The pathogen Vibrio alginolyticus H1 and its antagonist Pseudoalteromonas piscicida H2 associated with the health status of cuttlefish Sepia pharaonis

Highlights

• •V. alginolyticus H1 and P. piscicida H2 from S. pharaonis were characterized.
• •V. alginolyticus H1 was virulent while P. piscicida H2 was avirulent to S. pharaonis.
• •The antagonistic effect of P. piscicida H2 to V. alginolyticus H1 is phobotaxis.

Abstract

The balance in bacterial community is very important for the maintenance of the health status in the hosts. During the occurrence of a pervasive skin ulcer disease in Sepia pharaonis, bacterial isolate H1 and its antagonist bacterial isolate H2 were simultaneously isolated from the healthy cuttlefish, but only bacterial isolate H1 was isolated from the diseased cuttlefish. In the present study, the genetic and biochemical analysis showed that isolate H1 was identified as Vibrio alginolyticus, and isolate H2 was identified as Pseudoalteromonas piscicida, respectively. The antibiotic susceptibility test using CLSI M45–2015 method showed that the antibiotic resistance of V. alginolyticus H1 and P. piscicida H2 was different, and V. alginolyticus H1 showed strongly resistance to ampicillin. LD₅₀ was calculated based the infection using immerse infection experiment. The result showed that the LD₅₀ for 7 d of V. alginolyticus H1 was 1.58 × 10⁶ CFU/mL, while the no death was observed during the infection of P. piscicida H2. Since the virulence related factors were significantly influenced by host immunity, the virulence factors of pathogen V. alginolyticus H1 was assessed under the stressors of H₂O₂ and 2,2′-dipyridyl. The results showed that the pathogenicity of V. alginolyticus H1 was associated with the haemolytic activity and bacterial motility. Different components of the P. piscicida H2 were collected and were tested for the antagonistic activity. It was unexpected that no antagonistic substance was detected, while V. alginolyticus H1 showed obvious phobotaxis to P. piscicida H2. It could be concluded that V. alginolyticus H1 was a pathogen of S. pharaonis, and P. piscicida H2 was a potential antagonistic bacteria to inhibit V. alginolyticus H1 via chemotaxis instead of producing antagonistic substance.

Introduction

Cuttlefish Sepia pharaonis is a cultured species with the merits of high spawning rate, rapid growth rate, short lifetime, high tolerance to high population density, and high adaptable eating habits [1]. In addition, it is generally regarded as a high qualified food because it contains high protein content and low fat content. Therefore, this species has been a fantastic potential for the extensive artificial culture [1], [2], [3]; however, with the rapid and high intensive development in the culture, an increasing number of bacterial infections that could cause severe diseases in cuttlefish have been reported, leading to the destructive consequences in its breeding and culture. V. alginolyticus, a bacterium that is ubiquitously present in the marine environment [4], had been identified as a pathogen closely associated with skin ulcer disease during cuttlefish culture in our previous study [1,5,6].

Organism is a reservoir to a complex community of dynamic equilibrium microbiota, including bacteria, fungi, parasites, and viruses [7]. The balance in microbial community plays critical roles in maintaining the health status of the host. Numerous beneficial bacteria exist in human skin, such as Cutibacterium acnes, Corynebacterium accolens, and Corynebacterium amycolatum. These probiotics can produce antimicrobial molecules that effectively inhibit the growth of pathogenic bacteria, including Streptococcus pneumoniae, Escherichia coli, and Staphylococcus epidermidis [8]. The imbalance of microbiota can lead to several skin diseases such as psoriasis, hidradenitis suppurativa, acne vulgaris, and atopic dermatitis [8]. Our previous study also indicated that the skin ulcer disease of the cuttlefish was highly relevant to the balance of its bacterial community [2].

Use of antibiotics has once been an effective method to treat bacterial infection, but the long-term, large-scale and highly frequent use of antibiotic has resulted in the dissemination of drug-resistant genes, the emergence of new drug-resistant bacteria, the indiscriminately killing of beneficial bacteria in the intestinal tracts of aquatic animals, as well as generating other hazardous side effects, all of which undermine the safety of aquatic products [9,10]. Recently, new ecological and environmentally friendly biological methods to control the bacterial infection have been concerned, and the antagonist bacteria and their metabolites are being widely used to reduce morbidity, disease spread, and further to enhance the survival rate of cultured animals when challenged with pathogens [11], [12], [13]. It is well known that bacteria belonging to Vibrio spp. are the major pathogens to aquatic animals [14]. Vibrios frequently cause large-scale disease and lead to significant losses [14]. Previous researches have found that isolates of Pseudoalteromonas spp. show antagonistic activity to Vibrio spp., showing a great potential to prevent vibriosis in aquaculture [15], [16], [17]. There are diverse antagonistic effects of Pseudoalteromonas spp. on the growth of V. alginolyticus, Vibrio harveyi and Vibrio parahaemolyticus, as well as other common opportunistic pathogenic bacteria, via the production of small molecular antimicrobial metabolites such as alkaloids, polyketides, and peptides [18]. Other macro molecular including extracellular serine proteases, metalloproteases, and certain unidentified proteolytic compounds have also been identified to be the antibacterial agents of Pseudoalteromonas spp. used to kill Vibrio spp. [19], [20], [21], [22].

Our previous research showed the coexistence of bacterium H1 with its antagonist bacterium H2 in healthy cuttlefish; however, only bacterium H1 was detected in the skin ulcers diseased cuttlefish, which supported the viewpoint that the microbe balance is important for health status of the host. Thus, it was postulated that the antagonist bacterium H2 would exert a protective effect on cuttlefish from skin ulcer disease, by inhibiting the virulence of bacterium H1. This study aims to identify and characterize the pathogen of bacterium H1 responsible for skin ulcer symptoms in cuttlefish as well as the antagonist bacterium H2. Different components of cells were extracted and the antagonist effect was determined to trace the specific antagonistic substances. These results would not only provide data for the deeper understanding the occurrence of the skin ulcer disease in S. pharaonis, but also offer novel probiotics for the disease control in cuttlefish culture.

Materials and methods

Sample collection, bacterial isolation, and chemicals

Three groups of cuttlefish at healthy stage, diseased stage, and agonal stage during the skin ulcer disease were collected, homogenized in PBS using high-throughput tissue homogenizer (Beyotime, Shanghai, China), finally 50 μL homogenate was plated on 2216E agar consisted of 5 g/L tryptone, 1 g/L yeast extract and 0.01 g/L FePO₄ and 3 g/L agar in aged seawater, as described previously [2]. In this study, both bacteria were purified on 2216E agar incubated in a thermostatic incubator at 28 °C (Jiecheng, Shanghai, China). The liquid culture were grown in 2216E medium at 28 °C in a shaker (Yiheng HZ-103B, Shanghai, China). Its growth was monitored using Microplate Reader ( FlexA-200, Allsheng, Hangzhou, China). All chemicals were purchased from Sangon (Shanghai, China), unless otherwise stated.

Biochemical characterization of bacterial isolates

The Gram-staining was used to investigate the morphology of the bacterial isolates H1 and H2 under light microscope Olympus Bx53 (Olympus, Tokyo Japan). API 20 NE Kit and VITEK® 2 compact (BioMérieux) were used to characterize the physiological and biochemical properties of bacterial isolates H1 and H2. All biochemical tests were performed in triplicates, from the aspects of nitrote reduction, indole production, glucose fermentation, arginine dihydrolase, urease, bile esculin, hydrolysis gelatin, o-ni-trophenolbeta-D-galactoside, assimilation of glucose, assimilation of arabinose, assimilation of mannose, assimilation of mannitol, assimilation of N-acetyl-glucosamine, assimilation of D-maltose, assimilation of sodium gluconate, assimilation of potassium gluconate, assimilation of capric acid, assimilation of oxalic acid, assimilation of trisodium citrate, assimilation of phenylacetic acid.

DNA extraction and 16S rRNA gene sequence

MiniBEST Bacteria Genomic DNA Extraction Kit Ver.3.0 (TaKaRa, Beijing, China) was used to extract genomic DNA from the bacterial cells, following the manufacturer's instructions. The concentration and quality of DNA was determined using Microplate Reader (FlexA-200, Allsheng, Hangzhou, China), and the integrity was determined using gel electrophoresis analysis.

The primers used in this study were listed in Table 1. The 50 μL PCR reaction mixture contained 25 μL 2 × PCR plus mix, 22 μL ddH₂O, 1 μL genomic DNA, 1 μL forward primer (8F) and 1 μL reverse primer (1492R) (10 μM each). The PCR procedure was performed as follows: an initial denaturation at 94 °C for 4 min, 30 cycles of amplification with denaturation at 94 °C for 30 s, annealing at 57 °C for 1 min, and an extension at 72 °C for 1 min, then, a final extension at 72 °C for 10 min. PCR products were electrophoresed in 1 % agarose gel with nuclear staining dyes and photographed with a digital camera under UV light. The PCR products were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China), and the sequences were blasted in NCBI (https://www.ncbi.nlm.nih.gov/) to identify the bacterial status. Phylogenetic trees were constructed using the neighbor-joining algorithm of MEGA and bootstrapped 1000 times [23].

Table 1.

Primers used in this study.

Genes	Primers	Sequences (5′−3′)	Annealing temperature ( °C)	Size of amplicon (bp)
16S rRNA	8F	AGAGTTTGATCCTGGCTCAG	57	1500
	1492R	GGTTACCTTGTTACGACTT
tdh	tdhF	GTAAAGGTCTCTGACTTTTGGAC	53	269
	tdhR	TGGAATAGAACCTTCATCTTCACC
trh	trhF	TTGGCTTCGATATTTTCAGTATCT	51	500
	trhR	CATAACAAACATATGCCCATTTCCG
tlh	tlhF	AAAGCGGATTATGCAGAAGCACTG	54	450
	tlhR	GCTACTTTCTAGCATTTTCTCTGC

Antibiotic susceptibility test

CLSI M45–2015 methods were used for the antibiotic susceptibility of bacterial isolates H1 and H2 [24]. Antibiotic susceptibility method by using E-test strip was as described by Durand et al., [25]. Briefly, place the E-test strip (Hopebio, Qingdao, China) lightly on the infected and dried 2216E agar plate and culture at 28 °C for 24 h. The minimal inhibitory concentration (MIC) of the antibacterial medicine against the bacteria is determined by the reading scale at the horizontal intersection of the antibacterial circle and the test strip. MIC≤2 μg/mL is sensitive, MIC=4 μg/mL is moderately sensitive, and MIC≥8 μg/mL is resistant [26]. The following antibiotics were tested: ampicillin, amoxicillin and clavulanic acid, cefotaxime sodium, ceftazidime, imipenem, gentamicin, tetracycline, ciprofloxacin, and compound sulfamethoxazole.

Growth measurement

Growth of bacterial isolates H1 and H2 was performed as described previously [[27], [28]]. A single colony was inoculated into 5 mL of 2216E and grown overnight at 28 °C under shaking condition. Overnight cultures were inoculated into 25 mL fresh 2216E in a sterilized glass conical flask at a ratio of 1:1000. The cultures were further incubated at 28 °C and the OD₆₀₀ was measured at every 2 h interval for 24 h using a Microplate Reader (FlexA-200, Allsheng, Hangzhou, China).

Artificial immerse infection of cuttlefish

To determine the cumulative mortality and the bacterial dose that caused 50 % mortality (LD₅₀) in cuttlefish, 120 healthy cuttlefish with a dorsal mantle length of approximately 2.5 ± 0.2 cm obtained from Xiangshan Laifa Aquatic Nursery (Ningbo, China) were divided into 12 groups, with ten cuttlefish in each group. The experiment was carried out in 60 L static aerated aquariums, and the seawater temperature and salinity were kept at approximately 23 ± 1.0 °C and 30 ± 1.0 ‰ (± S.D.), respectively. Each group was equipped with an aeration pump, which could maintain sufficient dissolved oxygen in the liquid. Bacteria H1 and H2 were separately cultured in 250 mL 2216E medium and incubated at 26 °C for 18 h. Then, five concentrations of 1.0 × 10⁷, 1.0 × 10⁶, 1.0 × 10⁵, 1.0 × 10⁴, and 1.0 × 10³ CFU/mL were supplemented into the seawater, and the seawater was maintained without replacement throughout the whole infection period. Ten cuttlefish from each group were immerse infected with the above bacterial concentrations, while the control group was the cuttlefish without bacterial inoculation. The cuttlefish were fed on live mysids (Neomysis orientalis) as described previously [29], twice a day (8:00 and 16:00) in order to ensure all the cuttlefish had sufficient food at all times. The mortality of cuttlefish was recorded every day and the observation was lasted for 7 d. LD₅₀ was calculated using SPSS based on the cumulative mortalities [30].

The growth of V. alginolyticus in the presence of H₂O₂ or 2,2′-dipyridyl

When the pathogens challenge the host, REDOX stress and iron lack are the main environmental stresses that the pathogens need to conquer [31,32]. Thus, H₂O₂ or 2,2′-dipyridyl (DP) were separately added into the medium to simulate oxidative stress and iron limited condition of the host. Briefly, overnight culture of bacterium H1 was inoculated into 2216E medium containing H₂O₂ at different concentrations of 0, 0.2, 0.4, 0.6, 0.8, 1 and 2 mM or DP at different concentrations of 0, 20, 40, 80, 160, 320 and 640 μM, respectively. After cultured for 12 h, 24 h, 36 h and 48 h, 100 μL of cultures were taken for the measurement of OD₆₀₀ using Microplate Reader (FlexA-200, Allsheng, Hangzhou, China). The MIC of H₂O₂ or DP was defined as the lowest concentration at which no obvious growth was observed.

Haemolytic activity of bacterium H1

Haemolytic activity was measured using the method as described by Natrah et al. [33]. In brief, 5 μL of the bacterium H1 culture was dropped onto the 10 % sheep blood agar. The plate was incubated at 28 °C for 24 h. The haemolytic circle of the colony was observed with naked eyes. To identify the haemolysin genes in the isolated strain H1, primers were designed to amplify the haemolytic genes of tdh, trh, and tlh, coding thermostable direct haemolysin (TDH), TDH related haemolysin (TRH), and non-thermolytic haemolysin (TLH), based on the previous sequences [34] and the primer sequences were listed in Table 1.

The motility test

The motility of bacterium H1 was determined as described by Pearson [35]. Ten microliters of overnight culture of bacterium H1 were separately dropped at the middle of 2216E medium with 1 % agar and 2216E medium with 0.3 % soft agar, both of which contained the MIC concentration of H₂O₂ or DP, respectively. While the same volume of bacterium H1 dropped on the same plate was used as a control sample. After the plate was incubated at 28 °C for 12 h, the swarming motility on 1 % agar and swimming motility on 0.3 % agar were assessed using the naked eye and quantified using a vernier caliper.

The antagonistic activity of bacterium H2

The antagonistic activity of bacterium H2 was first tested using the agar-well diffusion method described by Zhang et al. [36]. One hundred microliters of overnight culture of H1 were spread on 2216E plates, followed by adding filter paper disks impregnated with 5 μL of the overnight culture of H2, respectively. After incubation on 2216E plates at 28 °C for 24 h, the diameters of inhibitory zones were measured with a vernier caliper. The disks impregnated with 5 μL of sterile 2216E medium were used as the control. The antagonistic activity of bacterium H2 was also tested in the seawater. Fifty microliters of overnight culture of bacterium H1 and 50 µL overnight culture of bacterium H2 were simultaneously added into 5 mL sterilized seawater. At the same time, 50 µL overnight culture of bacterium H1 was separately added to 5 mL seawater as a control sample. The two suspensions were co-incubated for 12 h, the colony-forming units (CFU) of bacterium H1 on the TCBS plate were numbered.

Extraction of different components of bacterium H2

To trace the substances with antagonistic activity, the cell fractions of bacterium H2, including cell wall, cell free supernatant and high concentration ECPs were prepared. The cell wall was extracted as follows: 5 mL of bacterium H2 culture was collected and centrifuged at 15,000 rpm for 2 min to remove the supernatant, then, the cell pellet was resuspend in 5 mL PBS followed by adding 5 mg lysozyme and thoroughly mixing. The mixtures were left on the ice bath for 30 min and were placed in liquid nitrogen for immediate freezing. Then, the frozen cells were thawed on the ice and were sonicated in the ice bath for 60 times using ultrasonic homogenizer (SCIENTZ, Ningbo, China), with ultrasound 1 s and stop for 15 s. The cell lysate was centrifuged at 15,000 r/min for 2 min, and the precipitate was collected as the cell wall. Finally, the precipitate was resuspended into 500 μL PBS. To collect the cell free supernatant, 1 mL overnight culture of bacterium H2 was centrifuged at 12,000 rpm at 4 °C for 30 min, and the supernatant was collected and filtered through a 0.22 μm membrane (Millipore, the USA). To collect high concentration ECPs, bacterial cells were spread onto the surface of the cellophane (Bio-Rad, the USA) on a 2216E plate. After incubation at 28 °C for 12 h, the lawn was scraped off and suspended in 100 μL sterilized PBS (0.01 M, pH 7.2). The cells were removed by centrifugation at 12,000 rpm at 4 °C for 30 min, and the supernatant was filtered through a 0.22 μm membrane (Millipore, the USA). To collect the supernatant of the co-culture, 50 µL overnight culture of bacterium H1 and 50 µL overnight culture of bacterium H2 were simultaneously added to 5 mL 2216E liquid culture. After co-cultured for 12 h, the overnight culture was centrifuged at 12,000 rpm for 30 min at 4 °C, and the supernatant was filtered through a 0.22 μm membrane (Millipore, the USA).

Chemotaxis assay

The chemotaxis assay was tested as the method described previously [37]. The overnight cultures of bacteria H1 and H2 were separately diluted to an OD₆₀₀ of approximately 0.6 in 2216E medium. Ten microlitres of bacterium H2 were vertically dropped in the middle of the 2216E plate with 0.3 % agar. Two microlitres of bacterium H1 was dropped horizontally to both sides of bacterium H2. The plates were incubated at 28 °C for 24 h. The distance from the site of inoculation to the colony edges closest to (D1) and furthest from (D2) the H2 spot was measured and the response index (RI) was calculated as follows: RI = D1/(D1 + D2). Colony with RI values larger than 0.52 was considered to indicate positive chemotaxis, while smaller than 0.48 was considered to indicate negative chemotaxis, i.e. phobotaxis.

Statistical analysis

Statistical analysis was performed using SPSS 16.0 software package. The data were expressed as mean ± standard deviation (SD).

Results

Biochemical characterization and identification of the bacterium

In the healthy cuttlefish, there were two kinds of bacteria with distinct characteristics. One bacterium H1 was highly mobile, while another bacterium H2 showed obvious antagonistic activity to bacterium H1. Gram stain showed that both bacteria H1 and H2 were Gram-negative and short rod-shaped bacteria (Fig. 1A). In API 20NE tests, bacterium H1 exhibited positive for nitrate reduction, indole production, glucose fermentation, arginine dihydrolase, hydrolysis gelatin, assimilation of glucose, assimilation of mannitol, assimilation of N-acetyl-glucosamine, assimilation of sodium gluconate and assimilation of potassium gluconate; while bacterium H2 was positive for bile esculin and hydrolysis gelatin (Table 2).

Fig. 1.

Isolation and identification of isolated bacteria H1 and H2. (A) Gram staining of bacteria H1 (1) and H2 (2). (B) 16S rRNA PCR amplification products of bacteria H1 and H2. M: DL2000 Plus DNA Marker (Vazyme, Nanjing, China); lane 1. bacterium H1; lane 2. bacterium H2; (C) The homology tree of bacterium H1 and bacterium H2 constructed using Neighbor-joining method based on the 16S rRNA gene sequence analyses. Bootstrap values (> 50 %) based on 1000 replications are shown at branch node. (1) the phylogenetic tree of bacterium H1. Aliivibrio wodanis strain ATCC 15,382 was used an outgroup. Bar, 0.01 substitutions per nucleotide position. (2) the phylogenetic tree of bacterium H2. Alteromonas macleodii ATCC 27,126 was used an outgroup. Bar, 0.01 substitutions per nucleotide position.

Table 2.

API 20NE characteristics of H1 and H2.

Characteristics	H1	H2
Nitrote reduction	+	–
Indole production	+	–
Glucose fermentation	+	–
Arginine dihydrolase	–	–
Urease	–	–
Bile esculin	–	+
Hydrolysis gelatin	+	+
o-ni-trophenolbeta-D-galactoside	–	–
Assimilation of glucose	+	–
Assimilation of arabinose	–	–
Assimilation of mannose	–
Assimilation of mannitol	+	–
Assimilation of N-acetyl-glucosamine	+	–
Assimilation of D-maltose	–	–
Assimilation of sodium gluconate	+	–
Assimilation of potassium gluconate	+	–
Assimilation of capric acid	–	–
Assimilation of oxalic acid	–	–
Assimilation of trisodium citrate	–	–
Assimilation of phenylacetic acid	–	–

Note: +, positive; −, negative. (The biochemical characterization tube was cultured at 28 °C for 24 h, and the results were determined according to the manufacturer's instructions.).

To identify the species of this two isolates, 16S rRNA fragments were amplified from the purified colonies and the PCR products were sequenced (Fig. 1B). The 16S rRNA sequence of bacterium H1 located in the genus Vibrio and it exhibited highest nucleotide homology with that of the V. alginolyticus. The 16S rRNA sequence of bacterium H2 located in the genus Pseudoalteromonas and it exhibited highest nucleotide homology with that of the Pseudoalteromonas piscicida (Fig. 1C).

V. alginolyticus H1 and P. piscicida H2 showed different sensitivity to antibiotics

Antibiotic susceptibility of V. alginolyticus H1 and P. piscicida H2 was further determined. The antibiotic susceptibility test using nine kinds of antibiotics showed that V. alginolyticus H1 was sensitive to eight antibiotics including amoxicillin and clavulanic acid, cefotaxime sodium, ceftazidime, imipenem, gentamicin, tetracycline, ciprofloxacin, and compound sulfamethoxazole, but resistant to ampicillin (Table 3). The antibiotic susceptibility test using the same nine kinds of antibiotics showed that P. piscicida H2 was sensitive to all kinds of antibiotics (Table 3).

Table 3.

Antimicrobial susceptibility of V. alginolyticus H1 and P. piscicida H2.

Drug	Minimal inhibitory concentration (MIC) (μg/mL)
	H1	H2
Ampicillin	≥256 (R)	0.094 (S)
Amoxicillin and clavulanic acid	2 (S)	0.19 (S)
Cefotaxime sodium	0.094 (S)	0.023 (S)
Ceftazidime	0.25 (S)	0.38 (S)
Imipenem	0.047 (S)	0.047 (S)
Gentamicin	1.5 (S)	1.5 (S)
Tetracycline	0.75 (S)	0.38 (S)
Ciprofloxacin	0.012 (S)	0.006 (S)
Compound sulfamethoxazole	0.125 (S)	0.094 (S)

Note: S means susceptible; R means resistant. (MIC≤2 μg/mL is sensitive, MIC=4 μg/mL is moderately sensitive, and MIC≥8 μg/mL is resistant.).

V. alginolyticus H1 was virulence to the cuttlefish

V. alginolyticus H1 and P. piscicida H2 showed similar growth in 2216E medium. There was a lag phase of 2 h and a logarithmic phase of 16 h in the growth of both bacteria. When the culture time increased to 18 h, it came to the stationary phase of the growth (Fig. 2). In the infection experiment, the cumulative mortalities of cuttlefish showed a dose-dependent pattern when challenged with V. alginolyticus H1 (Fig. 3A). No death of cuttlefish occurred in the control group during the experiment. After 7 d postinfection, the cumulative mortality of cuttlefish was 100 %, 30 %, 0 % 0 % and 0 % respectively, when challenged with a dose of 1.0 × 10⁷, 1.0 × 10⁶, 1.0 × 10⁵, 1.0 × 10⁴ and 1.0 × 10³ CFU/mL, respectively. Thus, the LD₅₀ of V. alginolyticus H1 was 1.58 × 10⁶ CFU/mL for 7 d infection (Table 4). However, no death was observed in the cuttlefish challenged with different concentrations of P. piscicida H2 during the 7 d infection, even at its highest concentrations (Fig. 3B, Table 4).

Fig. 2.

The growth curves of bacterium H1 and H2 in 2216E liquid medium for 26 h, and the optical density was measured at 600 nm for an interval of 2 h. Each growth was carried out in triplicates. Data represent the mean ± SD.

Fig. 3.

Artificial infection of healthy cuttlefish. The mortality of cuttlefish was recorded every day and the observation was lasted for 7 d. (A) Cumulative mortality of cuttlefish challenged with different doses at 1.0 × 10⁷, 1.0 × 10⁶, 1.0 × 10⁵, 1.0 × 10⁴, and 1.0 × 10³ CFU/mL of V. alginolyticus H1. (B) Cumulative mortality of cuttlefish challenged with different doses at 1.0 × 10⁷, 1.0 × 10⁶, 1.0 × 10⁵, 1.0 × 10⁴, and 1.0 × 10³ CFU/mL of P. piscicida H2.

Table 4.

Result of V. alginolyticus H1 artificial infection test.

Group	Sample	Colony forming units·mL −1	Number of infections	Number of deaths	Mortality (%)	LD50
V. alginolyticus H1	the test group	1.0 × 103	10	0	0	1.58 × 106 cfu/mL
		1.0 × 104	10	0	0
		1.0 × 105	10	0	0
		1.0 × 106	10	3	30
		1.0 × 107	10	10	100
	the control group	–	10	0	0	–

Note: LD₅₀ was calculated using SPSS based on the cumulative mortalities.

The susceptibility of V. alginolyticus H1 to the stresses that simulate the host immunity

The growth of V. alginolyticus H1 showed similar trend when the concentrations of H₂O₂ ranged from 0.2 mM to 0.4 mM. However, when the concentrations of H₂O₂ increased to 0.6 mM, there was no growth within 24 h. As a result, the MIC of H₂O₂ for V. alginolyticus H1 in 24 h was 0.6 mM (Fig. 4A). When the levels of DP below 40 μM, the growth of V. alginolyticus H1 was not affected. When the concentrations of DP increased to 60 μM, the growth was slightly hindered. When the DP concentration increased to 80 μM, the growth of V. alginolyticus H1 was dramatically inhibited. No obvious growth was detected when the concentrations of DP were higher than 160 μM. Thus, the MIC of DP to V. alginolyticus H1 in 24 h was 160 μM (Fig. 4B).

Fig. 4.

The tolerance of V. alginolyticus H1 to H₂O₂ and DP. The optical density was measured at 600 nm for an interval of 12 h. The data presented in this study represents the mean ± SD. (A) Growth of V. alginolyticus H1 with different concentrations of H₂O₂ at 0, 0.2, 0.4, 0.6, 0.8, 1 and 2 mM. (B) Growth of V. alginolyticus H1 with different concentrations of DP at 0, 20, 40, 80, 160, 320 and 640 μM. Triplicates were carried out for each growth.

Virulence factors of V. alginolyticus H1

On sheep blood agar, V. alginolyticus H1 displayed a grass-green haemolytic phenomenon (Fig. 5A). PCR amplification showed that the tlh gene was present in V. alginolyticus H1 (Fig. 5B). V. alginolyticus H1 showed obvious swimming and swarming ability (Fig. 5C). Separate addition of H₂O₂ or DP increased the swimming motility of V. alginolyticus H1; however, both H₂O₂ and DP decreased the swarming motility of V. alginolyticus H1 (Fig. 5C). In detail, the diameter of swimming circles in the presence of H₂O₂ and DP respectively were 3.4-fold larger and 2.6-fold larger than that of colony without H₂O₂ or DP, while the swarming circles were 0.75-fold smaller and 0.65-fold smaller than that of colony without H₂O₂ and DP.

Fig. 5.

Haemolytic activity and bacterial motility of V. alginolyticus H1 under H₂O₂ stress and iron limited conditions. (A) Grass-green haemolytic activity of V. alginolyticus H1 displayed on sheep blood agar. (B) PCR amplification of the haemolysis genes. Lane M: DNA Marker; lane 1: amplification of the tdh gene; lane 2: amplification of the trh gene; lane 3: amplification of the tlh gene. (C) Bacterial motility under H₂O₂ stress and iron limited conditions. (1) V. alginolyticus H1 on 0.3 % agar as a control; (2) V. alginolyticus H1 with 0.4 mM H₂O₂ on 0.3 % agar; (3) V. alginolyticus H1 with 40 μM DP on 0.3 % agar; (4) V. alginolyticus H1 on 1 % agar as a control; (5) V. alginolyticus H1 with 0.4 mM H₂O₂ on 1 % agar; (6) V. alginolyticus H1 with 40 μM DP on 1 % agar.

Antagonistic activity of P. piscicida H2 to V. alginolyticus H1

When determined using filter paper method, P. piscicida H2 showed obvious antagonistic effect on the growth of V. alginolyticus H1 on the 2216E agar, with an antagonistic diameter of approximately 16.5 ± 0.5 mm (Fig. 6A). However, no antagonistic effects were visible in the different subcellular components, including the cell wall, cell free supernatant and extracellular products. What's more, there was also no antagonistic effect on the growth of V. alginolyticus H1 when using the supernatant from the coculture (Fig. 6B).

Fig. 6.

The antagonistic activity of P. piscicida H2 to V. alginolyticus H1. (A) The antagonistic activity of P. piscicida H2 to V. alginolyticus H1 using filter paper method. (1) Disk impregnated with 5 μL of P. piscicida H2; (2) Disks impregnated with 5 μL of PBS were used as the control; (3–5) and the diameter of antagonistic ring measured with vernier caliper. Each plate was spread with 100 μL overnight culture. (B) The antagonistic active in different cell components. (1) The antagonistic effect of P. piscicida H2 bacterial cells; (2) Disks impregnated with PBS were used as the control; (3) The antagonistic effect of cell wall; (4) The antagonistic effect of cell free supernatant; (5) The antagonistic effect of P. piscicida H2 extracellular products; (6) The antagonistic effect of co-culture supernatant. (C) The cell number of V. alginolyticus H1 in the absence and presence of P. piscicida H2. (D) Phobotaxis of V. alginolyticus H1 to P. piscicida H2. The overnight cultures of V. alginolyticus H1 and P. piscicida H2 were separately diluted to an OD₆₀₀ of about 0.6 in 2216E medium. Ten microliters of P. piscicida H2 were dropped vertically in the middle of the 2216E plate with 0.3 % agar. Two microliters of V. alginolyticus H1 were dropped on both sides of P. piscicida H2 horizontally. The arrows indicated V. alginolyticus H1 and P. piscicida H2.

Chemotaxis involved in the antagonism of P. piscicida H2

Corresponding to the above antagonistic results, the cell number of V. alginolyticus H1 in seawater showed that when comparing the cell numbers of V. alginolyticus H1 in both the monoculture and the culture with P. piscicida H2 for 12 h, they was approximately the same (Fig. 6C). These negative results led us to wonder whether P. piscicida H2 produced components that could not kill V. alginolyticus H1, but V. alginolyticus H1 disliked. To confirm this speculation, chemotaxis of V. alginolyticus H1 to P. piscicida H2 was performed and a RI of approximately 0.36 was obtained. The result showed that V. alginolyticus H1 showed obvious phobotaxis activity to the P. piscicida H2 (Fig. 6D).

Discussion

Vibrio and Pseudoalteromonas inhabit the same ecological niches and possess similar nutritional requirements, thus, this two kinds of bacteria frequently engage in competitive interactions. As a result, there is a great likelihood of simultaneous isolation of the two different bacterial genera from the same environment [17,38,39]. For example, V. alginolyticus and Pseudoalteromonas spp. were simultaneously identified from the gastric cavity of coral [37]. Our present study further confirmed this concept. Previously, we had found that the simultaneous presence of V. alginolyticus H1 with its antagonist P. piscicida H2 was only observed in the healthy cuttlefish, while only V. alginolyticus H1 was present in the cuttlefish with skin ulcer symptom [2]. Thus, it indicated that the balance between V. alginolyticus H1 and P. piscicida H2 was likely to be intimately associated with cuttlefish health. It has been generally accepted that V. alginolyticus isolates are the common causes of the diseases, and they can infect a wide variety of marine hosts, including fish [40], crabs [41], pearl oysters [4] and cuttlefish [6]. Meanwhile, Pseudoalteromonas isolates have been generally considered to be involved in predator-like interactions within the microbial loop, and to be used as a defense agent against pathogens in marine fauna [42]. Therefore, the emergence of P. piscicida H2 only in healthy cuttlefish indicated that P. piscicida H2 is healthful for cuttlefish, which is similar to the previous researches that the abundance of members of the Pseudoalteromonas is positively correlated with fish healthy stage [43]. Thus, it could be postulated that the balance of V. alginolyticus H1 and P. piscicida H2 is closely related to the health status of cuttlefish. This was similar to the case that the Pseudoalteromonas decreased and Vibrio increased from the skin sample in the diseased Atlantic salmon (Salmo salar) [44].

In our present study, we further found that despite sharing the same niche, V. alginolyticus H1 and P. piscicida H2 showed different ampicillin susceptibility, with V. alginolyticus being strongly resistant and P. piscicida being highly sensitive to ampicillin. This result further confirmed the concept that the environmental strains, especially the opportunistic pathogen of V. alginolyticus, showed highly frequent resistance to ampicillin over time [26]. Bacteria have shown general resistance to β-lactam antibiotics, including ampicillin, for the fact that β-lactam antibiotics are one of the principal antibiotics to be used frequently for bacterial infections in aquaculture [45]. The significant difference in sensitivity to ampicillin between V. alginolyticus and P. piscicida will further strengthen the correlation between the virulence and antibiotic resistance.

The results of the artificial infection revealed that V. alginolyticus H1 exhibited virulence to cuttlefish, which confirmed the notion that V. alginolyticus H1 acts as the opportunistic pathogen of cuttlefish, aligning with both conventional viewpoint and our initial postulation. In this study, the LD₅₀ value of V. alginolyticus H1 was similar to the LD₅₀ value of V. alginolyticus in Hippocampus kuda in an intraperitoneally infection model [46]. It has been generally accepted that haemolysis, iron uptake, motility are associated with the bacterial virulence [47], [48], [49]. Similar to V. alginolyticus Wz11 isolated in the inkjeted cuttlefish by Lv et al. [6], V. alginolyticus H1 also exhibited haemolytic activity. Haemolysin is important for bacterial iron acquisition by freeing up iron chelating proteins under iron-limited environments [50], and V. alginolyticus usually harbors TDH, TRH, and TLH [51]. In V. alginolyticus H1, only the tlh gene was detected, which exhibited phospholipase activity and has previously been described to induce apoptosis, membrane vesiculation, and necrosis in sea bream erythrocytes [50,52]. Another outstanding characteristic of V. alginolyticus H1 was its highly extraordinary motility. The expressions of the virulence related factors are significantly influenced by environmental factors, especially the factors that are involved in host immunity, such as oxidative stress and iron limitation [32,53,54]. Similar to the previous reports [55,56], ROS and H₂O₂ exhibited the same effects on the virulence factors of V. alginolyticus H1. Taken together, both iron limitation and oxidative stress increased the swimming motility of V. alginolyticus H1 under semisolid environments but decreased its swarming motility under solid environments.

Yet, in our present study, P. piscicida H2 showed no virulence during the 7 d infection. Previous reports have showed that probiotics P. piscicida might act as bio-agents to control Vibrio infection in pearl gentian groupers and shrimp Penaeus vanname [57,58,39]. As shown in our results, pathogen V. alginolyticus H1 was successfully isolated and characterized in the case of skin ulcers. V. alginolyticus H1 only coexisted with its antagonist bacterium P. piscicida H2 in the healthy cuttlefish. Moreover, the antagonist bacterium P. piscicida H2 demonstrated a significant inhibitory effect on V. alginolyticus H1 under experimental conditions, which led us to postulate that the antagonist bacterium P. piscicida H2 might inhibit the growth of V. alginolyticus H1 through producing biochemicals and predator-prey [39,[59], [60], [61]]. However, unlike the previous studies, no bacteriostatic compounds could be traced from the collected components of P. piscicida H2, and P. piscicida H2 did not exhibit predatory effect in the seawater samples, either. This intriguing phenomenon prompted us to wonder that the antagonistic effects of P. piscicida H2 on V. alginolyticus H1 might due to the fact that P. piscicida H2 produced a compound that V. alginolyticus H1 dislikes but did not kill it, causing V. alginolyticus H1 to keep away from it. This was proposed for the fact that bacteria possess the ability to forward favorable stimuli but away from detrimental stimuli, which is known as chemotaxis [62]. The evading of V. alginolyticus H1 to P. piscicida H2 was similar to the previous research that Vibrio cholerae demonstrated phobotaxis to non-lethal antibiotic dosages [63]. In the light of the references and our present results, we inferred that V. alginolyticus H1 might demonstrate phobotaxis toward the chemicals produced by P. piscicida H2, which might be the partial reason for the antagonism. Combined all our findings provided a scientific foundation for understanding the diseases caused by V. alginolyticus and offering new probiotic tool to control and prevent the skin ulcer disease in cuttlefish aquaculture. However, more research is needed to further investigate the antagonistic mechanism of P. piscicida H2 to V. alginolyticus H1, as well as the use of P. piscicida H2 as a probiotic in cuttlefish aquaculture.

Conclusion

In this study, the pathogen V. alginolyticus H1 and its antagonist P. piscicida H2 were isolated and identified, and the imbalance of this two bacteria contributed to the occurrence of skin ulcer disease in cuttlefish. The artificial immerse infection showed that V. alginolyticus H1 was virulent while P. piscicida H2 was avirulent to cuttlefish. Haemolytic activity and motility might contribute to the virulence of V. alginolyticus H1, which could be regulated by the environmental factors of iron limitation and REDOX stress that simulated the host immune responses. The antagonism of P. piscicida H2 was not due to the killing through the secretion of bacteriocidal compounds or predation, but depended on the phobotaxis of V. alginolyticus H1 to the chemicals produced by P. piscicida H2 that V. alginolyticus H1 disliked.

CRediT authorship contribution statement

Liting Xu: Methodology, Software, Formal analysis, Validation, Investigation, Data curation, Writing – original draft, Visualization. Maowang Jiang: Investigation, Resources, Validation. Ruibing Peng: Formal analysis, Software. Xiamin Jiang: Resources, Supervision. Shaoyun Wang: Writing – review & editing. Qingxi Han: Writing – review & editing, Data curation, Funding acquisition. Weiwei Zhang: Methodology, Conceptualization, Writing – review & editing, Project administration, Funding acquisition.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

• Data will be available on request.