolyzate2	1	1	1	1	1
Vitamin premix3	1	1	1	1	1
Mineral premix4	1	1	1	1	1
SA5	0.0	0.0	0.2	0.0	0.1
SB5	0.0	0.0	0.0	0.2	0.1
Chemical composition
Crude protein6	44.57	44.60	44.18	44.35	44.70
Crude lipid6	10.40	10.29	10.42	10.24	10.52
Moisture6	8.68	8.58	8.70	8.89	8.75
Ash6	12.56	12.49	12.41	12.26	12.10
Crude fiber6	7.60	1.31	1.45	1.56	1.48
Nitrogen-free extract7	16.19	22.73	22.84	22.70	22.45
Carbohydrate8	23.79	24.04	24.29	24.26	23.93
Gross energy9, kJ/g dry matter	18.71	18.73	18.72	18.68	18.82

SA = sodium acetate; SB = sodium butyrate.

¹LC represents a low carbohydrate diet; HC represents a high carbohydrate diet; HCSA, HCSB, and HCSASB represent a high carbohydrate diet supplemented with 2 g/kg SA, 2 g/kg SB, and a combination of 1 g/kg SA and 1 g/kg SB, respectively.

²Supplied by Chengdu Sanwang farming Co., Ltd. (China).

³Vitamin premix provided the following (mg/kg diet): vitamin A, 16,000 IU; vitamin D₃, 8,000 IU; vitamin K₃, 14.72; vitamin B₁, 17.80; vitamin B₂, 48; vitamin B₆, 29.52; vitaminB₁₂, 0.24; vitamin E, 160; vitamin C, 800; niacinamide, 79.20; calcium-pantothenate, 73.60; folic acid, 6.40; biotin, 0.64; inositol, 320; choline chloride, 1,500; L-carnitine, 100.

⁴Mineral premix provided the following (mg/kg diet): Cu (CuSO₄), 2.00; Zn (ZnSO₄), 34.4; Mn (MnSO₄), 6.20; Fe (FeSO₄), 21.10; I (Ca (IO₃) ₂), 1.63; Se (Na₂SeO₃), 0.18; Co (COCl₂), 0.24; Mg (MgSO₄ ·H₂O), 52.70.

⁵Supplied by Xinao Agriculture and Animal Husbandry Development Co., Ltd. (China).

⁶Crude protein, crude lipid, ash, crude fiber and moisture contents were measured value.

⁷Nitrogen-free extract = 100 − (moisture + crude protein + crude lipid + ash + crude fiber).

⁸Carbohydrate = nitrogen-free extract + crude fiber.

⁹Gross energy was calculated by NRC (2011) contents.

Standard methods were used to measure the chemical composition of the diet (AOAC, 2005). Crude protein content was analyzed according to the Kjeldahl method (Kjeltec 2300, FOSS, Hilleroed, Denmark). Crude lipid content was measured by petroleum ether extraction (Soxtec 2055, FOSS, Denmark). Moisture content was determined using a vacuum freeze dryer (GZX-9240MBE, Shanghai, China). Ash content was determined by burning at high temperature in a muffle furnace.

2.3. Fish and feeding trial

Largemouth bass were obtained from a farm (Qionglai Hongbo Agricultural Co., Ltd., China). The fish were kept temporarily in an indoor tank for two weeks and fed a LC diet twice daily. A total of 525 fish (initial body weight of 7.00 ± 0.20 g) were distributed in 15 white cylindrical tanks (35 fish per tank), with 5 treatments per tank and 3 replicates per treatment. The tanks were with 1 m of diameter and held 300 L of water. The fish were fed the trial diets twice daily (08:00 and 16:00) until visual satiety over a period of 8 weeks. During feeding, the water temperature was kept at 25.0 ± 2.0 °C, the dissolved oxygen level was maintained above 6.5 mg/L, the pH was at 6.2 to 7.2, and the NH₄⁺-N level was lower than 0.2 mg/L. We siphoned off the remaining faeces and replenished around 2/5 of the water after every feeding to maintain a clean environment. The photoperiod was kept natural throughout the experiment (12 h light:12 h dark).

2.4. Sample collection

After completing the feeding trial, the fish were fasted for 24 h and then anaesthetized with 0.1 g/L MS-222 (Sigma, St Louis, MO, USA). Blood was obtained from the tail vein using a heparinized syringe and then centrifuged at 2,500 × g for 10 min at 4 °C. The fish were dissected to remove the intestinal contents, and the midgut of fish was immobilized in 4% paraformaldehyde (n = 3) for histological observation. A portion of the midgut (n = 3) was immediately postfixed in 2.5% glutaraldehyde for electron microscopy. In addition, the remaining intestine was placed in sterile tubes and stored at −80 °C for subsequent enzyme analysis, qPCR, and protein blotting assays.

2.5. Growth performance

Initial body weight (IBW), final body weight (FBW), weight gain rate (WGR), specific growth rate (SGR), feed conversion rate (FCR), survival rate (SR), condition factor (CF), hepatosomatic index (HSI) and visceral index (VSI) were calculated using the formulas (Table 2).

Table 2.

Effects on growth performance of largemouth bass (Micropterus salmoides).¹

Items	Groups
	LC	HC	HCSA	HCSB	HCSASB
IBW, g/fish	7.03 ± 0.036	7.06 ± 0.059	7.02 ± 0.026	7.03 ± 0.013	7.02 ± 0.033
FBW, g/fish	41.00 ± 0.332a	36.17 ± 0.392c	38.09 ± 0.393b	37.86 ± 0.290b	38.35 ± 0.330b
WGR2, %	483.30 ± 6.137a	412.10 ± 8.389c	442.30 ± 4.079b	438.30 ± 5.133bc	446.10 ± 6.895b
SGR3, %/day	3.15 ± 0.018a	2.92 ± 0.029c	3.02 ± 0.013b	3.01 ± 0.017bc	3.03 ± 0.023b
FI4, g/fish	37.13 ± 0.631a	33.92 ± 0.228ab	33.44 ± 0.812b	32.83 ± 0.364b	34.24 ± 1.310ab
FCR5	1.09 ± 0.010	1.16 ± 0.012	1.10 ± 0.015	1.11 ± 0.012	1.09 ± 0.033
HSI6, %	3.11 ± 0.077d	5.49 ± 0.095a	5.24 ± 0.152ab	4.89 ± 0.111b	4.12 ± 0.106c
VSI7, %	14.32 ± 0.290b	17.31 ± 0.281a	17.20 ± 0.306a	16.59 ± 0.298a	15.41 ± 0.216b
CF8, g/cm3	2.32 ± 0.026	2.33 ± 0.015	2.37 ± 0.027	2.33 ± 0.025	2.27 ± 0.020
SR9, %	97.14 ± 1.732	92.38 ± 1.000	96.19 ± 2.646	97.14 ± 1.732	95.24 ± 2.000

IBW = initial body weight; FBW = final body weight; WGR = weight gain rate; SGR = specific growth rate; FI = feed intake; FCR = feed conversion rate; HSI = hepatosomatic index; VSI = visceral index; CF = condition factor; SR = survival rate.

LC represents a low carbohydrate diet; HC represents a high carbohydrate diet; HCSA, HCSB, and HCSASB represent a high carbohydrate diet supplemented with 2 g/kg SA, 2 g/kg SB, and a combination of 1 g/kg SA and 1 g/kg SB, respectively. SA = sodium acetate; SB = sodium butyrate.

^a–dWithin a row, means without a common superscript differ significantly (P < 0.05).

¹Data were expressed as means ± SEM (n = 3 for IBW, FBW, WGR, SGR, FI, FCR, and SR; n = 9 for HSI, VSI and CF).

²WGR = 100 × (final body weight − initial body weight)/initial body weight.

³SGR = 100 × [ln(final weight) − ln(initial weight)]/breeding days.

⁴FI = total amount of dry feed consumed per fish.

⁵FCR = FI/(final body weight − initial body weight).

⁶HSI = liver weight/whole body weight × 100.

⁷VSI = visceral weight/whole body weight × 100.

⁸CF = whole body weight/(body length)³ × 100.

⁹SR = final number of fish/initial number of fish × 100.

2.6. Hematoxylin and eosin (H&E staining), TUNEL staining, and Oil Red O staining

Initially, the samples were fixed in 4% paraformaldehyde to preserve their integrity. Subsequently, a gradual dehydration process was employed, using a gradient of alcohol to remove excess moisture. To facilitate further processing, the samples were immersed in xylene and then carefully embedded in paraffin wax. Once embedded, the samples were sectioned into 5-μm slices using both room-temperature microtome (Olympus BX43, Tokyo, Japan) and low-temperature microtome (CM1950, Leica Biosystems, Wetzlar, Germany). The sections from the room-temperature microtome were stained with H&E and subjected to terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) to assess cellular characteristics. Simultaneously, sections from the low-temperature microtome were stained with Oil Red O to investigate lipid content. Images were acquired using an automated digital slide scanner (Pannoramic MIDI II, 3D-HISTECH, Hungary) and quantified using ImageJ.

2.7. Immunohistochemical analysis

Immunohistochemical staining for GRP78 (1:100, YT5858, Immunway) was performed using specific antibodies on 4 μm section slides. The detailed program was based on the procedures reported in our previously published article (Zhao et al., 2022b). Sections were scanned using a digital slicing scanner (Pannoramic MIDI II, 3D-HISTECH, Hungary) and imaged. CaseViewer software was used to acquire three images on a 40× field. Image-pro plus 6.0 software (Media Cybernetics Inc, Rockville, MD, USA) was used to analyze the images together with positive immunohistochemical controls.

2.8. Electron microscopy

The samples were immobilized in a solution of 2.5% glutaraldehyde, subjected to dehydration through a gradient of acetone concentrations, and subsequently embedded in resin. Thin sections were then prepared using an ultrathin microtome (UC7rt, LEICA, Germany) and stained with uranyl acetate and lead citrate. The resulting images were captured utilizing an electron transmission microscope (JEM-1400FLASH, JEOL, Japan).

2.9. Serum biochemical indices analysis

Serum glutamate transaminase (GPT), glutamic oxaloacetic transaminase (GOT), alkaline phosphatase (AKP), acid phosphatase (ACP), and triglycerides (TG) levels were tested following the directions of the manufacturer by using standard kits (Nanjing Jiancheng Bioengineering Institute, China). Immunoglobulin (IgM) and fish complement protein 4 (C4) levels were determined according to the instructions of the enzyme-linked immunoassay (ELISA) kits (Shanghai Enzyme Linked Biotechnology Co., Ltd, China).

2.10. Quantitative real-time PCR

Using our previous genome (unpublished), Primer Premier 5.0 created the primer sequences for qPCR. Details of primers used in this study are shown in Table 3. The Animal Total RNA Isolation Kit (Cat.NO. RE-03014, Foregene, China) was utilized to separate total RNA from intestinal samples, which was then stored for a long period at −80 °C. For qPCR, total RNA was reverse transcribed into cDNA using RT Easy I (Cat.NO. RT-01032, Foregene, China), and kept at −20 °C. The CFX96 real-time PCR detection equipment (BioRad, USA) was then used to carry out real-time quantitative PCR experiments. The target genes were quantified using the ΔCT method, while β-actin was set as a reference gene.

Table 3.

Primer sequences used for real-time PCR analysis.

Gene	Primer sequence (5′ to 3′)	Tm, °C	Amplicon size, bp	E-value, %	R2	GenBank no.
β-Actin	F: AAAGGGAAATCGTGCGTGAC R: AAGGAAGGCTGGAAGAGGG	61	102	99.8	0.995	XM_020154709.1
ZO-1	F: ATCTCAGCAGGGATTCGACGGCTG R: CTTTTGCGCTGGCGTTGG	58.0	149	98.0	0.982	XM_038701018.1
Occludin	F: ACTTTGGATTACCTGCG R: GGGAGGGGCAAGACAACAGT	60.3	154	99.2	0.996	XM_038734217.1
Claudin-7	F: CATTTCAGCAAACACATC R: CGGCACAGAAATCCCAGAG	58.4	92	99.2	0.995	XM_038715821.1
ATF6	F: CAGGACGAAGTGCTTAGAGTT R: AGAGTAATGGACGGTCACAAT	64.3	145	97.9	0.985	XM_038716053.1
IRE1	F: ACGGACCAATCGTGAGAC R: CGGGAGGTGAAGTAGGAG	60.6	168	100.2	0.987	XM_038712961.1
XBP-1	F: ACACCCTCGACACGAAAGA R: AGAATGCCCAGTAGCAAATC	57.7	106	99.8	0.996	XM_038703562.1
GRP78	F: TTGCCGATGACGACGAAA R: CAATCAGACGCTCACCCT	60.6	82	99.4	0.995	NW_024041151.1
CHOPα	F: GATGAGCAGCCTAAGCCACG R: AACAGGTCAGCCAAGAAGTCG	63.0	165	100.1	0.998	XM_038697521.1
Eif2α	F: CCTCGTTTGTCCGTCTGTATC R: GCTGACTCTGTCGGCCTTG	57.7	85	99.8	0.991	PRJNA725023
bax	F: ACTTTGGATTACCTGCGGGA R: TGCCAGAAATCAGGAGCAGA	61.0	106	100.5	0.989	XM_038704178.1
bcl2	F: CGCCATCCACAGAGTCCT R: CCGGAACAGTTCGTCTATCACC	59.4	145	97.8	0.995	XM_038695757.1
caspase3	F: GCTTCATTCGTCTGTGTTC R: CGAAAAAGTGATGTGAGGTA	54.0	187	98.4	0.992	XM_038713063.1
caspase8	F: GAGACAGACAGCAGACAACCA R: TTCCATTTCAGCAAACACATC	56.0	156	98.8	0.996	XM_038718636.1
caspase9	F: CTGGAATGCCTTCAGGAGACGGG R: GGGAGGGGCAAGACAACAGGGTG	66.0	178	99.5	0.987	XM_038723308.1
NF-κB	F: TGATGATAACTGGCTTCGG R: TCAAACCTGGACCCTACCT	60.6	178	100.6	0.998	XM_038723088.1
p38-MAPK	F: CCCCACAACAAGAATCATGC R: TCTCAGCCTTCTCGTGGA	58	180	100.1	0.989	XM_038728055.1
Hepcidin1	F: CATTCACCGGGGTGCAA R: CCTGATGTGATTTGGCATCATC	58.0	140	98.9	0.991	XM_038710826.1
COX2	F: CACTGGGTCGTGTCACTTT R: TGATTCTCCTCCTTGCTGT	60.6	140	99.5	0.995	YP_636060.1
CD80	F: TCTTCATCGTGGTAATAATAGG R: TGTGGTGTCTTCAGGGTCT	58.0	142	99.6	0.989	EVM_0001828.1
IL-8	F: CGTTGAACAGACTGGGAGAGATG R: AGTGGGATGGCTTCATTATCTTGT	64.0	123	100.1	0.982	XM_038704089.1
FAS	F: TGATGATAACTGGCTTCGG R: TCAAACCTGGACCCTACCT	60.6	86	100.1	0.995	XM_038735140.1
ACCA	F: CACCAGGAACATATCGGACA R: ATCAATGTCGCTGTCAGTCT	63.0	184	99.7	0.994	XM_038709737.1
SCD1	F: CGCCGAAGATGATGGTGT R: GGAAGACTCGCAGTGGATTAG	63.0	153	98.9	0.998	XM_038735580.1
PPARγ	F: AGCAGACATCCGCCCTAA R: ACCTCGATCACGCCGTAC	64.3	160	100.4	0.997	XM_038695878.1
CPT1α	F: AGCCCCACCCCAACCTACCAG R: CGGCCCTCACGGAATAAACGC	65.0	81	98.2	0.991	XM_038695351.1
HSL	F: TACCCTCCGTGGCCTTTGACC R: CTCGTCTTCAGCCCCAGCGAT	64.0	161	99.5	0.987	XM_038725628.1
AMPKα	F: CACATGAATGCCAAGATTG R: GGACCAGCATATAACCTTC	54.7	165	99.6	0.995	XM_038734014.1
PGC1α	F: AGATTCAGGGCTAGATATGGG R: GGAAGAGTGGGCTTGGTG	63.0	189	98.9	0.997	XM_038731662.1
PPARα	F: CCACCGCAATGGTCGATATG R: TGCTGTTGATGGACTGGGAAA	58.0	156	100.2	0.993	XM_038738333.1

F = forward primer; R = reverse primer; Tm = melting temperature; ZO-1 = zonula occludens-1; ATF6 = activating transcription factor 6; IRE1 = inositol-requiring enzyme 1; XBP-1 = x-box binding protein 1; GRP78 = glucose related protein 78; CHOPα = C/EBP homologous protein alpha; Eif2α = eukaryotic initiation factor 2 alpha; bax = bcl2-associated x protein; bcl2 = b-cell lymphoma-2; caspase3 = cysteine aspastic acid-specific protease 3; caspase8 = cysteine aspastic acid-specific protease 8; caspase9 = cysteine aspastic acid-specific protease 9; NF-κB = nuclear factor kappa-B; p38-MAPK = mitogen-activated protein kinases; COX2 = cyclooxygenase 2; CD80 = CD80 molecule; IL-8 = interleukin 8; FAS = fatty acid synthase; ACCA = acetyl-CoA carboxylase; SCD1 = stearoyl-CoA desaturase-1; PPARγ = peroxisome proliferator-activated receptor γ; CPT1α = carnitine palmitoyl transferase-1 alpha; HSL = hormone-sensitive lipase; AMPKα = adenosine 5-monophosphate (AMP)-activated protein kinase alpha; PGC1α = peroxisome proliferators-activated receptor γ coactivator 1 alpha; PPARα = peroxisome proliferator-activated receptor-alpha.

2.11. Western blot

The Western blot procedure was performed according to our previous method (Zhao et al., 2022b). The intestinal tissue was lysed in 500 μL of lysis solution, centrifuged at 12,000 × g for 15 min and the supernatants were obtained. Electrophoresis was applied to precast gels. The target protein was transfected onto a PVDF film which was soaked in bovine serum protein for 2 h. The PVDF membrane was then removed, excess primary antibody was washed off with 0.05% Tween20 (TBST), transferred to secondary antibody culture and incubated for 1 h, then washed off again with TBST. Finally, a color developing solution was pipetted to react with the target protein on the PVDF film and images were taken. Data analysis was performed using ImageJ to quantify protein levels. Antibodies: mouse β-actin (1:1,000, 200068-8F10, Zenbio), rabbit bax (1:1,000, #43566, Cell Signaling), rabbit Eif2α (1:500, YT1507, Immunoway), rabbit GRP78 (1:1,000, YT5858, Immunway), rabbit p38-MAPK (1:1,000, Immunoway), rabbit XBP-1 (1:1,000, R1309-10, Huaan Biotechnology), rabbit PPARγ (1:1,000, ET1702-57, Huaan Biotechnology).

2.12. Statistics analysis

The results were expressed as means ± SEM. Shapiro–Wilk test and Levene test were used to check the normal distribution and homogeneity of variance of the data respectively. The t-test was utilized to analyze significant differences between the LC and HC groups, and one way ANOVA was utilized to examine significant differences amongst the HC, HCSA, HCSB, and HCSASB groups. Data were compared using Duncan multiple range test, with “∗” denoting statistical differences among the LC and HC groups (∗P < 0.05, ∗∗P < 0.01). Means without a common superscript differ significantly (P < 0.05). All data were statistically analyzed by GraphPad Prism 9.1.

3. Results

3.1. Growth performance

After 8 weeks of feeding, FCR, CF, and SR (Table 2) did not differ significantly among the groups (P > 0.05). The results of the growth performance analysis (Table 2) indicated that FBW, WG, and specific growth rate (SGR) were significantly lower in the HC group than in the low-carbohydrate diet (LC) group (P < 0.05). However, FBW was significantly higher in the HC diet supplemented with 2 g/kg sodium acetate (HCSA), 2 g/kg sodium butyrate (HCSB), and a combination of 1 g/kg sodium acetate and 1 g/kg sodium butyrate (HCSASB) groups (P < 0.05) than in the HC group, whereas WGR and SGR were significantly higher in the HCSA and HCSASB groups than in the HC group (P < 0.05).

VSI and HSI were significantly higher in the HC group than in the LC group (P < 0.05), and HSI was significantly lower in both the HCSB and HCSASB groups (P < 0.05), although VSI was significantly lower in the HCSASB group than in the HC group (P < 0.05).

3.2. Serum parameters

The serum AKP, ACP, GOT, and GPT levels were significantly higher in the HC group than in the LC group (P < 0.05); after treatment, AKP and GPT were significantly lower in the HCSA, HCSB, and HCSASB groups (P < 0.05). ACP was significantly lower in the HCSB group (P < 0.05), and GOT was significantly lower in the HCSASB group (P < 0.05, Fig. 1A to D). IgM and C4 were higher in the HC group and the three treatment groups than in the LC group, but only C4 was markedly higher in the HCSB and HCSASB groups than in the HC group (P < 0.05, Fig. 1E and F).

Fig. 1.

Effect of dietary sodium acetate (SA) and sodium butyrate (SB) on serum biochemical parameters of largemouth bass fed a high carbohydrate diet. LC represents a low carbohydrate diet; HC represents a high carbohydrate diet; HCSA, HCSB, and HCSASB represent a high carbohydrate diet supplemented with 2 g/kg SA, 2 g/kg SB, and a combination of 1 g/kg SA and 1 g/kg SB, respectively. (A) Alkaline phosphatase (AKP). (B) Acid phosphatase (ACP). (C) Glutamic oxaloacetic transaminase (GOT). (D) Glutamate transaminase (GPT). (E) Immunoglobulin (IgM). (F) Fish complement protein 4 (C4). Data were expressed as means ± SEM (n = 6). Asterisk indicates statistical differences between LC and HC groups (∗P < 0.05, ∗∗P < 0.01). ^a–cMeans without a common superscript differ significantly (P < 0.05).

3.3. Gut morphology and physical barrier

Pathological changes in the gut were analyzed. Intestinal villus height as shown by HE staining was markedly reduced in the HC group compared with the LC group (P < 0.05), while this was restored by treatment with SA, SB, and SASB (Fig. 2A and C). The widths of the intestinal villi were not markedly different (P > 0.05) among the experimental groups (Fig. 2A and C). The intestinal microvilli in the HC group were also shown by transmission electron microscopy to be disorganized and partially detached, exhibiting an irregular state, while in the other four groups, these were relatively cleanly arranged and uniform in length (Fig. 2B). Meanwhile, the lengths of intestinal microvilli in the HC group were less than those in the LC group (P > 0.05, Fig. 2B and D), while the intestinal microvilli in the HCSA, HCSB, and HCSASB groups were greater in length than those in the HC group, although the differences were not significant (P > 0.05, Fig. 2B and D). We also examined tight junction (TJ)-related genes to assess intestinal barrier integrity. We found that the gene expression levels of zonula occludens-1 (ZO-1), occludin, and claudin-7 were significantly lower in the group fed HC than in the LC group (P < 0.05, Fig. 2E), but the levels were notably higher in the HCSB and HCSASB groups than in the HC group (P < 0.05, Fig. 2E).

Fig. 2.

Dietary sodium acetate (SA) and sodium butyrate (SB) improved intestinal morphology and attenuated barrier damage in largemouth bass fed a high carbohydrate diet. LC represents a low carbohydrate diet; HC represents a high carbohydrate diet; HCSA, HCSB, and HCSASB represent a high carbohydrate diet supplemented with 2 g/kg SA, 2 g/kg SB, and a combination of 1 g/kg SA and 1 g/kg SB, respectively. (A) H&E staining images of intestinal sections (scale bars, 500 μm). (B) Transmission electron microscopy images of intestinal microvilli (scale bars, 500 nm). (C) Intestinal villi height and width. (D) Height of intestinal microvilli. (E) Expression levels of tight junction-related genes. Data were expressed as means ± SEM (n = 6). Asterisk indicates statistical differences between LC and HC groups (∗P < 0.05, ∗∗P < 0.01). ^a–cMeans without a common superscript differ significantly (P < 0.05). ZO-1 = zonula occludens-1.

3.4. Intestinal endoplasmic reticulum stress

There was a noticeable increase in the mRNA expression levels of ERS-related genes (ATF6, XBP-1, GRP78, CHOPα, and Eif2α) in the HC group compared with the LC group (P < 0.05, Fig. 3A). After SA and SB treatment, the mRNA expression levels of XBP-1, GRP78, and CHOPα in the HCSA, HCSB, and HCSASB groups were significantly decreased (P < 0.05, Fig. 3A), whereas the expression levels of ATF6 and Eif2α mRNA were significantly downregulated in the HCSASB group (P < 0.05, Fig. 3A). We then examined the ERS marker GRP78. Using immunohistochemical analysis, positive GRP78 expression was found to be significantly higher in the HC group than in the LC group (P < 0.05, Fig. 3B), while the positive expression was lower in the HCSA, HCSB, and HCSASB groups than in the HC group (P < 0.05, Fig. 3B). It is important to note that XBP-1 and Eif2α, key regulators of the ERS response, had protein expression levels that were remarkably increased in the HC group but decreased in the HCSA, HCSB, and HCSASB groups (P < 0.05, Fig. 3C to E).

Fig. 3.

Dietary sodium acetate (SA) and sodium butyrate (SB) alleviated high carbohydrate (HC)-induced intestinal endoplasmic reticulum stress in largemouth bass. LC represents a low carbohydrate diet; HC represents a high carbohydrate diet; HCSA, HCSB, and HCSASB represent a high carbohydrate diet supplemented with 2 g/kg SA, 2 g/kg SB, and a combination of 1 g/kg SA and 1 g/kg SB, respectively. (A) Expression levels of intestinal endoplasmic reticulum stress related genes. (B) Intestinal GRP78 immunohistochemistry (the tail of the arrow represent positive expression. Scale bars, 20 μm). (C-E) Expression levels of XBP-1 and Eif2α protein. Data were expressed as means ± SEM (n = 6). Asterisk indicates statistical differences between LC and HC groups (∗P < 0.05, ∗∗P < 0.01). ^a–cMeans without a common superscript differ significantly (P < 0.05). ATF6 = activating transcription factor 6; IRE1 = inositol-requiring enzyme 1; XBP-1 = x-box binding protein 1; GRP78 = glucose related protein 78; CHOPα = C/EBP homologous protein alpha; Eif2α = eukaryotic initiation factor 2 alpha.

3.5. Intestinal electron microscopy

The changes in intestinal structure and organelles were further observed using a transmission electron microscope. The results showed that the borders between intestinal epithelial cells in the LC group were clear, and tightly interconnected structures were visible; the mitochondria were oval; and the cristae were intact. Furthermore, the matrix electron density was moderate; the double-layered membrane structure was intact; the number of lysosomes was high; and the rough endoplasmic reticulum did not show pronounced swelling (Fig. 4). In contrast, the borders between intestinal epithelial cells in the HC group were blurred; most of the mitochondria were swollen; the cristae were ruptured or disappeared, showing vacuolization; and the number of lysosomes was notably lower than that in the LC group (Fig. 4). In contrast to the HC group, the HCSA, HCSB, and HCSASB groups showed some improvement but less than that of the LC group.

Fig. 4.

Electron micrographs of largemouth bass guts (scale bars, 1 μm). The red pentagons represent mitochondrial damage. LC represents a low carbohydrate diet; HC represents a high carbohydrate diet; HCSA, HCSB, and HCSASB represent a high carbohydrate diet supplemented with 2 g/kg SA, 2 g/kg SB, and a combination of 1 g/kg SA and 1 g/kg SB, respectively. SA = sodium acetate; SB = sodium butyrate; Mi = mitochondria; ER = endoplasmic reticulum; LYP = lysosome; LD = lipid droplet.

3.6. Intestinal apoptosis and inflammation

The results of the TUNEL assay indicated that the level of intestinal apoptosis was significantly higher in the HC group than in the LC group (P < 0.05), whereas the SA, SB, and SASB diets significantly inhibited apoptosis induced by HC (P < 0.05, Fig. 5A and B). Therefore, we investigated the expression levels of the most important genes and proteins involved in apoptosis. There was a significant upregulation of the mRNA expression levels of bcl2, bax, caspase3, caspase8, and caspase9 in the HC group compared with the LC group (P < 0.05). After SA and SB treatment, the mRNA expression levels of bax, caspase3, and caspase9 in the HCSA, HCSB, and HCSASB groups were significantly decreased compared with those in the HC group (P < 0.05), while the mRNA expression levels of bcl2 and caspase8 in the HCSASB group were significantly decreased compared with those in the HC group (P < 0.05, Fig. 5C). Likewise, the levels of key pro-apoptotic bax proteins were remarkably upregulated in the HC group (P < 0.05), while dietary SA, SB, and SASB significantly inhibited their expression (P < 0.05, Fig. 5E and F).

Fig. 5.

Dietary sodium acetate (SA) and sodium butyrate (SB) ameliorated high carbohydrate-induced apoptosis and inflammation in largemouth bass. LC represents a low carbohydrate diet; HC represents a high carbohydrate diet; HCSA, HCSB, and HCSASB represent a high carbohydrate diet supplemented with 2 g/kg SA, 2 g/kg SB, and a combination of 1 g/kg SA and 1 g/kg SB, respectively. (A) TUNEL (green) stained images of intestinal sections (scale bars, 50 μm). (B) Relative apoptosis rates in intestinal sections. (C) Expression levels of intestinal apoptosis related genes. (D) Expression levels of intestinal NF-κB and p38-MAPK genes and pro-inflammatory related genes. (E to G) Expression levels of intestinal bax and p38-MAPK proteins. Data were expressed as means ± SEM (n = 6). Asterisk indicates statistical differences between LC and HC groups (∗P < 0.05, ∗∗P < 0.01). ^a–cMeans without a common superscript differ significantly (P < 0.05). bax = bcl2-associated x protein; bcl2 = b-cell lymphoma-2; caspase3 = cysteine aspastic acid-specific protease 3; caspase8 = cysteine aspastic acid-specific protease 8; caspase9 = cysteine aspastic acid-specific protease 9; NF-κB = nuclear factor kappa-B; p38-MAPK = mitogen-activated protein kinases; COX2 = cyclooxygenase 2; CD80 = CD80 molecule; IL-8 = interleukin 8.

The mRNA expression levels of NF-κB and p38-MAPK were significantly higher in the HC group than in the LC group (P < 0.05). However, after three treatments, the mRNA and protein expression levels of p38-MAPK were significantly lower in the HCSA, HCSB, and HCSASB groups than in the HC group (P < 0.05, Fig. 5D, E, G), whereas only the expression levels of NF-κB mRNA were lower in the HCSB group than in the HC group (P < 0.05, Fig. 5D). There was a significant upregulation of the mRNA expression levels of pro-inflammatory genes (Hepcidin1, COX2, CD80, and IL-8) in the HC group (P < 0.05). However, after all three treatments, their expression levels were significantly lower than in the HC group (P < 0.05, Fig. 5D).

3.7. Intestinal lipid metabolism

There was a marked increase in intestinal fat content in the HC group as demonstrated by Oil Red O staining (P < 0.05), whereas the HCSA, HCSB, and HCSASB groups had lower intestinal fat contents than the HC group, and the contents were significantly less in the HCSB and HCSASB groups than in the HC group (P < 0.05, Fig. 6A and B). A similar pattern was observed for intestinal TG content (Fig. 6C). Furthermore, genes related to lipogenesis (FAS, ACCA, SCD1, and PPARγ) were significantly upregulated in the HC group compared with the LC group (P < 0.05), but SA and SB significantly reduced the expression of lipogenesis genes (P < 0.05, Fig. 6D). In addition, lipolysis-related genes showed an opposite trend to lipogenesis-related genes, with the expression levels of lipolysis-related genes (CPT1α, HSL, AMPKα, and PPARα) significantly lower in the HC group than in the LC group (P < 0.05) but significantly greater in the HCSA, HCSB, and HCSASB groups (P < 0.05, Fig. 6E). It is important to note that the protein level of the key adipogenic factor PPARγ was also significantly upregulated in the HC group (P < 0.05), while its expression was significantly inhibited by dietary SA and SB (P < 0.05, Fig. 6F and G).

Fig. 6.

Dietary sodium acetate (SA) and sodium butyrate (SB) ameliorated high carbohydrate-induced intestinal lipid deposition in largemouth bass. LC represents a low carbohydrate diet; HC represents a high carbohydrate diet; HCSA, HCSB, and HCSASB represent a high carbohydrate diet supplemented with 2 g/kg SA, 2 g/kg SB, and a combination of 1 g/kg SA and 1 g/kg SB, respectively. (A) Oil-red O staining images of intestinal sections (scale bars, 500 μm). (B) Relative oil-red O area in intestinal sections. (C) Intestinal triglycerides (TG) levels. (D) Expression levels of adipogenic related genes. (E) Expression levels of lipolytic related genes. (F, G) Expression level of PPARγ protein. Data were expressed as means ± SEM (n = 6). Asterisk indicates statistical differences between low carbohydrate (LC) and high carbohydrate (HC) groups (∗P < 0.05, ∗∗P < 0.01). ^a–cMeans without a common superscript differ significantly (P < 0.05). FAS = fatty acid synthase; ACCA = acetyl-CoA carboxylase; SCD1 = stearoyl-CoA desaturase-1; PPARγ = peroxisome proliferator-activated receptor γ; CPT1α = carnitine palmitoyl transferase-1 alpha; HSL = hormone-sensitive lipase; AMPKα = adenosine 5-monophosphate (AMP)-activated protein kinase alpha; PGC1α = peroxisome proliferators-activated receptor γ coactivator l alpha; PPARα = peroxisome proliferator-activated receptor alpha.

4. Discussion

The addition of moderate amounts of carbohydrates to aquatic feeds not only saves protein dosage but also reduces ammonia nitrogen emissions from aquatic animals that in turn reduces the pollution from farmed water bodies (Ali and Jauncey, 2004). However, a chronic HC diet can cause metabolic abnormalities in fish and impair immune function, thereby affecting gut health and eventually causing a reduction in growth rate (Wang et al., 2021; Xie et al., 2017). SA and SB can be rapidly absorbed by the intestinal tract of aquatic animals, and play important roles in regulating host metabolism, immune response and improving intestinal function (Xun et al., 2023, Zhang et al., 2020, Zhao et al., 2021a, Zhou et al., 2023). Therefore, we assessed the efficacy of adding SA and SB to a HC diet on the intestinal health of juvenile largemouth bass. Our study demonstrated that dietary SA and SB ameliorated HC-induced intestinal inflammation, apoptosis, and lipid metabolism disorders by reducing intestinal ERS. Although both SA and SB can alleviate the intestinal damage caused by HC, there is no significant difference between the two.

4.1. SA and SB enhanced the growth performance of HC-fed juvenile largemouth bass

SA and SB have been extensively studied in the aquaculture industry due to their effectiveness and safety. Many studies have shown that SA is catabolic in other tissues and organs after absorption in the blood, and is an important energy source for the host (Park et al., 2015). However, SB is the main source of energy metabolism in intestinal epithelial cells. In addition, SA and SB can also improve the enzyme activity of intestinal digestive enzymes, promote nutrient absorption, and improve growth performance (Estensoro et al., 2016; Feng et al., 2022a; Robles et al., 2013). The present research revealed that the HC group of largemouth bass demonstrated substantially reduced growth parameters (FBW, WG, and SGR) compared with the LC group, in agreement with previous studies (Feng et al., 2022b; Liang et al., 2022). However, supplementation with SA and SB significantly improved growth performance, as has been observed in studies with zebrafish, Nile tilapia, and yellow catfish (Abdel-Tawwab et al., 2021; Zhang et al., 2020, Zhao et al., 2021b). Interestingly, SA and SB were equally effective in the growth promotion of juvenile largemouth bass. In addition, dietary SA and SB reversed the abnormally high body indices (HSI and VSI) caused by HC. Similarly, SB reduced HSI and VSI in largemouth bass fed a high-fat diet (Chen et al., 2023).

4.2. SA and SB alleviated immune disorders caused by HC

The analysis of serum parameters helps to assess the overall health status of the animal. Alkaline phosphatase and ACP are two important immunomodulatory enzymes that help eliminate pathogens during the immune response (Fu et al., 2017). Glutamate transaminase and GOT are two major metabolic enzymes that are frequently used to assess the organismal health of fish (Zhao et al., 2021d). Metabolic and immune disorders may lead to abnormally elevated activities of these enzymes (Lin et al., 2018). The present research found that intake of HC resulted in abnormally elevated serum AKP, ACP, GPT, and GOT levels, but treatment with SA and SB restored these to relatively normal states. Similarly, studies on yellow catfish and grass carp also revealed that the dietary supplementation of SA and SB reduced the abnormal elevation of these enzymes caused by external stress (Tian et al., 2017, Zhao et al., 2021a). In addition, the immune system, particularly the humoral adaptive immune system, is largely composed of C4 and IgM (Boshra et al., 2006; Zhou et al., 2013). In this study, we found no significant changes in C4 or IgM in the HC group compared with the LC group, but the addition of SA and SB to the diet resulted in enhanced IgM activity and significantly higher C4 activity. Conversely, it has been shown that dietary carbohydrate was negatively correlated with serum IgM and C4 activity (Zhou et al., 2013), possibly due to the variation in tolerance to carbohydrate levels in different fish species. However, studies on crucian carp and European seabass showed that serum innate immune parameters, including IgM and C4, were elevated to some extent after the addition of short-chain fatty acids to the diets, consistent with our results (Abdel-Mohsen et al., 2018; Li et al., 2022b). Thus, these findings suggest that dietary SA and SB can alleviate HC-induced immune disorders to the same extent and enhance non-specific immunity in largemouth bass.

4.3. SA and SB attenuated HC-induced intestinal barrier damage

Gut health is known to be closely linked to performance, feed efficiency, and general health, and excessive carbohydrate intake can affect fish gut metabolism and physiology (Zhang et al., 2023; Zhao et al., 2020b). Previous studies have demonstrated that HC can damage intestinal villi and microvilli in yellow catfish and largemouth bass (Zhou et al., 2021). Similarly, in this study, HC reduced intestinal villus height and microvillus length, but all of these effects were reversed by dietary SA and SB. Studies have shown that SA and SB are converted into ketone bodies (acetoacetic acid, β-hydroxybutyric acid) in the liver, which serve as the main fuel source of intestinal oxidative metabolism, providing energy for intestinal growth and promoting intestinal development (Zhang et al., 2019). These results suggest that SA and SB can protect against HC-induced atrophy of intestinal villi and microvilli. In addition, the oversupply of carbohydrates as an energy source can lead to chronic stress, resulting in damage to the intestinal barrier that is largely governed by the TJ protein that connects epithelial cells (Oshima et al., 2008; Suzuki, 2013). Further studies showed that SA and SB reduced HC-induced TJ reduction by increasing the expression levels of ZO-1, occludin, and claudin-7 genes. Interestingly, similar findings were obtained from studies on broilers (Zou et al., 2019), grass carp (Wu et al., 2018), and mice (Chen et al., 2022), where SA and SB markedly increased the expression of TJ-related genes in the intestine. Thus, our results suggest that dietary SA and SB improved HC-induced intestinal morphology and intestinal barrier function in largemouth bass.

4.4. SA and SB ameliorated HC-induced intestinal ERS, apoptosis, and inflammation and improved lipid metabolism

Previous reports have demonstrated that a chronic HC diet induces intestinal ERS in fish such as largemouth bass, large yellow croaker, and yellow catfish (Zhao et al., 2021c; Fang et al., 2021; Zhao et al., 2020b). In addition, similar studies have been reported in mammals, and ERS has been shown to be strongly correlated with intestinal injury (Huang et al., 2019; Song et al., 2022). Therefore, we hypothesized that HC-induced intestinal injury, including intestinal inflammation, apoptosis, and disorders of lipid metabolism, is attributed to excessive activation of ERS. Hence, we investigated the ERS status to further explore the potential mechanisms of SA and SB in attenuating HC-induced intestinal injury. In this study, ERS-related genes (ATF6, XBP-1, GRP78, CHOPα, and Eif2α) and key proteins (XBP-1, GRP78, and Eif2α) were markedly upregulated in the HC group, but intestinal ERS was significantly alleviated in juvenile largemouth bass following the addition of SA and SB to the diet. Previous studies have demonstrated that SA and SB can ameliorate tissue damage by attenuating ERS in the brain, liver, and intestine of mice (Hu et al., 2018; Wu et al., 2021; Zhang et al., 2016). However, few studies have examined the effect of adding SA and SB to the diet on ameliorating HC-induced intestinal ERS in fish. Our results suggest that SA and SB can alleviate intestinal HC-induced ERS in largemouth bass, thereby providing an empirical basis for ameliorating intestinal damage.

Chronic inflammation, apoptosis, and excessive lipid deposition are closely associated with ERS (Jia et al., 2020; Medzhitov, 2008; Sano and Reed, 2013). In aquaculture species, a HC diet induced intestinal and hepatic inflammation and apoptosis in eels, Nile tilapia, and largemouth bass (Lin et al., 2018, Shi et al., 2022b; Wang et al., 2022). In the present study, the HC group displayed upregulated expression of pro-inflammatory genes (hepcidin1, COX2, CD80, and IL-8) through NF-κB and p-38MAPK signaling pathways, while dietary SA and SB inhibited the expression of pro-inflammatory factors in the intestine of largemouth bass, significantly ameliorating HC-induced intestinal inflammation. Similarly, studies on Nile tilapia also showed that dietary SA reduced the expression of pro-inflammatory factors (IL-8, IL-12, TNF-α, and IL-1β) by inhibiting MAPK and NF-κB signaling pathways (Li et al., 2020a). Additionally, dietary SB reduced the expression of pro-inflammatory factors (TNF-α, IL-1β, IL-6, and IL-8) through this signaling pathway and enhanced intestinal immune function in grass carp (Tian et al., 2017). In the present study, multiple experimental approaches consistently demonstrated that HC induced intestinal apoptosis, while dietary SA and SB reduced intestinal apoptosis by inhibiting the expression of pro-apoptotic genes (bax, caspase3, caspase8, and caspase9). The addition of SB to the HC diet of goats reduced the expression of pro-apoptotic genes (caspase3, caspase8, and caspase9) and inflammatory genes, which in turn inhibited the inflammatory response and reduced hepatocyte apoptosis (Chang et al., 2018). Studies in mice have also shown that SA inhibits cisplatin-induced apoptosis by attenuating the production of ROS (Zheng et al., 2023). Therefore, we suggest that this anti-apoptotic effect of SA and SB is retained in the intestine of the HC group.

A chronic HC diet causes ERS, leading to the disruption of lipid homeostasis that in turn leads to excessive intestinal lipid deposition, creating a vicious circle (Baiceanu et al., 2016; Kim et al., 2018; Zhang et al., 2021). ERS activates de novo adipogenesis by inducing the expression of SREBP-1c through the XBP-1 pathway (Lee et al., 2008). De novo adipogenesis suppresses fatty acid β-oxidation due to the adverse effect of the adipogenic intermediate malonyl-CoA on CPT1 activity (Morris et al., 2011). Thus, ERS promotes excessive lipid deposition primarily through induction of adipogenesis and inhibition of β-oxidation. In the current study, we observed abnormal accumulation of intestinal fat in the HC group; further studies suggested that this results from increased lipid synthesis pathways and inhibition of ectopic deposition due to catabolic pathways. However, we found that dietary SA and SB reduced HC-induced excess intestinal lipid deposition by inhibiting lipogenesis (FAS, ACCA, SCD1, and PPARγ) and activating lipolytic pathways (CPT1α, HSL, AMPKα, PGC1α, and PPARα) in the gut of largemouth bass. Similar studies have demonstrated that SA attenuates hepatic lipid deposition in Nile tilapia by activating lipolytic metabolism (Zhou et al., 2023). Studies on grass carp have shown that SB reduced hepatic lipid accumulation and improved organismal health (Zhou et al., 2019). Interestingly, dietary SB also improved abnormal lipid metabolism in mice fed a high-fat diet (Adeyanju et al., 2021). Thus, SA and SB play important roles in alleviating lipid metabolism disorders caused by HC and high-fat diets, and the remission effect of SA is slightly better than that of SB.

5. Conclusions

In this study, we evaluated the efficacy and mechanisms of dietary SA and SB in reducing HC-induced intestinal damage in juvenile largemouth bass. We found that dietary SA and SB reduced intestinal inflammation and apoptosis, reduced intestinal damage, and repaired the intestinal barrier by inhibiting HC-induced ERS in juvenile largemouth bass. We further observed that dietary SA and SB inhibited lipogenesis and promoted lipolysis to reduce excessive intestinal fat deposition. These findings demonstrate that SA and SB are viable aquafeed additives that can protect the intestinal health of aquaculture animals.

Author contributions

Liulan Zhao: Funding acquisition, Project administration, Data curation, Conceptualization, Methodology. Liangshun Cheng: Software, Data curation, Formal analysis, Sample collection, Writing – original draft. Yifang Hu: Formal analysis, Investigation, Writing-original draft. Xiaohui Li: Methodology, Investigation. Yihui Yang: Methodology, Investigation. Jin Mu: Sample collection, Validation. Lianfeng Shen: Data curation. Guojun Hu: Writing – review & editing. Kuo He: Date analysis. Haoxiao Yan: Writing – review. Qiao Liu: Writing – review & editing. Song Yang: Project administration, Resources, Supervision, Writing – review & editing.

Declaration of competing interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.