Abstract
The influences of TRIM28 on the gastric tumorigenesis together with potential molecular mechanisms remain to be studied. We aimed at exploring the important effects of TRIM28 on gastric cancer (GC) and uncovering underling molecular mechanisms. Through immunohistochemistry analysis of 20 pairs of GC and the peritumoral tissues, the expression level of TRIM28 was determined. A variety of assays were applied to explore the important roles of TRIM28 in GC. Western blotting and qRT-PCR analyses were used to analyze the association between TRIM28 and the Wnt/β-catenin signaling pathway. TRIM28 was highly expressed in GC tissues than peritumoral tissues. And high expression level of TRIM28 in GC was associated with good prognostic effects. In vitro functional assays suggested TRIM28 knockdown enhanced the proliferation and clone formation of GC cell. Moreover, TRIM28 knockdown enhanced the expression level of stemness markers, strengthened sphere-forming and drug-resistance properties of GC cells, suggesting important effect on GC cell stemness. Besides, our analysis showed that the Wnt/β-catenin signaling was involved in the effect of TRIM28 on GC cell stemness property, and blocking Wnt/β-catenin signaling pathway obviously rescued the promotion influence of TRIM28 knockdown. Overall, TRIM28 has an important influence on regulating the stem-like property of GC cell via Wnt/β-catenin signaling, suggesting TRIM28 a promising drug target and a potential predictor of prognosis.
Keywords: TRIM28, Wnt/β-catenin, gastric cancer, CD44, stemness, cancer progression
Impact statement
In our work, we explored the effects of TRIM28 on gastric cancer (GC) stemness. And we found that TRIM28 knockdown promoted GC cell stem-like characteristics. Mechanistically, we illustrated that TRIM28 knockdown activated the Wnt/β-catenin signaling pathways. Our work makes contributions to elucidating the cellular mechanisms of GC development and identifying implicated-genes and associated driver mutations.
Introduction
As the fifth most frequent cancer and the fourth leading cause of tumor-associated deaths worldwide 1 , GC has a 33% five-year survival rate 2 . Although much effort has been put forth to improve prevention and treatment so as to reduce GC morbidity and mortality. Nevertheless, the outcomes of GC patients is unfavorable because its high metastasis and recurrence. Hence, exploring the underling mechanisms of GC development and identifying implicated-genes are in the emerging world today.
Because of its self-renewing capacity, cancer stem cells (CSCs) play important roles in progression, recurrence, and survival of malignancy 3 . Previous investigations have indicated that CSCs had profound influence on the development of GC 4 . Therefore, therapies targeting the CSCs may become potential strategies of advanced GC in the near future.
Tripartite motif containing 28 (TRIM28), also named as KAP1or TIF1β, belongs to the TRIM family 5 . In a stem cell model, TRIM28 is important for maintaining the pluripotent state 6 . Moreover, TRIM28-null mice die before the process of gastrulation 7 . Moreover, TRIM28 is significant for mouse embryonic stem cells differentiation8, 9 . However, TRIM28 has also been reported to antagonize adult erythrocytes differentiation 10 . Similar paradoxical effects of TRIM28 have also been observed in cancer. Through downregulating the p53 expression in lung cancer, TRIM28 plays oncogenic roles 11 . However, TRIM28 also inhibits proliferation of lung cancer cells through downregulating E2F family members that is important for cell proliferation 12 . Previous studies indicate an oncogenic effect of TRIM28 on human GC 13 . Results from that study showed that high mRNA expression level correlated with obviously decreased survival 13 . However, the results also showed reduced TRIM28 mRNA expression level among 1/3 of the GC tissues; unfortunately, this important observation was not further explored 13 . These results indicate that TRIM28 might also have complex influences on human GC. Nevertheless, the biological effects of TRIM28 on GC stemness have not been fully studied.
In the current work, the potential roles of TRIM28 may play in GC were further explored. We demonstrated high TRIM28 expression had good prognostic effect on GC. Knockdown of TRIM28 had a pivotal role in GC stemness and chemoresistance, in addition to promoting cell proliferation and clonogenicity. Mechanistically, TRIM28 knockdown promoted GC stemness through a novel modulative process on Wnt/β-catenin pathway.
Materials and methods
Tissue specimens and immunohistochemistry (IHC)
The IHC of the GC tissue microarry (HStmA020PG01, Outdo Biotech) was performed as previously reported 14 . And the IHC results were scored by an expert pathologist.
Kaplan-Meier Plotter database analysis
The Kaplan-Meier plotter, an online tool, was applied to determine the prognostic effect of TRIM28 on GC.
Cell culture
MKN28, HGC-27, BGC-823, and AGS are human GC cell lines, while GES-1 is a normal gastric cell line. To HGC-27, BGC-823, MKN28, and GES-1, they were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) 15 . While for AGS, it was grown in F-12K containing 10% FBS 16 .
Antibodies and reagents
Primary antibodies included anti-TRIM28 (ab22553) and anti-CD44 (ab189524) were purchased from Abcam, while anti-Nanog ( #4903T), anti-Sox2 ( #3579T), anti-Oct4 (#2840T), and anti-β-catenin (#8480) were purchased from Cell Signaling Technology. The 5-Fluorouracil (Fu) (ST1060) was from Beyotime Biotechnology. Stock solution of 5-Fu was prepared with dimethylsulfoxide (DMSO) at 25mg/mL. The Wnt/β-catenin inhibitor (KYA1797K) (S8327) was from Selleck. Stock solution of KYA1797K was prepared in dimethylsulfoxide (DMSO) at 25mM. KYA1797K could effectively degrade β-catenin at a concentration of 25µM (48 h). Negative control were cells treated with an equal volume of DMSO. Puromycin was purchased from MedChemExpress.
Viral transduction of cells
Lentiviral shRNA (GenePharma) was used to establish TRIM28-knockdown AGS cell lines. Lentiviral TRIM28 expression construct (GenePharma) was used to establish TRIM28-overexpressing HGC-27 cell line. The sequences of shRNA-1 and shRNA-2 was 5’-TAAGCACAGGTTTGGTCTCAG-3’ and 5’-TAAGAACTGGTACTGGTGGTC-3’. Stable TRIM28-knockdown (shTRIM28) or TRIM28-overexpressing (TRIM28) cells together with the corresponding controls were selected with puromycin (8μg/ml).
Quantitative real-time PCR (qRT-PCR)
The qRT-PCR was conducted as reported previously 14 . The primers for TRIM28, CD44, Nanog, Oct4, Sox2, β-catenin, MMP7, cylcin D1, and c-Myc were shown as Table 1. Notably, mRNA levels were all standardized to GAPDH.
Table 1.
Primer sequences.
| Primer | Sequence | |
|---|---|---|
| GAPDH | ATCAAGAAGGTGGTGAAGCA | AGACAACCTGGTCCTCAGTGT |
| TRIM28 | AAGGACCATACTGTGCGCTCTAC | ACGTTGCAATAGACAGTACGTTCAC |
| CD44 | TCCAGGCAACTCCTAGTAGT | CAGCTGTCCCTGTTGTCGAA |
| Nanog | AATACCTCAGCCTCCAGCAGATG | TGCGTCACACCATTGCTATTCTTC |
| Oct4 | CTTGCTGCAGAAGTGGGTGGAGGAA | CTGCAGTGTGGGTTTCGGGCA |
| Sox2 | AAATGGGAGGGGTGCAAAAGAGGAG | CAGCTGTCATTTGCTGTGGGTGATG |
| β-catenin | AAAGCGGCTGTTAGTCACTGG | CGAGTCATTGCATACTGTCCAT |
| MMP7 | GAGTGAGCTACAGTGGGAACA | CTATGACGCGGGAGTTTAACAT |
| cyclin D1 | CAATGACCCCGCACGATTTC | CATGGAGGGCGGATTGGAA |
| c-Myc | GTCAAGAGGCGAACACACAAC | TTGGACGGACAGGATGTATGC |
Western blotting analysis
The western blotting analysis was conducted as reported previously 14 . And the expression levels of TRIM28, CD44, Nanog, Oct4, Sox2, and β-catenin were determined through western blotting analysis and were normalized based on GAPDH. The membrane was blocked and incubated in the primary antibody, followed by incubating in the secondary antibody.
CCK-8 assay
2000 GC cells were plated into the 96-well plates for determining GC cell viability based on the CCK-8 kit (Beyotime Biotechnology).
EdU proliferation assay
Staining of EdU was performed according to the specific protocols (RIBOBIO) and images from three fields were acquired. Then, the EdU-positive and total cells were counted with ImageJ to calculate the EdU-positive cell proportion.
Colony-formation assay
Six-well plates were plated with 1000 GC cells/well. When observable colonies formed, the GC cells were treated as previously reported 17 , and counted by using ImageJ.
Tumorsphere-formation assay
The steps of tumorsphere-formation experiment were as follows18, 19 . The GC cells were seeded into the ultra-low-attachment plates with an appropriate density with the DMEM/F12 medium containing B27 supplement (2%), bFGF (10ng/mL), and EGF (20ng/mL). Seven days later, tumorspheres of 50μm or bigger in diameter were counted by using ImageJ.
Statistical analysis
Statistical analysis were conducted using GraphPad Prism 9.0. Comparison across multiple groups was carried out using one-way analysis of variance, while comparison between two groups was done using student’s t-tests (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).
Results
TRIM28 was upregulated in gastric cancer and indicated good prognosis
The gastric tissue microarrays contained 20 GC tissues and 20 peritumoral tissues and were applied to determine TRIM28 protein level. Results in Fig. 1A-B indicated that TRIM28 was highly expressed in GC tissues relative to the peritumoral tissues (P < 0.0001). Moreover, based on a publically available database (GSE62254), the association between TRIM28 level and patient survival were explored. The results showed that high TRIM28 expression was associated with better patient survival (Fig. 1C). Furthermore, high TRIM28 also correlated with first progression survival (Fig. 1D) or post progression survival (Fig. 1E). All the aforementioned results indicated that TRIM28 could have a tumor suppressor influence on GC development.
Figure 1.
TRIM28 was upregulated in human GC tissues and related to good prognosis of GC. A IHC images of GC and corresponding peritumoral tissues of tissue microarrays. B IHC scores of GC tissue microarrays.C-E Kaplan-Meier Plotter analysis displayed that the overall survival (P = 0.0011, C), first progression survival (P = 0.023, D), and post progression survival (P = 0.0021, E) rates of high TRIM28 expression group were obviously higher compared with that of the low expression group. *P < 0.05, **P < 0.01, ****P < 0.0001.
TRIM28 knockdown promoted GC cell proliferation and clonogenicity
The finding that high TRIM28 level was positively related to GC good prognosis indicated that TRIM28 could play an anti-proliferative effect. And to test this hypothesis, we determined TRIM28 mRNA level in four GC cells (MKN28, HGC-27, BGC-823, and AGS) and GES-1. TRIM28 was found to be obviously upregulated in AGS cells in comparison with that in the GES-1 cell (Fig. 2A). According to the baseline levels of TRIM28, the AGS cell line with the highest levels of TRIM28 was chosen to construct TRIM28-knockdown cell line. While the HGC-27 GC cell line with the lowest levels of TRIM28 was chosen to generate TRIM28-overexpression cell line. Both qRT-PCR and western blotting assays were used to determine the efficiencies of knockdown together with overexpression (Fig. 2B-C). The knockdown efficiency of shRNA1 was higher than shRNA2 and was selected for the subsequent experiments (termed shTRIM28). The CCK8 assays showed that TRIM28 knockdown in AGS cells displayed enhanced cell proliferation (Fig. 2D), whereas TRIM28-overexpressing HGC-27 cells showed significantly decreased proliferation (Fig. 2E). The EdU proliferation assay showed that TRIM28 knockdown increased EdU incorporation in AGS cells, while TRIM28 overexpression decreased EdU incorporation in HGC-27 cells (Fig. 3A-B). Similarly, the colony-forming assays showed that TRIM28 knockdown in AGS cells exhibited a significantly higher number of colonies than control cells, whereas TRIM28-overexpressing HGC-27 cells showed significantly decreased colonies (Fig. 3C-D).
Figure 2.
TRIM28 knockdown promoted GC cell proliferation. A The baseline mRNA level of TRIM28 in GES-1 and GC cells. B-C The efficiencies of TRIM28 knockdown in AGS cells (B) and overexpression within HGC-27 cells (C). D-E CCK8 experiments showed TRIM28 knockdown increased cell viability in AGS cells and overexpression of TRIM28 within HGC-27 cells suppressed cell viability. *P < 0.05, **P < 0.01, ****P < 0.0001.
Figure 3.
TRIM28 knockdown promoted EdU incorporation and clonogenicity of GC cells. A-B EdU assays demonstrated that knockdown of TRIM28 facilitated EdU incorporation in AGS cells and overexpression of TRIM28 within HGC-27 cells suppressed EdU incorporation. C-D Knockdown of TRIM28 increased cell clonogenicity in AGS cells and overexpression of TRIM28 within HGC-27 cells inhibited cell colony-forming . *P < 0.05, **P < 0.01, ****P < 0.0001.
TRIM28 knockdown promoted stemness and resistance to drugs in GC cells
We further examined TRIM28 expression on GC cell stemness and resistance to drugs. We observed that TRIM28 knockdown in AGS cells had a significant higher number of tumorspheres over seven days, whereas TRIM28-overexpressing HGC-27 cells showed significant decreased tumorspheres (Fig. 4A). Then, qRT-PCR showed that AGS-shTRIM28 cells had higher level of stemness markers (including CD44, Nanog, Oct4, and Sox2) compared with those in AGS-shNC cells (Fig. 4B). While HGC-27-TRIM28 cells displayed lower level of these stemness markers (Fig. 4C). The protein level of these stemness markers were further validated via western blot analysis. The results showed AGS-shTRIM28 and HGC-27-Vector cells had higher protein level of stemness markers compared with those in AGS-shNC and HGC-27-TRIM28 cells (Fig. 4D-E), which were consistent with the results of qRT-PCR. Besides, we found that low levels of TRIM28 in AGS cell line increased resistance to 5-Fu (Fig. 4F), a commonly used chemotherapeutic drug for GC. While high levels of TRIM28 in HGC-27 cell line decreased resistance to 5-Fu (Fig. 4G). Thus, we revealed that TRIM28 downregulation promoted GC stemness and resistance to drugs.
Figure 4.
TRIM28 knockdown upregulated GC cell stemness, and resistance to drugs. A GC cell stemness was upregulated by TRIM28 knockdown within AGS cell line but decreased via TRIM28 overexpression within HGC-27 cell line. B-C The qRT-PCR analysis for expression of stem cell markers in TRIM28-knockdown AGS cells and cell control, together with in TRIM28-overexpressing HGC-27 cells and cell control. D-E Protein level of stemness markers within TRIM28-knockdown AGS cells and cell control, together with in TRIM28-overexpressing HGC-27 cells and normal control. F TRIM28-knockdown AGS cells showed significantly lower sensitivity to 5-Fluorouracil (Fu) than control cells. G TRIM28-overexpressing HGC-27 cells showed significantly highly sensitivity to 5-Fu than control cells. *P < 0.05, **P < 0.01, ***P < 0.001.
TRIM28 knockdown promoted stemness via the Wnt/β-catenin pathway
During GC progression, the Wnt/β-catenin signaling pathway is shown to be important for the maintenance of GC cell stemness. Hence, we determined whether TRIM28 knockdown activated Wnt/β-catenin signaling pathway to promote GC cell stemness. Through the western blotting experiment, the β-catenin protein in TRIM28-knockdown or TRIM28-overexpressing cells were respectively determined. Fig. 5A showed that TRIM28 downregulation elevated total β-catenin protein levels in AGS cell lines. While, overexpression of TRIM28 suppressed the protein level of β-catenin within HGC-27 cell lines. Consistent with the results of western blotting assays, the mRNA expression of β-catenin was significantly increased upon TRIM28 knockdown in AGS cells and were decreased after TRIM28 overexpression in HGC-27 cells, (Fig. 5B-C). Similarly, the mRNA expression of MMP7, c-Myc, and cyclin D1, which were downstream target genes of β-catenin, were significantly increased upon TRIM28 knockdown and were decreased after TRIM28 overexpression (Fig. 5B-C).
Figure 5.
Effects of TRIM28 knockdown on cancer stemness are mediated by the Wnt/β-catenin signaling. A β-catenin protein within TRIM28-knockdown AGS cells and normal control, as well as in TRIM28-overexpressing HGC-27 cells and normal control. B-C qRT-PCR analysis for expression of β-catenin, MMP7, cyclin D1, and c-Myc. D Sphere formation assay in TRIM28-knockdown AGS cells and normal control with or without exposure to KYA1797K. E β-catenin and CD44 expression within TRIM28-knockdown AGS cell line and normal control with or without incubation with KYA1797K. F qRT-PCR analysis of β-catenin, MMP7, cyclin D1, c-Myc, CD44, Nanog, Sox2, and Oct4 in TRIM28-knockdown AGS cells and normal control with or without incubation with KYA1797K. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
To further confirm that the GC cell stemness enhanced by TRIM28 knockdown was through activating the Wnt/β-catenin signaling pathway. KYA1797K, an inhibitor against Wnt/β-catenin pathway, was used for rescuing the roles of TRIM28 knockdown in stemness and found that KYA1797K was able to rescue the effects of TRIM28 knockdown using the sphere assay (Fig. 5D), consistent with the western blot and qPCR analyses in AGS cells (Fig. 5E-F). Our findings suggest that TRIM28 regulates cancer stemness through Wnt/β-catenin pathway.
Discussion
We have explored the important influence of TRIM28 on cancer for over 20 years. However, it is hard to unambiguously conclude whether TRIM28 is an oncogenic agent or tumor suppressor because the effect of TRIM28 on cancer is complicated. Several studies indicate that TRIM28 may play oncogenic roles when it is overexpressed in tumor, which might advance tumor growth and metastasis via promoting EMT 20 , mediating metabolic switch in stressed conditions 21 , regulating the activity or stability of p53 or other proteins11,22,23 which corporately enable tumor cells to smoothly across the cell cycle even when the genome includes many errors. However, for certain tumor cells, TRIM28 downregulate pro-apoptotic genes, indicating that TRIM28 also promotes cancer cell survival12,24,25.
We investigated the crucial influence of TRIM28 on GC progression and its potential molecular mechanisms. TRIM28 was highly expressed in GC, and its elevated expression level was related to increased overall survival. This finding was in accordance with several investigations that showed TRIM28 was highly expressed in tumor tissue relative to the peritumoral tissues. Besides promoting the proliferation rate of GC cells, TRIM28 knockdown was especially found to facilitate pluripotent phenotype through the activation of Wnt/β-catenin signaling. In all, our results strongly indicated that TRIM28 may paly anti-tumor effects on GC cells.
Growing evidence has suggested the significant influence of Wnt/β-catenin signaling on maintaining tumor stemness property, which is considered as emerging hallmarks of cancer. A large number of papers have indicated that β-catenin level and its activity are associated with GC stemness. SNHG11 resulted in GSK-3β ubiquitination and activated the Wnt/β-catenin signaling, which facilitated GC stemness 26 . In GC, RORβ downregulates the cell stemness through antagonizing the Wnt/β-catenin pathway 27 . MARCH1 facilitates GC growth and promotes the GC cell stem-like characteristics via activating the Wnt/β-catenin signaling pathway 28 . It is worth noting that upregulating the activation of β-catenin might be potential models for investigating the cellular mechanism of GC and evaluating anti-tumor targeting drugs. Therefore, antagonizing the β-catenin activity by TRIM28 could play an anti-tumor role.
Our results suggested that TRIM28 was overexpressed in primary GC and its high protein level was associated with favorable prognosis. Moreover, in addition to facilitating GC cell proliferation and clonogenicity, TRIM28 knockdown was found to be a key modulator of GC cell stemness through activating Wnt/β-catenin signaling pathway. These results strongly indicated that TRIM28 could be prognostic factor for GC and it might have a tumor suppressing role in GC cells. Further study is clearly warranted for the molecular mechanisms involving TRIM28 overexpression in GC, especially the target with which it interacts when regulating cancer cell biological function. Hence, our research provides obvious elucidation to the molecular mechanisms through which TRIM28 partnered in cancer cell stem-like characteristics, at least with respect to GC, and TRIM28 provides new perspectives for research.
Footnotes
Authors’ contributions: S.Z. and M.L. designed the research and revised the manuscript. T.N. and M.Z. carried out the experiment and data analysis, and prepared the draft. Z.W., N.Z. partially conducted the IHC experiments. S.Z. partially revised the manuscript.
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Capital Health Development Research Fund (No. 2020-1-2023), and Young Scientists Fund of the National Natural Science Foundation of China (grant number 82100592).
ORCID iDS: Nan Zhang 
https://orcid.org/0000-0002-3353-2359
Shengtao Zhu
https://orcid.org/0000-0002-2795-8943
References
- 1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA: a cancer journal for clinicians 2021;71:209–49 [DOI] [PubMed] [Google Scholar]
- 2. Siegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics, 2023. CA: a cancer journal for clinicians 2023;73:17–48 [DOI] [PubMed] [Google Scholar]
- 3. Batlle E, Clevers H. Cancer stem cells revisited. Nature medicine 2017;23:1124–34 [DOI] [PubMed] [Google Scholar]
- 4. Sun L, Huang C, Zhu M, Guo S, Gao Q, Wang Q, Chen B, Li R, Zhao Y, Wang M, Chen Z, Shen B, Zhu W. Gastric cancer mesenchymal stem cells regulate PD-L1-CTCF enhancing cancer stem cell-like properties and tumorigenesis. Theranostics 2020;10:11950–62 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Jaworska AM, Wlodarczyk NA, Mackiewicz A, Czerwinska P. The role of TRIM family proteins in the regulation of cancer stem cell self-renewal. Stem cells 2020;38:165–73 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Hu G, Kim J, Xu Q, Leng Y, Orkin SH, Elledge SJ. A genome-wide RNAi screen identifies a new transcriptional module required for self-renewal. Genes & development 2009;23:837–48 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Cammas F, Mark M, Dolle P, Dierich A, Chambon P, Losson R. Mice lacking the transcriptional corepressor TIF1beta are defective in early postimplantation development. Development 2000;127:2955–63 [DOI] [PubMed] [Google Scholar]
- 8. Cammas F, Oulad-Abdelghani M, Vonesch JL, Huss-Garcia Y, Chambon P, Losson R. Cell differentiation induces TIF1beta association with centromeric heterochromatin via an HP1 interaction. Journal of cell science 2002;115:3439–48 [DOI] [PubMed] [Google Scholar]
- 9. Cammas F, Herzog M, Lerouge T, Chambon P, Losson R. Association of the transcriptional corepressor TIF1beta with heterochromatin protein 1 (HP1): an essential role for progression through differentiation. Genes & development 2004;18:2147–60 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Nakamura Y, Yamagata T, Maki K, Sasaki K, Kitabayashi I, Mitani K. TEL/ETV6 binds to corepressor KAP1 via the HLH domain. International journal of hematology 2006;84:377–80 [DOI] [PubMed] [Google Scholar]
- 11. Jin JO, Lee GD, Nam SH, Lee TH, Kang DH, Yun JK, Lee PC. Sequential ubiquitination of p53 by TRIM28, RLIM, and MDM2 in lung tumorigenesis. Cell death and differentiation 2021;28:1790–803 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Chen L, Chen DT, Kurtyka C, Rawal B, Fulp WJ, Haura EB, Cress WD. Tripartite motif containing 28 (Trim28) can regulate cell proliferation by bridging HDAC1/E2F interactions. The Journal of biological chemistry 2012;287:40106–18 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Yokoe T, Toiyama Y, Okugawa Y, Tanaka K, Ohi M, Inoue Y, Mohri Y, Miki C, Kusunoki M. KAP1 is associated with peritoneal carcinomatosis in gastric cancer. Annals of surgical oncology 2010;17:821–8 [DOI] [PubMed] [Google Scholar]
- 14. Liu S, Jiang H, Min L, Ning T, Xu J, Wang T, Wang X, Zhang Q, Cao R, Zhang S, Zhu S. Lysophosphatidic acid mediated PI3K/Akt activation contributed to esophageal squamous cell cancer progression. Carcinogenesis 2021;42:611–20 [DOI] [PubMed] [Google Scholar]
- 15. Zhang Y, Kang M, Zhang B, Meng F, Song J, Kaneko H, Shimamoto F, Tang B. M(6)A modification-mediated CBX8 induction regulates stemness and chemosensitivity of colon cancer via upregulation of LGR5. Molecular cancer 2019;18:185. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 16. Ivanov DP, Parker TL, Walker DA, Alexander C, Ashford MB, Gellert PR, Garnett MC. Multiplexing spheroid volume, resazurin and acid phosphatase viability assays for high-throughput screening of tumour spheroids and stem cell neurospheres. PloS one 2014;9:e103817 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Zhang N, Liu S, Xu J, Ning T, Xie S, Min L, Zhu S, Zhang S, Zhu S. PGM3 regulates beta-catenin activity to promote colorectal cancer cell progression. Experimental biology and medicine 2022;247:1518–28 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Gao Y, Li J, Xi H, Cui J, Zhang K, Zhang J, Zhang Y, Xu W, Liang W, Zhuang Z, Wang P, Qiao Z, Wei B, Chen L. Stearoyl-CoA-desaturase-1 regulates gastric cancer stem-like properties and promotes tumour metastasis via Hippo/YAP pathway. British journal of cancer 2020;122:1837–47 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Yang T, Shu X, Zhang HW, Sun LX, Yu L, Liu J, Sun LC, Yang ZH, Ran YL. Enolase 1 regulates stem cell-like properties in gastric cancer cells by stimulating glycolysis. Cell death & disease 2020;11:870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Chen L, Munoz-Antonia T, Cress WD. Trim28 contributes to EMT via regulation of E-cadherin and N-cadherin in lung cancer cell lines. PloS one 2014;9:e101040 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Pineda CT, Potts PR. Oncogenic MAGEA-TRIM28 ubiquitin ligase downregulates autophagy by ubiquitinating and degrading AMPK in cancer. Autophagy 2015;11:844–6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Cui J, Hu J, Ye Z, Fan Y, Li Y, Wang G, Wang L, Wang Z. TRIM28 protects CARM1 from proteasome-mediated degradation to prevent colorectal cancer metastasis. Science bulletin 2019;64:986–97 [DOI] [PubMed] [Google Scholar]
- 23. Jin X, Pan Y, Wang L, Zhang L, Ravichandran R, Potts PR, Jiang J, Wu H, Huang H. MAGE-TRIM28 complex promotes the Warburg effect and hepatocellular carcinoma progression by targeting FBP1 for degradation. Oncogenesis 2017;6:e312 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Tian C, Xing G, Xie P, Lu K, Nie J, Wang J, Li L, Gao M, Zhang L, He F. KRAB-type zinc-finger protein Apak specifically regulates p53-dependent apoptosis. Nature cell biology 2009;11:580–91 [DOI] [PubMed] [Google Scholar]
- 25. Li X, Lee YK, Jeng JC, Yen Y, Schultz DC, Shih HM, Ann DK. Role for KAP1 serine 824 phosphorylation and sumoylation/desumoylation switch in regulating KAP1-mediated transcriptional repression. The Journal of biological chemistry 2007;282:36177–89 [DOI] [PubMed] [Google Scholar]
- 26. Wu Q, Ma J, Wei J, Meng W, Wang Y, Shi M. lncRNA SNHG11 Promotes Gastric Cancer Progression by Activating the Wnt/beta-Catenin Pathway and Oncogenic Autophagy. Molecular therapy : the journal of the American Society of Gene Therapy 2021;29:1258–78 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Wen Z, Chen M, Guo W, Guo K, Du P, Fang Y, Gao M, Wang Q. RORbeta suppresses the stemness of gastric cancer cells by downregulating the activity of the Wnt signaling pathway. Oncology reports 2021;46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Liang W, Zhang T, Huo J, Yang J. MARCH1 promotes the growth and maintaining of stem cell-like characteristics of gastric cancer cells by activating the Wnt/beta-catenin signaling pathway. Tissue & cell 2022;78:101895. [DOI] [PubMed] [Google Scholar]