Seed biopriming with Ochrobactrum ciceri mediated defense responses in Zea mays (L.) against Fusarium rot

Abstract

Seed bio-priming is a simple and friendly technique to improve stress resilience against fungal diseases in plants. An integrated approach of maize seeds biopriming with Ochrobactrum ciceri was applied in Zn-amended soil to observe the response against Fusarium rot disease of Zea mays (L.) caused by Fusarium verticillioides. Initially, the pathogen isolated from the infected corn was identified as F. verticillioides based on morphology and sequences of the internally transcribed spacer region of the ribosomal RNA gene. Re-inoculation of maize seed with the isolated pathogen confirmed the pathogenicity of the fungus on the maize seeds. In vitro, the inhibitory potential of O. ciceri assessed on Zn-amended/un-amended growth medium revealed that antifungal potential of O. ciceri significantly improved in the Zn-amended medium, leading to 88% inhibition in fungal growth. Further assays with different concentrations (25, 50, and 75%) of cell pellet and the cultural filtrate of O. ciceri (with/without the Zn-amendment) showed a dose-dependent inhibitory effect on mycelial growth of the pathogen that also led to discoloration, fragmentation, and complete disintegration of the fungus hyphae and spores at 75% dose. In planta, biopriming of maize seeds with O. ciceri significantly managed disease, improved the growth and biochemical attributes (up to two-fold), and accelerated accumulation of lignin, polyphenols, and starch, especially in the presence of basal Zn. The results indicated that bioprimed seeds along with Zn as the most promising treatment for managing disease and improving plant growth traits through the enhanced accumulation of lignin, polyphenols, and starch, respectively.

Introduction

Maize (Zea mays L.) is a short-duration, most diverse cereal crop of the family Poaceae with great adaptability under many agro-climatic and soil environments (Perera and Weerasinghe 2014). It is the third-most commonly cultivated cereal after wheat and rice, and is one of the world’s most socio-economically important versatile multi-purpose crop due to its nutritional profile (79% starch, 10% protein, 4% fiber, 4% fat, and 3% minerals) and also used as a forage crop with multiple roles as an industrial and energy crop (Poole et al. 2021). In the last 50 years, the consumption of maize increased up to 50% reaching about 18 kg per capita per year (FAOSTAT 2017). In Pakistan, maize as a Kharif crop is cultivated on an area of 1,653 thousand hectares and recorded growth of 16.6 percent over last year’s cultivated area of 1,418 thousand hectares hence contributing 0.7% to GDP (Gross domestic prodection). Punjab province contributes 30% of total grain production, while the remaining 70% comes from the other three provinces (Khyber Pakhtunkhwa, 63%, Sindh, 5%, and Baluchistan, 3%) (Pakistan Bureau of Statistics, 2021–2022).

Fungal diseases are among the most important factors limiting the yield and grain quality of maize, with Fusarium rot or Fusarium ear rot caused by the mycotoxigenic fungus Fusarium at the top of the list (Czembor et al. 2019). Among the most common ear rotting fungal species, Fusarium verticillioides is a cosmopolitan fungus, which has been linked with maize worldwide (Glenn et al. 2001) in causing stalk rot, kernel rot, ear rot, seed rot, seedling blight, and wilt (Rodríguez et al. 2008). F. verticillioides can cause disease, at all developmental stages of the plant, in some cases without displaying any symptoms and, consequently, fumonisins are present in symptomless infected kernels (Miedaner et al. 2010). Warm and dry conditions favor the disease, while low rainfall accompanied by a long duration of higher temperature (30–35 °C) during flowering provokes mycotoxin accumulation and disease development (Czembor et al. 2019).

Micronutrient, zinc (Zn) is recognized as a dual sword against pathogen growth and host susceptibility, which induced enhanced jasmonic acid/ethylene signaling pathway promoting host resistance against many necrotrophic pathogens (Martos et al. 2016; Shoaib et al. 2022). For numerous fungal infections, including leaf spots in chilies, early blight in tomatoes, and charcoal rot in mungbean, basal or foliar application of Zn (3–5 mg Kg⁻¹) has been suggested as an effective and environment-friendly treatment for the disease management (Shoaib et al. 2020, 2021, 2022). Moreover, Zn is the second most abundant trace metal in living organisms and its deficiency has been identified as the main culprit for hidden hunger in two billion people. Therefore, in recent years the importance of Zn has gained momentum in agriculture for producing Zn-fortified crops, especially in the case of cereals (e.g. corn) (Choukri et al. 2022). Moreover, Zn is an essential element for the regulation of physio-biochemical, molecular, and morpho-growth responses in plant cells, while Zn deficiency affects root development, retarded growth, and increased susceptibility to fungal infections (Tavallali et al. 2010). Hence, utilization of Zn for the management of Fusarium ear rot disease in the maize might prove effective and sustainable option.

Various studies are also exploiting the important contributions of biocontrol bacteria towards plant diseases management as these bacteria by producing a number of metabolites such as antibiotics, hydrogen cyanide, siderophore, and lytic enzymes, stimulating phytohormones (e.g. auxins, cytokinins, and gibberellins), and increasing accessibility of various soil nutrients that are involved in improving plant health, vigor, and productivity (Köhl et al. 2019). Besides the environmental conditions and nature of crops, the inoculation method also affects the survival, colonization, and multiplication, of microbial agents applied. In comparison to a number of different inoculating approaches, pre-sowing seed treatment with biocontrol agents provides a physiological state that allows the microbial agent to create close contact with the seed and also serves as an important management strategy for a number of seed and soil-borne diseases (Sarkar et al. 2021). This process of bio-priming is documented as a viable, inexpensive, and environment friendly approach for improving stress tolerance, nutrient uptake, seed germination, and yield of valuable crops (Chakraborti et al. 2022). Bio-primed seeds exhibit systemic resistance to stress by improving hydrolytic enzyme activity, producing oxidants and antioxidants, changing internal plant hormone levels, as well as differential gene expression (Deshmukh et al. 2020). The benefits of biocontrol bacteria can further be enhanced by combining them with Zn (Awan et al. 2022), which might offer a simple, economical, and eco-friendly approach to manage fungal diseases. However, limited knowledge is present in this regard. For instance, Shoaib et al. (2020) found that soil application of Ochrobactrum ciceri and Zn (2.5 mg Kg⁻¹) protected mungbean plants against M. phaseolina by improving biochemical and antioxidant responses in the plants. Gawad et al. (2021) recommended the development of zinc- and Trichoderma-based compositions to mitigate gray mold disease of tomatoes caused by Botrytis cinerea. Azmat et al. (2022) confirmed the synergistic role of Zn nanoparticles and Pseudomonas sp. in protecting wheat plants from all stress groups (heat and drought) by minimizing oxidative stress through enhanced production of antioxidants. Therefore, the current study was designed to determine the in vitro antifungal potential of O. ciceri in Zn-amended medium against F. verticillioides, and in planta disease managing potential of seed biopriming with O. ciceri in Zn-amended soil on morpho-growth, physio-chemical, and histo-pathological traits in the maize plants.

Materials and methods

Isolation and identification of the fungal pathogen

The pathogen was isolated from infected corn collected from a local market in Lahore, Pakistan. The infected seeds were placed between two paper towels and pressed using a rolling pin to remove excess water, then plated onto 2% water agar. The emerging hyphae were placed on a 2% Malt extract agar [(MEA: 20 g Malt extract, 20 g agar in 1000 mL⁻¹ distilled water)] media plate incubated at 28 ± 2 °C till 7 days to produce conidia. The conidia were dislodged by flooding plates with sterile distilled water, and these were spread on 2% MEA plates incubated at 28 ± 2 °C for 24 h for conidial germination. Then single germinated conidia were transferred to separate plates containing 2% MEA and incubated for 7 days (Broders et al. 2022).

Identification based on morphological characters such as colony color, texture, diameter, conidia color, conidiophores, and chlamydospores were studied under the light microscope (Olympus CX41, Tokyo, Japan) at a magnification of 100 × using a key by Nelson et al. (1983). For molecular identification, DNA extraction of fungal genomic DNA was carried out by the Nucleon Reagent B method (Akhtar et al. 2014). PCR amplification was carried out by using universal ITS primers (ITS-1 TCCGTAGGTGAACCTGCGG; ITS-4 TCCTCCGCTTATTGATATGC). PCR was performed in a thermal cycler (T100TM Thermal Cycler, BIO-RAD, Singapore) primer pair. PCR tube contained a reaction mixture of 50 µL including master mixture (25 µL), each forward and reverse primer (1 µL), nuclease free water (15 µL), and 8.0 µL fungal DNA suspension containing (30–50 ng). The temperature profile was programmed as follows: pre-heated for 5 min at 95 °C, followed by 40 denaturation cycles for 45 s at 95 °C, 45 s annealing at a temperature of 60 °C with 10 min final extension at 72 °C and tempered at 4 °C for sample restoration. Sequences of ITS were submitted to GenBank under under Accession No OP735521.

For long-term storage, the isolated pathogen was grown on 2% MEA for 7 days, and then 2 mL of a 10% glycerol solution was pipetted onto the plate to dislodge conidia; the resulting conidial suspension was removed from the plate with a pipette, transferred to Eppendorf tube (2 mL), and stored at − 80 °C (Leslie and Summerell 2006).

Pathogenicity test

The conidial suspension of the pathogen was prepared in sterilized distilled water by harvesting conidia from 7-day-old culture. Healthy seeds of maize variety CZP-13200 were surface disinfected in a 2% sodium hypochlorite for 5 min, immersed for 1 min in a 10⁶ mL⁻¹ macroconidia suspension, and then equally spaced around the plate on sterile water-saturated filter paper (10 seeds plate⁻¹), approximately 1 cm from the edge with five replications. Plates were incubated at 28 °C in the dark for 7 days; then, healthy seeds were counted that successfully germinated. Seeds were considered to have successfully germinated if the radicle was > 1 cm long and had > 50% healthy tissue. The pathogenicity of the pathogen was scored based on the following rating scale: 0 = 100% germination, with no symptoms of infection; 1 = 70 to 99% germination, with no lesion formation on the roots; 2 = 30 to 69% germination, with coalesced lesions; and 3 = 0 to 29% germination, where all seed and root tissue were colonized (Broders et al. 2022).

In vitro antifungal bioassays

O. ciceri (FCPB-0727; GeneBank, Accession No. LC415039) was checked for antifungal potential against the isolated fungal pathogen by dual culture method in a Zn-amended medium. Malt agar medium was prepared in Petri plates (9 cm), and 2.5 ppm of zinc sulfate (ZnSO₄, AppliChem) was added to the growth medium. The MEA medium without Zn was used as the control. After pouring and solidifying, a 5 mm disk of a 7-day-old pure culture of the pathogen was inoculated on one side of the plates, and the bacterial strain was inoculated by streaking 2.5 cm away from the center on the same plate. The plates were incubated at 28 ± 2 °C for 7 days in a completely randomized design. After incubation, fungal growth inhibition was recorded with respect to control. The percentage reduction in the radial growth of fungal mycelia by bacterial strains in comparison to that on control plates without bacteria was evaluated by the following formula (Riaz et al. 2023).

$$\text{Percentage inhibition}\left(\%\right)=\text{Control}-\text{Treatment}/\text{Control}\times 100$$

Antifungal bioassays with cell pellet and culture filtrate of O. ciceri

A pure O. ciceri inoculum was inoculated in 100 mL of LB broth medium (1% trypton, 1% NaCl, and 0.5% yeast extract) in 500 mL of the flask and incubated for 72 h at 30 °C under stirring (120 rpm). The culture filtrates (CF) and bacterial cell pellet (CP) were separated by centrifugation at 12,000 rpm at 4 °C for 30 min from the exponential growth phase. The CP was washed with autoclaved distilled water to remove excess culture and re-suspended in phosphate buffer saline to be used later, while CF was filtered under vacuum through filter paper (pore size: 0.22 µm), and the filtrates were stored at 4 °C for further assays (Shoaib et al. 2020).

Mycelial growth inhibition was estimated by the radial growth inhibition assay in 2% MEA in Petri plates (9 cm), prepared by appropriately incorporating different concentrations (25, 50, and 75%) of CP as well as CF in the solid medium. The antifungal potential of different concentrations of CP and CF was also assessed with the amendment of 2.5 ppm of ZnSO₄ in the growth medium. The non-amended medium (without CP, CF, or Zn) was used as the control (Table 1). A 5 mm disk of a 7-day-old pure culture of the pathogen was inoculated in the middle of the plates. A set of 52 plates with a total of 14 treatments was set up at 28 ± 2 °C for 7 days in a completely randomized design. After incubation, fungal growth inhibition and morphological alterations (microconidia, macroconidia, chlamydospore, and conidiophore) were observed under a light microscope with respect to control.

Table 1.

In vitro experimental design for testing antifungal activity of cell pellet and culture filtrate of Ochrobactrum ciceri with the incorporation of ZnSO₄ (2.5 ppm)

	Without Zn	With Zn
Cell pellet/culture filtrate concentration (%)	0	0
	25	25
	50	50
	75	75

In planta pot bioassays

Forty pots were set up in quadruplicate with 8 treatments in a completely randomized design at the experimental area of the Faculty of Agricultural Sciences (1° 30′15″ N and 74° 18′ 23″ E) from April-July, 2022 (average temperature: 35 °C and average humidity: 65%) (Table 2). The soil was covered with a polythene sheet after inserting formalin (2%) soaked cotton buds at various places in the soil, then the sheet was removed after 7 days, and the soil was left open for the removal of formalin fumes. Earthen pots (12ʺ length × 8ʺwidth) were filled with sterilized soil (4 kg pot⁻¹). The fungal inoculum was prepared from 7-days-old cultural plates of the pathogen by scrubbing culture with a sterile spatula in sterilized distilled water, then cultural suspension (50 mL pot⁻¹) was mixed in pre-sterilized potted soil and left for 3 days for the establishment of the pathogen.

Table 2.

Experimental design for the effect of ZnSO₄ (Zn: 2.5 mg Kg⁻¹) and seed-priming with Ochrobactrum ciceri (OC) on growth and disease caused by Fusarium verticillioides (FV) in Zea mays

Treatments	Without pathogen	Treatments	With pathogen
T1	Negative control (normal seeds, without any treatment)	T5	Positive control (normal seeds + soil inoculation with the FV only)
T2	OC-primed seeds	T6	OC-primed seeds
T3	Zn + Non-primed seeds	T7	Zn + Non-primed seeds
T4	Zn + OC-primed seed	T8	Zn + OC-primed seeds

Before seed sowing, basal dose of Zn (2.5 mg Kg⁻¹) was applied in the form of zinc sulfate (ZnSO₄. H₂O), which was brought from Engro Fertilizers ^LTD. For seed priming, the inoculum of O. ciceri was prepared in LB medium, incubated in an orbital shaker at 37 °C and 120 rpm for three days. The bacterial suspension was prepared in 1% of carboxy methyl cellulose (CMC) solution to achieve 1.0 × 10⁷ colony-forming units per mL of suspensions. Surface-sterilized maize seeds were coated with O. ciceri by soaking seeds for 12 h in the bacterial suspension, and surface-dried seeds were sown in pots (10 seeds pot⁻¹) (Amruta et al. 2019). Non-primed dry seeds were used as a negative control (T₁), while non-primed dry seeds provided with the pathogen served as a positive control (T₂) (Table 2).

The germination rate was recorded 20 days after sowing, while the disease, biochemical, anatomical, and growth attributes of the maize plants were measured 60 days after sowing.

Disease and biochemical traits

The disease severity was assessed in a similar way as described in a pathogenicity trial (Broders et al. 2022). Total chlorophyll content and carotenoids were checked as described formerly (Lichtenthaler and Wellburn 1983) and total protein content (TPC) was determined by the method of Lowery et al. (1951). The CAT (catalase) activity (EC: 1.11.1.6) was measured in a mixture (enzyme extract + 0.05 M sodium phosphate buffer + 0.036% of 35% hydrogen peroxide) at 240 nm (Aebi 1984). The reaction mixture for POX activity (EC 1.11.1.7) was quantified at 420 nm after mixing with 100 mM phosphate buffer, enzyme extract, 5.33% pyrogallol and 0.5% H₂O₂ (Kumar and Khan 1982). PPO activity (EC 1.14.18.1), was determined at 495 nm in the reaction mixture made with 1.5 mL of 0.1 M sodium phosphate buffer (pH 7.0), 0.6 mL, 10 mM catechol and 0.1 mL enzyme extract (Mayer et al. 1965).

Anatomical studies

A comparative microscopic study of transverse sections of all the treatments (T₁-T₈) was carried out to determine the anatomical changes in plant cells in response to different treatments. Free-hand thin transverse sections were microtome with the help of a blade along the radial plane of a cylindrical portion of the stem. Sections of maize stem were treated with Wiesner’s reagent (Phloroglucinol-HCl) (Johansen 1940), iron (III) chloride (Pomer et al. 2004), and Lugol’s iodine or IKI (Hinchman 1973) for detection of lignin, polyphenols, and starch, respectively. All treated sections were mounted on a microscope slide and examined under a light microscope.

Growth traits

A total of 12 growth attributes including the number of nodes per plant, the number of leaf per plant, leaf area, length, fresh, dry weights of leaf, stem, and root were measured.

Statistical analysis

Data regarding the effect of different treatments in the laboratory as well as in pot assays were analyzed statistically and the data were subjected to analysis of variance (ANOVA). The treatment means were delineated by LSD test at p ≤ 0.05 level of significance using computer software Statistics 8.1. Afterward, principal components analysis was built to summarize the variability of the treatments and to determine the association among the measured traits.

Results

Identification of the fungal pathogen and pathogenicity test

Fusarium verticillioides was recovered from the maize seeds, showed fluffy, white growth from the front side, and white to pale straw on the reverse side reaching a diameter of 7–7.5 cm after 7 days at 28 °C on MEA (Fig. 1). There were hyaline, branched hyphae and conidiophores; septated, oval to kidney-shaped measuring 5–10 × 2.1–2.9 μm microconidia; falcate, 3–5 septate measuring 20–37 × 2.2–3.1 μm macroconidia, and thick-walled round chlamydospores (Fig. 1). About 770 bp amplicon was obtained through PCR amplification (GenBank Accession No: OP735521), confirmed the identification of F. verticillioides through BLAST analysis of the sequence by showing its 100% similarity to OP020562.1 on the NCBI database. Re-inoculation of maize seed with the F. verticillioides caused 70% inhibition in the germinations, and all seeds and root tissue were colonized with the fungus growth confirming the pathogenicity of the fungus on the maize. No disease symptoms were found in the control .

Fig. 1.

Pathogenicity test, morphological and molecular description of Fusarium verticillioides a: Infected corn cob; b: Front and back view of pure culture of isolated pathogen on 2% Malt extract agar (MEA) after 7 days of incubation at 28 °C; c: Light micrographs showing microscopic characters, hyphae (hyp), falcate and large macroconidia (Mc), zero to one-septate microconidia (mc), intercalary chlamydospore (Ch), long branched and septate conidiophore (Cp); d: Total genomic DNA of the isolated fungus and amplified PCR product of approximately 770 bp using ITS primer; e: Re-inoculation on the maize seeds to confirm the pathogenicity of the isolated fungus

In vitro bioassays

Antifungal activity of O. ciceri in Zn-amended medium through dual culture assay

Compared with the control (Fig. 2a₁-a₃), inoculation of O. ciceri (OC) significantly (p ≤ 0.05) inhibited mycelial growth of F. verticillioides (FV) by 81% and also induced discoloration and distortion of the fungal structures (Fig. 2b₁-b₃). However, there was no effect of the Zn amendment (without OC) on the growth of FV, and the fungus morphological features also remained unaffected though hyphal density and sporulation reduced visibility (Fig. 2c₁-c₃). Inoculation of OC on the Zn- amended medium, not only declined fungal growth significantly (p ≤ 0.05) by 88%, but also distorted fungal structures more intensively. Furthermore, no pigment was found in the control and Zn-amended plates (without OC), while the fungus exhibited red-wine pigment in FV + OC, which was decreased to a negligible amount in FV + OC + Zn (Fig. 2a₁-a₃ to d₁-d₃).

Fig. 2.

Growth inhibition and morphological alterations in Fusarium verticillioides (FV) due to antifungal action of Ochrobactrum ciceri (OC) in dual culture technique on zinc (Zn) amended malt extract agar (MEA) plates at 7^th day after incubation at 28 °C. The letters above bars show a significant difference (p ≤ 0.05) as determined by the LSD test and error bars show means of replicates (n = 3). Morphological alterations in the fungus were observed at 100 × and depicted with colored boxes from a-d. a₁, a₂: Dense white cottony colony; b₁, b₂: Sparse growth with pigmentation; c₁, c₂: Less dense white cottony colony; d₁, d₂: Sparse growth with negligible pigmentation; a₃: Normal hyphae (hyp), macroconidia (Mc), microconidia (mc), chlamydospore (ch) and conidiophore; b₃: aseptate, discolored and distorted hyphae, macroconidia and microconidia; c₃: Fewer macroconidia and microconidia; d₃: Aseptate, discolored, fragmented and swollen hyphae, macroconidia and microconidia

Antifungal activity of cell-pellet and culture filtrate of O. ciceri in Zn-amended medium

The growth of the FV was significantly inhibited by all three concentrations (25, 50 and 75%) of both cell pellet (CP) and cultural filtrate (CF) of O. ciceri, while the latter was more antifungal than the former. Moreover, presence of Zn in the growth medium also improved the antimycotic activity of CP or CF (Fig. 3). Therefore, agar medium incorporated with the low to medium concentrations of CP and CF significantly decreased fungal biomass by 71–77% and 84–88%, while by 73–80% and 87–100% in the presence of Zn, respectively. Further, there was no growth of the fungus at higher concentration (75%) of either CP or CF (Fig. 3).

Fig. 3.

Antifungal potential of different concentrations (25–75%) of cell pellet (CP) and the cultural filtrate (CF) of Ochrobactrum ciceri (OC) against Fusarium verticilloides (FV) on Zn-amended malt extract agar (MEA) plates at 7^th day incubation at 28 °C. Each treatment in the experiment has three independent biological replicates (n = 3). The letter in superscript shows a significant difference (p ≤ 0.05) as determined by the LSD test

CP and CF of O. ciceri also induced changes in the fungus growth pattern (Fig. 4) and structural features (Fig. 5a-f) both in the Zn-amended and un-amended growth medium. All changes in the fungus growth pattern and structural features are summarized in Table 3. For instance, when medium was devoid of Zn, the fungus produced wine-red pigmentation (Fig. 4) without altering structural features at 25% CP (Fig. 5b₁), while the hyphae discolored and macroconidia turned into loose clusters at 50% CP (Fig. 5c₁), and mycelial growth was lacking at 75% CP (Fig. 4). Likewise, the fungus produced inflated, faded, and fragmented structures at 25% CF (Fig. 5d₁), the intensity of structural abnormalities became severe at 50% CF (Fig. 5e₁), and the whole dissolution of the fungus was evident at 75% CF (Fig. 5f₁).

Fig. 4.

Antifungal potential of different concentrations (25–75%) of cell pellet (CP) and the cultural filtrate (CF) of Ochrobactrum ciceri (OC) against Fusarium verticilloides on Zn-amended malt extract agar (MEA) plates at 7^th day after incubation at 28 °C

Fig. 5.

Antifungal potential of different concentrations (25–75%) of cell pellet (CP) and the cultural filtrate (CF) of Ochrobactrum ciceri (OC) against Fusarium verticilloides (FV) on Zn-amended malt extract agar (MEA) plates at 7^th day after incubation at 28 °C at 100 × . a₁, a₂: Normal hyphae (hyp), macroconidia (Mc), microconidia (mc), chlamydospore (ch) and conidiophore; b₁, b₂: clusters of mc in b₁ and scattered mc in b₂; c₁, c₂: Aseptate and discolored hyphae, Mc in clusters in c₁ and in a chain in c₂; d₁, d₂: Aseptate, discolored, fragmented and swollen hyp, Mc and mc; e₁: aseptate, discolored, fragmented and swollen hyp, zero to fewer Mc and mc in e₁; f₁: Completely dead, distorted hyp without any Mc and mc

Table 3.

Morphological and microscopic alterations in Fusarium verticilloides due to the effect of different concentrations of cell pellet (CP) and the cultural filtrate (CF) of Ochrobactrum ciceri on malt extract agar ( MEA) plates amended with Zn at 7^th day after incubation at 28 °C

Morphological characters	Culture medium containing different concentrations of CP or CF (Without Zn)
	(0%)	(25%)		(50%)		(75%)
	Control	Cell pellet	Cultural filtrate	Cell pellet	Cultural filtrate	Cell pellet	Cultural filtrate
Colony characters
Growth	Highly dense	Light	Light	minute	minute	No growth	Minute
Color	Whitish	Whitish brown	Creamy brown	Creamy	Creamy	–	Whitish
Texture	Cottony	Cottony	Cottony	Cottony	Fused	–	Fused
Pigments	Absent	Present	Present	Absent	Absent	–	Absent
Microscopic characters
Chlamydospores	Absent	Absent	Present	Absent	Present	–	Absent
Microconidia	Present	Clustered	Highly clustered	Highly clustered	Clustered	–
Macro conidia length (μm)	5–20	5–20	5–20	5–20	5–20	–
Macro conidia width (μm)	2–3	2–3	2–3	2–3	2–3	–
Macro conidia septation	6–7	5–6	5–6	4–5	4–5	–
Hypae	Normal	Swollen	Highly swallon	Fairly swallon	Distorted	–
Conidiophore	Present	Present	Present	Present	Present	–

Morphological characters	Culture medium containing different concentrations of CP or CF (With Zn)
	(0%)	(25%)		(50%)		(75%)
	Control	Cell pellet	Cultural filtrate	Cell pellet	Cultural filtrate	Cell pellet	Cultural filtrate
Colony characters
Growth	Highly dense	Less minute	Minute	Minute	No growth	No growth	No growth
Color	Whitish	Whitish brown	Whitish	Creamy	–	–	–
Texture	Cottony	Sticky	Sticky	Sticky	–	–	–
Pigments	Absent	Present	Absent	Absent	–	–	–
Microscopic characters
Chlamydospores	Absent	Absent	Absent	Absent	–	–	–
Microconidia	Less clustered	clustered	Clustered	Clustered	–	–	–
Macro conidia length (μm)	5–20	5–20	5–20	5–20	–	–	–
Macro conidia width (μm)	2–3	2–3	2–3	2–3	–	–	–
Macro conidia septation	6–7	5–6	5–6	5–6	–	–	–
Hypae	Normal	Distorted	Distorted	Distorted	–	–	–
Conidiophore	Present	Present	Present	Present	–	–	–

In the presence of Zn + 25% CP, the fungus exhibited the production of wine-red pigmentation (Fig. 4), whereas the hyphae turned into small fragments, and conidia failed to retain in tight clusters (Fig. 5b₂), the same pattern of structural abnormalities continued till 50% CP (Fig. 5c₂), and the fungus failed to show any growth at 75% CP (Fig. 4). In Zn + CF, deterioration of the fungal structures (hyphae and conidia) was clearly evident at 25% CF (Fig. 5d₂), with the complete absence of growth 50% and 75% CF (Fig. 4).

In planta bioassays

Disease and growth

The treatments (T₂-T₄) without inoculating with the pathogen (FV) exhibited the positive response to seed biopriming (T₂), basal Zn application (T₃) or basal Zn + seed biopriming (T₄) by significantly improving area and dry weight of leaf as well as height and weight of the maize plants by 30–50% in T₂, 20–40% in T₃, and 30–60% in T₄, respectively, compared to T₁ (Figs. 6, 7, 8, 9).

Fig. 6.

Effect of Fusarium verticillioides (FV), Ochrobactrum ciceri (OC), and zinc (Zn) on growth in Zea mays plants. T₁: Negative control (normal seeds, without any treatment); T₂: OC-primed seeds; T₃: Zn + Non-primed seeds; T₄: Zn + OC-primed seed; T₅: Positive control (normal seeds + soil inoculation with the FV only); T₆: FV + OC-primed seeds; T₇: FV + Zn + Non-primed seeds; T₈: FV + Zn + OC-primed seeds

Fig. 7.

Effect of Ochrobactrum ciceri (OC) and zinc (Zn) on germination of Zea mays under biotic stress of Fusarium verticillioides (FV). T₁: Negative control (normal seeds, without any treatment); T₂: OC-primed seeds; T₃: Zn + Non-primed seeds; T₄: Zn + OC-primed seed; T₅: Positive control (normal seeds + soil inoculation with the FV only); T₆: FV + OC-primed seeds; T₇: FV + Zn + Non-primed seeds; T₈: FV + Zn + OC-primed seeds

Fig. 8.

Effect of Ochrobactrumciceri (OC) and zinc (Zn) on the leaf attributes of Zea mays under biotic stress of Fusarium verticillioides (FV). T₁: Negative control (normal seeds, without any treatment); T₂: OC-primed seeds; T₃: Zn + Non-primed seeds; T₄: Zn + OC-primed seed; T₅: Positive control (normal seeds + soil inoculation with the FV only); T₆: FV + OC-primed seeds; T₇: FV + Zn + Non-primed seeds; T₈: FV + Zn + OC-primed seeds

Fig. 9.

Effect of Ochrobactrum ciceri (OC) and zinc (Zn) on growth attributes of Zea mays under biotic stress of Fusarium verticillioides (FV). T₁: Negative control (normal seeds, without any treatment); T₂: OC-primed seeds; T₃: Zn + Non-primed seeds; T₄: Zn + OC-primed seed; T₅: Positive control (normal seeds + soil inoculation with the FV only); T₆: FV + OC-primed seeds; T₇: FV + Zn + Non-primed seeds; T₈: FV + Zn + OC-primed seeds

The presence of the pathogen in T₅ led to a decrease in germination percentage, the number of nodes per plant, and the number of leaves per plant, as well as reduction in the length, fresh weight, and dry weight of leaves, stems, and roots by 30–50% compared to T₁. To evaluate potential disease management treatments (T₆-T₈), their effects were assessed in comparison to T₅ and T₁. Generally, the stress induced by the pathogen was mitigated through the application of seed biopriming (T₆), basal Zn (T₇), and their combination (T₈) compared to T₅ (Figs. 6, 7, 8, 9). However, plants in T₅-T₈ that were exposed to the pathogen (FV) exhibited smaller size and chlorosis compared to the other four treatments (T₁-T₄) (Fig. 6).

Therefore, employing OC as a seed priming agent in soil inoculated with pathogens (T₆) resulted in a significant boost in the germination rate, the number of leaves per plant, as well as the length and dry weight of leaves, stems, and roots, showing an increase of 25–50% compared to T₅. Similarly, the application of basal Zn at a concentration of 2.5 mg Kg⁻¹ in T₇ demonstrated comparable effects to T₆, with improvements ranging from 20 to 60% across the studied attributes over the positive control (T₅). Though, the most noteworthy outcomes were observed when primed seeds were sown in soil with Zn (T₈). This treatment substantially enhanced all physical traits of plant growth, surpassing the effects of T₅, T₆, and T₇. Consequently, the germination rate increased to 100%, while the other twelve traits related to plant growth showed significant improvements ranging from 40 to 100% compared to T₅. In many instances, the values of these investigated traits were statistically on par with those of T₁ (Figs. 6, 7, 8, 9).

Biochemistry and histopathology

Though, the pathogen infection (T₅) significantly decreased the total chlorophyll content (TCC), carotenoids (CC), total protein content (TPC), and the activity of PPO by 30–40%, while enhanced the activities of CAT and POX by 100% and 50%, respectively, compared to the T₁. Application of seed bioprimining, basal Zn and their combination impart a positive outcome on the plant biochemical traits either in the presence or absence of the pathogen. There was 30–60% enhancement in all these biochemical attributes in T₂, T₃, and T₄, compared to T₁. So far, the treatments inoculated with the pathogen (T₆-T₈) also exhibited at par values of TCC, CC, and TPC as were observed in T₂-T₄, while higher values of CAT, POX, and PPO, with PPO activity were noticed in T₆-T₈ showing a substantial increase of 150–200% compared to other attributes (Table 4).

Table 4.

Effect of Ochrobactrum ciceri (OC) and zinc (Zn) on physiological and biochemical assays of maize under stress of Fusarium rot caused by Fusarium verticillioides (FV)

Treatments	(mg g−1)			(U min−1 mg−1 protein)
	Total chlorophyll content	Carotenoids	Total protein content	Peroxidase	Catalase	Polyphenol oxidase
T1: Negative control	26.43 cd	9.89 b	10.57 bc	4.28 c	1.13 d	1.33 c
T2: OC-primed seeds	31.70 a	11.10 a	13.62 ab	4.44 c	1.89 cd	2.01 ab
T3: Zn + Non-primed seeds	29.53 b	11.27 a	12.01 ab	4.79 c	2.11 c	2.17 ab
T4: Zn + Non-primed seeds	32.01 a	11.12 a	14.97 a	4.55 c	2.71 b	2.85 a
T5: Positive control (FV only)	17.57 e	7.31 c	7.96 d	6.14 b	2.10 c	0.82 d
T6: FV + OC-primed seeds	25.33 d	10.18 b	12.43 a-c	7.47 a	3.25 a	2.10 ab
T7:FV + Zn + Non-primed seeds	26.11 cd	11.12 a	10.12 c	7.23 a	3.22 a	2.17 ab
T8: FV + Zn + OC-primed seeds	27.94 c	10.86 ab	13.24 ab	7.65 a	3.77 a	2.76 a

The letters in each column show a significant difference (p ≤ 0.05) as determined by the LSD test (n = 3)

Examining anatomical changes in maize stem sections using various stains that can identify defense-related biochemicals revealed several features. A single-layered epidermis and hypodermis were observed, vascular bundles were completely surrounded by a sheath of sclerenchyma cells, and there was no observed cambium. The vascular bundles were of the closed type, and in the center of the stem, ground tissues composed of parenchyma cells were present. The xylem formed a V-shaped structure with narrow protoxylem at the base and larger metaxylem elements on the tips of the arms of the V, while the phloem was located between the arms of the V-shaped xylem (Figs. 10, 11, 12).

Fig. 10.

Transverse sections of maize stem stained with ferric chloride for observation of phenol due to the effect of Fusarium verticillioides (FV), Ochrobactrum ciceri (OC) and zinc (Zn). Vb: Vascular bundle; Xy: Xylem; Ph: Phloem; PdVb: Phenol deposition in vascular bundle; PdC: Phenol deposition in cell. T₁: Negative control (normal seeds, without any treatment); T₂: OC-primed seeds; T₃: Zn + Non-primed seeds; T₄: Zn + OC-primed seed; T₅: Positive control (normal seeds + soil inoculation with the FV only); T₆: FV + OC-primed seeds; T₇: FV + Zn + Non-primed seeds; T₈: FV + Zn + OC-primed seeds

Fig. 11.

Transverse sections of maize stem stained with phloroglucinol for observation of lignin due to the effect of Fusarium verticillioides (FV), Ochrobactrum ciceri (OC) and zinc (Zn). Ep: Epidermis; Hyp: Hypodermis; Vb: Vascular bundle; Xy: Xylem; Ph: Phloem; G: gel; Ld: lignin deposition. T₁: Negative control (normal seeds, without any treatment); T₂: OC-primed seeds; T₃: Zn + Non-primed seeds; T₄: Zn + OC-primed seed; T₅: Positive control (normal seeds + soil inoculation with the FV only); T₆: FV + OC-primed seeds; T₇: FV + Zn + Non-primed seeds; T₈: FV + Zn + OC-primed seeds

Fig. 12.

Transverse sections of maize stem stained with iodine for observation of starch grains (SG) due to the effect of Fusarium verticillioides (FV), Ochrobactrumciceri (OC) and zinc (Zn). T₁: Negative control (normal seeds, without any treatment); T₂: OC-primed seeds; T₃: Zn + Non-primed seeds; T₄: Zn + OC-primed seed; T₅: Positive control (normal seeds + soil inoculation with the FV only); T₆: FV + OC-primed seeds; T₇: FV + Zn + Non-primed seeds; T₈: FV + Zn + OC-primed seeds

Staining with ferric chloride indicated that cell wall and cell lumen were heavily deposited with phenolic compounds in the positive control (T₅) compared to the negative control (T₁). The treatments with OC-primed seeds (T₂, T₄, T₆, and T₈) showed a greater disposition of phenolics and gel (Fig. 10). Lignin deposition, observed by staining with phloroglucinol-HCl (Wiesner) reagent, showed heavy deposition in xylem and sclerenchyma cells in all treatments infected with the pathogen (T₅-T₈) compared to treatments without the pathogen (T₁-T₄). Pink staining indicated the presence of syringil and p-hydroxycinnamyl aldehyde in T₂-T₄ (Fig. 11). Iodine staining revealed that the positive control (T₅) had an intense amount of starch granules around vascular bundles and in parenchymatous cells compared to the negative control (T₁). Abundance of starch granules was also observed in T₂ and T₆ compared to other treatments (Fig. 12).

Principle component analysis

Principal component analysis was employed to explore potential correlations among the investigated attributes of the plants. The PCA analyses accounted for more than 90% of the total variance. Notably, T₈ (Zn + OC-primed seed) emerged as the most effective in enhancing the plant's physical traits. This treatment (T₈ ) exhibited a significant correlation with T₁, primarily attributed to its plant growth-promoting traits. Moreover, a high correlation was observed among all growth traits and with treatments situated near the origin (T₁, T₂, T₃, and T₈). The findings suggested that OC-primed seeds in Zn amended soil present the most promising treatment for disease management and improvement of plant growth traits (Fig. 13).

Fig. 13.

Principle component analysis for the effect of Ochrobactrum ciceri (OC) and zinc (Zn) on different attributes of Zea mays under biotic stress of Fusarium. verticillioides (FV). T₁: Negative control (normal seeds, without any treatment); T₂: OC-primed seeds; T₃: Zn + Non-primed seeds; T₄: Zn + OC-primed seed; T₅: Positive control (normal seeds + soil inoculation with the FV only); T₆: FV + OC-primed seeds; T₇: FV + Zn + Non-primed seeds; T₈: FV + Zn + OC-primed seeds

Discussion

Corn rot, a severe plant disease caused by fungus F. verticilloides, poses a significant threat to crops globally (Czembor et al. 2019). A strategic approach to prevent and control fungal diseases involves the use of antagonistic bacteria through seed priming. Additionally, the effectiveness of biocontrol agents can be enhanced by combining them with basal Zn (Shoaib et al. 2021). This study aims to evaluate the in vitro antifungal potential of rhizobacteria and Zn against the growth and morphology of the maize corn rot pathogen. Furthermore, the study investigated the in vivo disease management potential of basal Zn and primed seeds, analyzing their impact on morpho-growth, physio-chemical, and anatomical traits in maize plants.

Identification and pathogenicity of the pathogen

The fungus was isolated from the infected corn and was identified through micro and macroscopic characteristics as F. verticilloides. White fungal hyphae exhibited abundant sporulation, hence producing septated, oval to kidney-shaped microconidia, 5–measuring 10 × 2.1–2.9 μm, while septate and falcate macrocondia measuring 20–37 × 2.2–3.1 μm in size. This is in accordance with the identification of F. verticilloides isolated from the infected maize seeds made previously (Leslie and Summerell 2006; Pelizza et al. 2011; Gagkaeva and Yli-Mattila 2020; Sebayang et al. 2021). ITS-based identification has been established as an authentic tool for the identification of Fusarium). In the present study, the ITS-based region also confirmed the identification of isolated species from the infected maize seeds as F. verticillioides (OP735521), and showed its 100% similarity to OP020562 and KJ765860, while 98.88% similarity with ON949921.1 available in GenBank. Pathogenicity test revealed F. verticillioides as a virulent pathogen contaminating maize kernels (Blacutt et al. 2018a, b).

In vitro bioassays

Results revealed that the growth of F. verticillioides was significantly inhibited in dual culture assays inoculated with O. ciceri by 81% and 88% on the un-amended and Zn-amended growth medium, respectively, as compared to the control. The cell pellet and culture filtrate of the fungus were also found equally inhibitory for the fungal growth. However, the antifungal potential of either cell pellet or bacterial metabolite was significantly enhanced in the presence of Zn. The growth inhibition was accompanied by discoloring, distorting, fragmented fungal hyphae, macro- and microconidia, though fungal structures were drastically distorted due to the antifungal action of O. ciceri on Zn-amended MEA. The antifungal potential of O. ciceri might be associated with its remarkable capability to produce broad-spectrum antimicrobial compounds including hydrogen cyanide, hydrogen sulfide and ammonia (Imran et al. 2019). Antifungal action might also be associated with the ability of O. ciceri to secrete low molecular weight organic acids (e.g. gluconic, 2-ketogluconic, 5-ketogluconic, acetic, citric, oxalic, malic and succinic acid) during phosphate and Zn solubilization (Abraham and Silambarasan 2016). Moreover, the hyphal density and sporulation decreased by the antifungal action of Zn in the Zn-amended-medium (without O. ciceri) and the fungal growth was not affected significantly. The antifungal action of Zn has been reported earlier by Shoaib et al. (2020, 2022). Accordingly, the growth and physiology of Alternaria alternata (leaf spot in chili) and Macrophomina phaseolina (charcoal rot in mungbean) were inhibited by higher doses of ZnSO₄ (> 8.50 mM) in the growth medium. Presently, the growth medium was amended with 2.5 ppm of Zn (0.0154 mM), which may not be sufficient amount to inhibit F. verticillioides. Therefore, it is plausible to assume that the greater inhibition in the growth of fungus may be combined effect of O. ciceri and Zn, as the bacteria besides acting as antifungal agent also solubilizing Zn in the Zn-amended medium, increase its availability to act as an antifungal agent.

The F. verticillioides did not produce pigment in control, and in Zn-amended plates (without O. ciceri), which may show the inessentiality of pigment for pathogenicity as well as for virulence/aggressiveness factor, and pigmentation production was described as independent of growth of cultures on different media and pathogenicity assays (Deepa et al. 2018). Nevertheless, a considerable amount of pigment was produced by the fungus in the presence O. ciceri, which was reduced to a lesser extent on a Zn-amended medium inoculated with O. ciceri, which might be attributed to activation of the self-defense mechanism of the fungus in the presence of competing or invading microbes (Venkatesh and Keller 2019). The results are in accordance with the previous findings, where F. verticillioides produced pigmentations (toxins) against the antibiosis effect of Pseudomonas protegens (Quecine et al. 2016). Hence, in vitro assays revealed that O. ciceri was most effective in affecting fungal growth parameters and toxin production in the presence of Zn.

In planta bioassays

The maize plants in T₁-T₄ (without pathogen) were healthy and asymptomatic, whereas the plants grown in F. verticillioides-infested soil (T₅-T₈) were smaller and chlorotic, and the stem appeared to be healthy. These results are consistent with previous findings on maize plants infected by F. verticillioides, where contaminated seeds developed no symptoms after germination but already carry endophytic infection (Kant et al. 2017; Blacutt et al. 2018a, b). Presently, the results on growth assays of the maize plant further provided evidence of systemic fungal invasion from seeds to roots as the length and biomass of roots were decreased considerably by 40–50%, and the rest of the growth attributes of the shoot, leaves, and nodes were reduced by 20–50% in T₅ as compared to T₁ (Stagnati et al. 2019).

Generally, the seed priming with O. ciceri and soil application with Zn either alone or in combination significantly enhanced the growth attributes of maize plants under both conditions (with or without pathogen). Nevertheless, the combined effect of O. ciceri and Zn was found to be the most promising treatment. Therefore, the growth attributes including leaf area, leaf dry weight, length, and biomass of stem and root increased significantly by 30–50%, 20–40%, and 30–60% in T₂ (O. ciceri), T₃ (Zn) and T₄ (Zn + O. ciceri), respectively, compared to T₁ (negative control)_. Furthermore, the application of O. ciceri as seed priming in pathogen-inoculated soil (T₆) significantly enhanced the different growth attributes up to 40% compared to T₅. Likewise, soil application with Zn (2.5 mg Kg⁻¹) also exhibited statistically at par values to T₆ for the attributes of leaf and nodes, while the attributes of shoot and roots improved more profoundly by 50%. Even so, sowing of bio-primed seeds in Zn-amended soil enhanced all physical traits of the plant up to 50–100% as compared to T₅. In many previous studies, the production of indole acetic acid has been associated with an increase in plant biomass and nutrient uptake in maize plants (Lobo et al. 2019). Kuan et al. (2016) reported an increase in maize crop yield due to the positive effect of PGPR in the mobilization of nitrogen. Bacterial antagonists (Bacillus, Pseudomonas, and Paenibacillus) were also found promising agents for stimulating plant growth and managing F. verticillioides control in maize by producing hydrolytic enzymes, increasing phosphorus uptake in plants, creating limiting iron conditions in the rhizosphere for the pathogen (López et al. 2016; Diniz et al. 2022). Priyanka and Sevugapperuma (2018) also documented over 70% suppression in Botrytis leaf blight with an increase in the expression of defense-related genes (phenylalanine ammonia-lyase and ascorbate peroxidase) due to the effect antifungal metabolites of O. ciceri.

Growth enhancement and disease management due to the basal application of Zn could be ascribed to increased resistance of the plants to disease due to the induction of resistance in the host and the protective effect of Zn on root cell membrane integrity (Alsamir et al. 2020). Joint additive or synergic effects between Zn and other soil nutrients may also be responsible for correcting deficiencies in plants and for improving cellular integrity in maize (Shoaib et al. 2022).

The maximum benefit obtained with the combined application of O. ciceri and Zn may be associated with improved soil health and plant nutritional status (Ullah et al. 2022). In Zn + O. ciceri, Zn may also be a factor to induce the production of antimicrobial compounds in O. ciceri (Khan et al. 2018), thus Zn may provide better plant-bacterial interactions, while bacteria by solubilizing Zn increase its availability to the plants. Previous reports also indicated basal Zn (2.5 or 5 mg Kg⁻¹) or basal Zn + biocontrol (seed priming) as an effective strategy for managing mungbean charcoal rot and tomato early blight and for obtaining a lucrative source of yield in the crop (Khan et al. 2018; Awan et al. 2019). Over and above, Shoaib et al. (2020), findings showed a combination of Zn (2.5 mg Kg⁻¹) and O. ciceri managed mungbean charcoal rot probably by developing efficient signal transduction in host cells, which may result in the biphasic accumulation of reactive oxygen species (ROS) and enhancing activities of defense-related enzymes responsible for phenols oxidation and suberization of host plant cells. Likewise, in the present study fungal infection in positive control interfered with plant biochemical traits by decreasing photosynthetic pigment (TCC and CR), total protein content (TPP), and activity of PPO, while improving the activity of CAT and POX (Shoaib et al. 2022). Seed priming with OC and basal Zn triggered plant defense mechanisms, hence boosting biochemical traits including TCC CR, TPP, and POX by 30–60%, while PPO activity by 150–200% over positive control (Awan et al. 2019). Nevertheless, high PPO activity might be responsible for creating toxic environment for the pathogen through the oxidation of endogenous phenolic compounds (Awan et al. 2019).

Histopathological analysis of the stem revealed intense deposition of lignin, phenols, and starch in cell walls and cell lumens of all treatments provided with the pathogen (T_5-T₈) compared to the treatment devoid of the pathogen (T_1-T₄). In plant cells, the excessive production of lignin, phenols, starch, and gel serves as a chemical and physical barrier that constitutes an activation mechanism and provides a defense to the plants against biotic stresses (Almeida et al. 2015). The accumulation of phenolics as indicated in black color due to staining with ferric chloride was in accordance with the earlier findings, where Colletotrichum acutatum infected citrus plants produced dark color after staining with ferric chloride. Greater accumulation of phenolics as well as in treatments provided with Zn and O. ciceri or both may provide evidence of the development of induced systemic resistance in the maize plants (Marques et al. 2015). Accumulation of phenolic substances has also been documented earlier by the action of biocontrol bacteria used in bio-priming at diverse growth phases of the plants (Dias et al. 2021).

Lignin deposition is a well-documented response to pathogenic challenges, as highlighted by Lee et al. (2019). Research indicates that modifications in lignin biosynthesis can lead to alterations in both the growth and defense mechanisms associated with secondary cell wall components, as demonstrated by Xie et al. (2018). In the context of pathogen infection, a pronounced accumulation of lignin, particularly guaiacyl lignin (evident as red-stained cells), was consistently observed across all treatment groups. Interestingly, variations in the abundance of syringyl and p-hydroxycinnamyl aldehyde (indicated by pink staining) were noted, with some treatments exhibiting a higher prevalence of these components. Similarly, Zúñiga et al. (2019) observed very heavy red coloration in almond plants infected with Polystigma amygdalinum compared to resistant plants. Deposition of lignin was associated with resistance in cotton to Verticillium dahlia (Xu et al. 2011) and flax to Sclerotinia sclerotiorum (Eynck et al. 2012). The deposition of lignin in infected cells may prevent the spread of toxins and enzymes of the pathogen into the host and at the same time also the transfer of water and nutrients from the host cells to the pathogen indeed, activate defense responses and facilitate the accumulation of stress-related proteins (Miedes et al. 2014; Lee et al. 2019).

The abundance of starch granules was also observed around the vascular bundles and in the parenchymatous cells of T₅ and T₆ as compared to other treatments. Under pathogen stress plant produces more starch granules as a reserve food as a defense response (Engelsdorf et al. 2017). Similarly, another study reported that banana plants form excessive starch grains to provide protection against black leaf streak disease (Saraiva et al. 2013).

Conclusions

F. verticillioides, identified as the fungal pathogen causing infection in corn, was confirmed through both morphological examination and sequencing of the internal transcribed spacer region of the ribosomal RNA gene. The pathogenicity assay established F. verticillioides as the agent responsible for seed and seedling infections in Z. mays. In laboratory conditions, the inhibitory capacity of O. ciceri exhibited significant enhancement in Zn-amended media. Further assessments involving various concentrations (25, 50, and 75%) of cell pellet and cultural filtrate of O. ciceri (with/without Zn), demonstrated a dose-dependent inhibitory effect on the mycelial growth of the pathogen. This effect resulted in discoloration, fragmentation, and complete disintegration of the fungus hyphae and spores, particularly at the 75% dose. In planta experiments revealed that biopriming maize seeds with O. ciceri effectively managed the disease, leading to notable improvements in growth and biochemical attributes. Additionally, there was an accelerated accumulation of lignin, polyphenols, and starch, particularly in the presence of basal Zn. Overall, the findings suggest that bioprimed seeds, coupled with Zn, represent a highly promising treatment for disease management and enhancement of plant growth traits through increased accumulation of lignin, polyphenols, and starch, respectively. The outcome of this study recommended that the utilization of bioprimed seeds in Zn amended soil (2.5 mg Kg⁻¹) for the management of Fusarium rot disease in maize caused by F. verticillioides.

Abbreviations

OC

O. ciceri

CP

Cell pellet

CF

Cultural filtrate

FV

F. verticillioides

hyp

Hyphae

Mc

Macroconidia

mc

Microconidia

ch

Chlamydospore

ch

Conidiophore

Ep

Epidermis

Hyp

Hypodermis

Vb

Vascular bundle

Xy

Xylem

Ph

Phloem

G

Gel

Ld

Lignin deposition

Author contributions

HSY performed experiments and collected data; AS designed experiment, analyzed data, wrote first draft and did supervision; AA reviewed the paper; SP and SD helped in conducting the experimental portion; and SM did supervision. All authors read and approved the final manuscript.

Declarations

Conflict of interest

Authors have no conflict of interest. All the authors/co-authors are well conversant for their participation for the completion of research work. All authors agree that author list is correct in its content and order and that no modification to the author list can be made without the formal approval of the Editor-in-Chief, and all authors accept that the Editor-in-Chief's decisions over acceptance or rejection or in the event of any breach of the Principles of Ethical Publishing in the Physiology and Molecular Biology of Plants”.