Enhancing in vitro regeneration via somatic embryogenesis and Fusarium wilt resistance of Egyptian cucumber (Cucumis sativus L.) cultivars

Abstract

Background

Somatic embryogenesis offers a reliable method for cucumber (Cucumis sativus L.) regeneration and genetic enhancement against Fusarium wilt. This study aimed to establish a tailored somatic embryogenesis system for Egyptian cultivars, fostering genetic improvements and Fusarium wilt-resistance lines.

Results

Employing the Optimal Arbitrary Design (OAD) approach, we optimized the induction medium, initiating prolific embryogenic calli (53.3 %) at 1 mg/L 2,4-D. The cotyledonary leaf (CL) was the preferred explant, showing 60 % embryogenic callus development. Bieth Alpha exhibited higher responsiveness, generating ∼ 18 somatic embryos per explant compared to Prince's ∼ 10. Somatic embryogenesis system validation used quantitative RT-PCR, showing Cucumis sativus splicing factor 3B subunit (CUS1) and an embryogenesis marker gene expression exclusively within embryogenic calli and mainly during embryogenesis initiation. Evaluating fungal toxin filtrate concentrations for selecting embryogenic calli, the S2 selection (25 % filtrate, four subculture cycles) was chosen for somatic embryo development. To gauge the ramifications of selection at the genetic stratum, an in-depth analysis was executed. A cluster analysis grounded in ISSR banding patterns revealed a distinct separation between in vivo-cultivated plants of the two cultivars and regenerated plants devoid of pathogen filtrate treatment or those regenerated post-filtrate treatment. This segregation distinctly underscores the discernible genetic impact of the selection process.

Conclusions

The highest embryogenic capacity (53.3%) was achieved in this study by optimizing the induction stage, which demonstrated the optimal concentrations of BA and 2,4-D for induced proembryonic masses. Moreover, consistent gene expression throughout both stages of embryogenesis suggests that our system unequivocally follows the somatic embryogenesis pathway.

1. Background

Cucumber (Cucumis sativus L., 2n = 14), a widely consumed vegetable from the Cucurbitaceae family, boosts significant levels of phosphorus, potassium, and oxalic acid. Its popularity spans global cuisines, frequently gracing salads across continents. Notably, cucumber holds paramount status in the realm of horticultural commodities, not only within Egypt but on a global scale.

Cucumber plant regeneration, achieved through organogenesis from explants like cotyledons, hypocotyls, and leaves,¹ has shown success, though challenges persist, including low regeneration rates, chimeric structures, abnormal morphogenesis, and premature flowering.² As a more promising approach, somatic embryogenesis can be induced both in plants and in culture, allowing asexual embryo formation.[3], [4], [5] This process is influenced by various factors, with the genotype of the donor plant being a critical determinant of success.⁶ Similar effects have been observed in other plant species, underscoring the genetic control over the embryogenesis process.⁷

Nutrient media composition, encompassing elements like plant growth regulators (PGRs), sugars, light, stress factors, and gelling agents, has been extensively investigated in relation to somatic embryogenesis, as discussed by Gaj.⁸ Among these components, PGRs, including auxins and cytokinins, are frequently highlighted for their role in regulating the cell cycle, initiating cell divisions, and inducing dedifferentiation.⁹ Research has shown that auxin synthesis under embryogenic conditions is a crucial signal for cell fate.¹⁰ The synthetic auxin 2,4-D has successfully induced embryogenic competence in somatic cells of various plant species, making it a widely recognized method.[11], [12] The application of exogenous 2,4-D can influence plant growth through both direct and indirect mechanisms, potentially by increasing endogenous auxin levels. Supporting this notion, Márquez-López et al.¹³ observed elevated levels of the natural auxin, indole 3-acetic acid (IAA), after the application of exogenous 2,4-D or 1-naphthaleneacetic acid (NAA). This aligns with findings that cellular IAA content rises during somatic embryogenesis induction.¹⁴ In some plant species, like Dendrobium, thidiazuron (TDZ) in the induction medium directly promotes somatic embryo production from leaf tips.¹⁵ Shen et al.¹⁶ confirmed this, observing directly induced somatic embryos in Phalaenopsis with benzyl adenine (BA) and TDZ. The study showed a direct link between cytokinin levels in the medium and somatic embryo production, a practice seen in various plant systems, including cucumber.¹⁷

Within the greenhouse, an array of cucumber diseases has been documented, encompassing downy mildew (Pseudoperonospora cubensis), powdery mildew (Erysiphe cichoracearum), gray mold (Botrytis cinerea), root rot (Phomopsis sclerotioides), white mold (Sclerotinia sclerotiorum), gummy stem blight, and black rot (Didymella bryoniae), anthracnose (Colletotrichum orbiculare), and Fusarium wilt (Fusarium oxysporum). Among these, Fusarium wilt stands out as the most destructive affliction in cucumber cultivation. This ailment, attributed to Fusarium oxysporum f. sp. cucumerinum, as noted by Din et al.,¹⁸ has been identified as a substantial threat. Meng et al.¹⁹ have reported that Fusarium wilt thrives in elevated air and soil temperatures (ranging from 23.9 °C to 30 °C), with disease manifestation being less likely in cooler soil conditions (below 20 °C), where an infected plant might remain symptom-free.

Significantly impacting crop yield, this pathogen can lead to a substantial reduction (10 % to 60 %) in overall greenhouse cucumber production, as highlighted by Meng et al.¹⁹ in Egypt. In light of this challenge, the present study sets out to establish a somatic embryogenesis system for selected Egyptian cucumber cultivars. This endeavor aims to harness the potential of this system to enhance these cultivars genetically and foster the development of cucumber lines displaying Fusarium wilt resistance. Ultimately, these resistant lines are envisaged to contribute to an effective cucumber breeding program tailored for Egypt's agricultural context.

2. Methods

2.1. Plant materials and explant preparation

Mature seeds of two cucumber cultivars, Beith Alpha and Prince, from the Horticulture Research Institute in Giza, Egypt, were used in these studies. The seeds underwent surface sterilization using 15 % Clorox (sodium hypochlorite, 8.25 % w/v) for 15 min, followed by rinsing with sterile distilled water four times. Afterwards, the seeds were air-dried on sterile filter paper within a laminar flow hood. Subsequently, the dried seeds were plated onto half-strength (½) MS basal salt medium supplemented with 3 % sucrose and solidified with 0.6 % agar. The cultures were incubated for 14 days under a light/dark cycle of 16/8 h and a temperature of 22 °C (±2 °C). Three types of explants were prepared under aseptic conditions: hypocotyls, the first true leaf, and stem segments. Cotyledonary and first true leaves were excised into small disks (approximately 4 to 6 mm²), while hypocotyls were cut into segments of 3 to 4 mm in length. All explants were prepared simultaneously and placed on an embryogenic induction medium (EIM), which consists of ½ MS, 2,4-Dichlorophenoxyacetic acid (2,4-D: 1 mg/L), 6-benzyladenine (BA: 0.25 mg/L), 20 g/L sucrose, and 3 g/L phytagel.

2.2. Media preparation and culture conditions

The development of somatic embryos in cucumber involved a two-step process: the induction stage and the subsequent development stage. Consequently, two distinct types of media were formulated: an embryo induction medium (EIM) and an embryo development medium (EDM). To enhance somatic embryo induction, an optimization approach was adopted using only Prince plant material. An orthogonal array design [L9 (3)⁴] experiment was carried out, involving three factors with three treatment levels each, encompassing explant types, 2,4-D concentration, and BA concentration as the primary variables. The induction of embryogenesis utilized MS basal salt as a nutrient source, with media supplemented with various concentrations (0.2, 0.5, and 1 mg/L) of 2,4-D and three concentrations (0.1, 0.2, and 0.5 mg/L) of BA. All EIM media were enriched with 20 g/L sucrose, pH-adjusted to 5.8, and solidified with 3 g/L phytagel, resulting in nine distinct treatments (Table 1, T1 → T9). Autoclaving was carried out at 121 °C and 1.5 atm for 15 min, followed by pouring the media into Petri dishes (19 × 15 mm). To study the impact of medium composition on cucumber embryonic induction, three different explant sources—cotyledonary leaf (CL), first true leaf (L), and stem segments (ST)—were inoculated on each type of medium (T1 → T9) and cultured for 3 weeks under a 16/8 light/dark cycle at 23 °C (±2 °C). Each treatment was replicated five times. To assess the effectiveness of each medium (treatment) in inducing embryonic callus, the percentage of embryogenic callus was calculated using the formula:

$$\mathrm{E}\mathrm{m}\mathrm{b}\mathrm{r}\mathrm{y}\mathrm{o}\mathrm{g}\mathrm{e}\mathrm{n}\mathrm{i}\mathrm{c}\mathrm{c}\mathrm{a}\mathrm{l}\mathrm{l}\mathrm{u}\mathrm{s}\mathrm{i}\mathrm{n}\mathrm{d}\mathrm{u}\mathrm{c}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n}\%=\frac{\mathrm{Number}\mathrm{of}\mathrm{embryonic}\mathrm{callus}\mathrm{induced}}{\mathrm{Total}\mathrm{number}\mathrm{of}\mathrm{explants}}\times 100$$

Table 1.

Orthogonal array design, L9(3⁴), using factors including IBA, IAA, and explant types for preparing different treatments to optimize the conditions for induction in vitro somatic embryos in cucumber.

Treatments	BA	2,4-D	Explant
1	0.125	0.5	CL
2	0.25	1	L
3	0.5	2	ST
4	0.125	1	ST
5	0.25	2	CL
6	0.5	0.5	L
7	0.125	2	L
8	0.25	0.5	ST
9	0.5	1	CL

The optimal concentrations from these treatments were integrated with three different basal salts, Murashige and Skoog (MS), Gamborg B5 (B5), and Litvay et al. (LV), to identify the most suitable basal salt for inducing somatic embryogenesis in cucumber. For somatic embryo development, a hormone-free embryo development medium (EDM) was employed. Three basal salts were tested at full and half strength, following the same preparation methods as mentioned above.

2.3. Transplantation and acclimatization of in vitro seedling

Somatic embryos, either at the cotyledonary stage with or without visible radicles, derived from embryonic calli, were cultured on ½ MS basal medium supplemented with 1.5 % (w/v) sucrose for a duration of 2 weeks, following a 16-hour photoperiod. Following this, the newly grown plantlets underwent a two-day acclimatization period to the altered growth conditions. Subsequently, they were carefully extracted from the container and washed with sterile water to remove any residual media. Once cleaned, these plantlets were transplanted into pots containing a mixture of orchard soil and vermiculite (2:1 ratio) to facilitate further plant development within a greenhouse environment. The greenhouse was maintained at a temperature of 25 (±1) °C and illuminated with a light intensity of 25 μmol m⁻² s⁻¹ for 14 h per day.

2.4. Pathogen preparation

Fusarium oxysporum f.sp. cucumerinum, the causative agent of cucumber plant wilt, was isolated from infected plants according to Abro et al.,²⁰ and this pathogen was employed in the current study. The cucumber plants subjected to testing were heavily infested by this isolated pathogen. The pathogen was cultivated using two distinct media. Potato Dextrose Agar (PDA) served as the solid medium for periodic subculturing of the fungus, while Richard's nutrient (R) medium²¹ was used as a liquid medium for generating the fungus culture filtrate. Both media were adjusted to a pH of 4.0. Promising fungal colonies cultivated on PDA medium were transferred to the liquid (R) medium for a 3-week culturing period in darkness at temperatures ranging from 25 to 28 °C. Following culturing, the cultures underwent sieving via a nylon mesh and were then doubly sterilized through bio-filtration, utilizing double 45 µm filter membranes. A total of five liters of fungal filtrate were collected and subsequently preserved at a temperature of −20 °C until used and added to the media after autoclaving.

2.5. Selection of cucumber lines resistant to Fusarium filtrate

Embryogenic calli were initiated using an induction medium supplemented with 15 %, 25 %, and 50 % pathogen filtrate (PF) and subjected to 5, 4, and 3 subculture cycles under consistent physical conditions as mentioned earlier. The viable embryos originating from the embryonic calli were subsequently moved to Embryo Development Medium (EDM) for a developmental phase lasting 2 – 3 weeks. Following successful acclimatization, the regenerated plants were transplanted into the soil.

2.6. RNA isolation and expression analysis of embryogenesis marker genes

Total RNA was extracted from the initial explants at weeks 1, 2, and 3, during both the induction and development stages, using the Spectrum Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, USA). The concentration and purity of the RNA were assessed with an ND-1000 spectrophotometer (NanoDrop, ThermoFisher). To prevent DNA contamination, trace amounts of DNA were eliminated using an On-Column DNase I Digestion Set (Sigma-Aldrich), following the manufacturer's guidelines. Subsequently, first-strand cDNA was synthesized in a 20-μL reaction volume, utilizing 1 μg of RNA and the Maxima First Strand cDNA Synthesis Kit (ThermoFisher, Waltham, MA, USA). For the quantification of transcript levels, real-time quantitative RT-PCR (qRT-PCR) was employed. The product of the reverse transcription was diluted at a 3:1 ratio (water: cDNA), with 2 μl of the diluted product used for each reaction. The qRT-PCR was done in a 10 μl reaction volume, employing the LightCycler® 480 SYBR™ Green I Master kit (Roche), a LightCycler®480 Multiwell Plate 96, and Multiwell Sealing Foil (Roche). A LightCycler® 480 System (Roche) real-time detection system was utilized, with the following reaction conditions: initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 58 °C for 20 s, and extension at 72 °C for 10 s. Subsequently, a melt curve analysis involved denaturation at 95 °C, annealing at 65 °C for 5 s, and extension at 98 °C with a rate of 0.11 °C/s for fluorescence measurement, followed by cooling at 40 °C for 10 s.

Relative transcript levels were calculated and normalized using 25S rRNA as the internal control using the forward primer: GTACGAGAGGAACCGTTGATT and the reverse primer: AGAGGCGTTCAGTCATAATCC. Fold-change values were determined using the comparative 2^(-ΔΔCt) method, as described by Livak and Schmittgen in 2001.²² The primers used for embryogenesis marker gene analysis are listed in Table 2.

Table 2.

Primer names, sequences, and annealing temperatures of ISSR primers and embryogenesis marker gene primers.

Primer name	Sequence	Annealing temp.
UBC807	5ʹ-AGA GAG AGA GAG AGA GT- 3ʹ	53 °C
UBC828	5ʹ-TGT GTG TGT GTG TGT GA- 3ʹ	58 °C
UBC878	5ʹ-GGA TGG ATG GAT GGA T- 3ʹ	54 °C
UBC822	5ʹ-TCT CTC TCT CTC TCT CA- 3ʹ	53 °C
UBC874	5ʹ-CCC TCC CTC CCT CCC T- 3ʹ	60 °C
CsCUS1-F CsCUS1-R	5ʹ-CAGGACTCAATGCTCCCATAC- 3ʹ 5ʹ-ACACCAAACACATCTCCATACA- 3ʹ	62 °C
CsSEM1-F CsSEM1-R	5ʹ-GCTCCTCATAGACACTACCAATG- 3ʹ 5ʹ-TAGTCCACTTTGTGCTTGGATTA- 3ʹ	62. °C
CsSECAD1-F CsSECAD1-R	5ʹ-ATCCCAGCCTTTGCTCTTATT- 3ʹ 5ʹ-CAACGTCTGCAGTTATGTTGTG- 3ʹ	62 °C

2.7. Genetic variation analysis using ISSR analysis

The DNA was extracted from leaf tissue using the indirect method with the Gene JET DNA purification kit from Molecular Biology, Thermo Fisher Scientific, Germany, according to manual instructions. DNA was eluted with 100 µl elution buffer and centrifuged at 10000 rpm for 1 min (repeated twice). The extracted DNA was stored at −80 °C.

Five ISSR primers (Operon Nippon EGT Co., Ltd., USA) were assessed for polymorphic product generation across all samples (Table 2), following optimization of amplification conditions via appropriate MgCl₂ concentrations and annealing temperatures. Genomic DNA served as the amplification template, with a reaction mixture comprising 25 µl of Nippon Genetics Europe Master Mix Taq Ready Mix with Dye and 3 µl of primer (10 pmoles). Amplification conditions were fine-tuned using a gradient thermal cycler (Biometra Thermal Cycler, Germany). After iterative experiments, a standardized PCR program included an initial 4 min. denaturation at 94 °C, followed by 40 cycles of denaturation (45 sec at 94 °C), primer-specific annealing (45 sec), extension (45 s at 72 °C), and a final 7 min. extension at 72 °C, with a subsequent cooldown to 4 °C before removing PCR tubes. Amplification products were loaded into 1.5 % agarose gel electrophoresis in 1 × TAE buffer at 70 V for 1 h. ISSR fingerprinting was visualized using the Gel Works 1D advanced gel documentation system (UVP, UK), photographed under UV light, and band sizes estimated using a 100-bp DNA ladder (Fermentas, Germany) as a standard marker.

2.8. Statistical analysis

The collected data underwent statistical analysis through one/two-way analysis of variance (ANOVA), followed by Tukey's honest significant difference (HSD) post hoc test, with a significance level set at p < 0.05. The statistical analysis was conducted using STATISTICA v.12 software (StatSoft Inc., 2014, Tulsa, OK, USA). The ISSR marker, a multi-locus dominant type, facilitated binary scoring (presence: 1, absence: 0) of amplified DNA polymorphic fragments for each individual family. Polymorphic fragment percentages were employed to study somaclonal variation among regenerated and original cucumber plants. Cluster analysis was executed using NTSYS-pc ver. 2.1, and a neighbor-joining tree was constructed based on a Jaccard similarity matrix.²³

3. Results

3.1. Optimization of somatic embryogenesis culture

To optimize the concentration of plant hormones and explants required for somatic embryogenesis induction for the tested cucumber cultivars, an orthogonal array design (OAD) was employed, significantly reducing treatments to a manageable 9. A complete randomized design would necessitate 27 treatments and 1350 explants, while OAD [L9 (3)⁴] reduced this to 9 treatments using 450 explants (Table 1). Observations at 3 weeks revealed cucumber embryogenic calli characterized by friable texture, yellow color, and pro-embryonic masses (Fig. 1). Factors tested for inducing embryogenic calli included 6-benzyladenine (BA), 2,4-Dichlorophenoxyacetic acid (2,4-D), and explant types: cotyledonary leaf (CL), true leaf (L), and stem segment (ST), with BA inducing pro-embryonic masses in 53.3 % of tested explants at 0.125 and 0.25 mg/L (Fig. 2a), and 1 mg/L 2,4-D also initiating a maximum of 53.3 % embryogenic calli (Fig. 2b). The cotyledonary leaf (CL) was the most responsive explant, with 60 % developing embryogenic calli (Fig. 2c).

Fig. 1.

Somatic embryogenesis in cucumber. Cotyledonary leaf explants (1–3 mm² in size) were grown on induction medium for 1 week; after 3 weeks, the embryonic calli were developed. Upon transferring to the development medium, the proembryonic masses were developed into somatic embryos and subsequently germinated into seedlings. At day 21, seedlings were collected from jars and planted in soil (peatmoss) under high humidity, soil with high water content, and a light cycle of 16 hrs (light)/ 8 hrs (dark) for 2 weeks. All growing seedlings were transferred to permanent soil until the flowering stage.

Fig. 2.

Optimizing the embryonic cucumber callus using four different factors Media, 6-benzyladenine (BA), 2,4-dichlorophenoxyacetic acid (2,4-D), and explant types: CL, cotyledonary leaf; L: true leaf; and ST: stem segment.

Using different basal salts (MS, B5, LV) for cucumber embryonic induction, MS basal salt under specific conditions (0.125 mg/L BA, 1 mg/L 2,4-D, and CL explants) using the Beith Alpha cultivar yielded the highest induction rate of approximately 75 % (Fig. 2c). For developing mature somatic embryos, embryogenic calli were cultured on developmental media under the same conditions as induction. Both full and half-strength MS basal salt exhibited superior development (Fig. 3a), with half-MS medium yielding 17 embryos per callus and full MS yielding 10 embryos (Fig. 3a). The differences in the number of developed somatic embryos on LV and B5 basal salts were not statistically significant (8 embryos/embryogenic callus). Comparing the two commercial cultivars under fully optimized conditions during induction and development (Fig. 3b), Bieth Alpha (about 18 SE/explant) displayed significantly more responsiveness than Prince (about 10 SE/explant).

Fig. 3.

(a) Number of developed cucumber somatic embryos evolved on free-hormone embryo development medium (EDM) in both full strength and half strength. Values are the means ± SE of three biological replicates (n = 15). (b) Number of produced somatic embryos in both genotypes, Beith Alpha and Prince. Values are the means ± SE of three biological replicates (n = 15). Letters on bars indicate statistically significant differences (p < 0.05). Letters on bars indicate statistically significant differences (p < 0.05). (c) The fold change in expression level of CsCUS1 during induction and development of cucumber somatic embryogenesis in embryonic and non-embryonic calli. Values are the means ± SE of three biological replicates (n = 15). (d) The fold change in expression level of CsSEM1 and CsECAD1 during the induction and developmental stages of cucumber somatic embryogenesis. Values are the means ± SE of three biological replicates (n = 15).

3.2. Validation of the cucumber somatic embryogenesis system

To confirm the optimized system's reliance on somatic embryogenesis rather than organogenesis, quantitative RT-PCR was employed (Fig. 3a and b). Transcript levels of Cucumis sativus splicing factor 3B subunit 2 (CUS1, Accession #: XM_004152766), a known marker for embryogenic cucumber calli,²⁴ were measured in both embryogenic and non-embryogenic calli (Fig. 3c) during the induction and developmental stages of cucumber somatic embryogenesis (Fig. 1). Notably, CUS1 transcripts were absent in non-embryogenic calli across both stages. However, a robust signal was detected during induction, peaking at 2 weeks and gradually diminishing during development (Fig. 3c). These findings signify CUS1′s exclusive expression in embryogenic calli solely during induction. Furthermore, Wiśniewska et al.²⁵ identified two cucumber somatic embryogenesis marker genes, DIVARICATA-like transcription factor (CsSEM1) and cinnamyl alcohol dehydrogenase 1 (CsSECAD1). Transcript levels of these genes were assessed in embryogenic calli at 2- and 3-week induction, as well as at 1-, 2-, and 3-week developmental stages (Fig. 3d). Both genes exhibited transcription throughout somatic embryogenesis. Cumulatively, these outcomes robustly underscore the somatic embryogenesis basis of our system.

3.3. Selection of embryonic calli resistance to Fusarium wilt

Fusarium oxysporum f.sp. cucumerinum isolates underwent confirmation using ITS, TEF1, and RPB1 sequence analysis. The isolate aligning with 100 % similarity to Fusarium oxysporum f.sp. cucumerinum was chosen. The Fusarium oxysporum f.sp. cucumerinum filtrate, referred to as pathogen filtrate (PF), was prepared as outlined in the methods section. Employing optimized in vitro somatic embryogenesis, the study introduced varying pathogen filtrate (PF) volumes (15 %, 25 %, and 50 %) into media for CL explant inoculation. This process underwent 3, 4, and 5 cycles of 3 weeks each. Embryogenic calli (5 embryogenic calli/plate) were transferred to optimized developmental medium (½ MS) for three weeks, with somatic embryo counts conducted throughout. During the selection process (Fig. 5c), embryogenic calli exhibited a color change to brown by week 2, followed by the growth of creamy yellow masses in the third week. Subculturing for cycles 2 and 3 led to increased size and the initiation of numerous proembryonic masses, later developing greenish coloration and sometimes fine hairs. Selected calli were moved to the development medium for the full maturation of somatic embryos. Somatic embryo numbers were tallied under different treatments: S1 (15 % PF, 5 cycles), S2 (25 % PF, 4 cycles), S3 (50 % PF, 3 cycles), and S4 (100 % PF, 2 cycles) (Fig. 5a). The application of selection procedures led to significantly reduced somatic embryo counts per plate. S1 and S2 yielded similar embryo numbers (32.3 and 35.7 embryos/plate, respectively), while S3 and S4 produced fewer (20.1 and 8 embryos/plate). Thus, S2 was selected for further development of the chosen somatic embryos. The impact of selection procedures on somatic embryo germination was assessed by calculating germination percentages for each procedure (Fig. 5b). Observations indicated no significant differences for S1, S2, and S3 compared to the control (no selection), while S4 displayed lower germination compared to the control.

Fig. 5.

Selection protocols isolate cucumber lines resistant to Fusarium oxysporum f.sp. filtrate. (a) NS, non-selection procedures; S1, selection procedures at 15 % Fusarium oxysporum f.sp. filtrate for 5 cycles of subculture; S3, selection procedures at 25 % Fusarium oxysporum f.sp. filtrate for 4 cycles of subculture; S4, selection procedures at 50 % Fusarium oxysporum f.sp. filtrate for 3 cycles of subculture; and S4, selection procedures at 100 % Fusarium oxysporum f.sp. filtrate for 2 cycles of subculture. (b) Germination of induced somatic embryos under different selection processes (S1 → S4). (c) cucumber embryogenic calli under the selection process (S2). (d) a selected somatic embryo resistant to 15 % Fusarium oxysporum f.sp. filtrate for 5 cycles of embryogeneic calli subculture.

3.4. Genetic variation due to selection procedures

To assess the genetic impact of selection, ISSR analysis was employed using five primers. These primers generated a total of 20 ISSR-amplified fragments, including 10 polymorphic, 4 monomorphic, and 6 unique bands (Table 3 and Fig. 6). The UBC828 primer exhibited the highest ISSR band count, with 5 DNA bands, including a unique 700 bp band (Prince cv: in vivo-grown plant). In contrast, UBC822 displayed the fewest bands (3 PCR bands), featuring two unique bands sized at 341 bp (Beith Alpha cv: in vivo-grown plant) and 513 bp (Prince cv: in vivo-grown plant). The remaining primers (UBC807, UBC874, and UBC878) yielded four bands, with one unique band each, spanning 427 bp (Beith Alpha cv: in vivo-grown plant), 290 bp (Prince cv: in vivo-grown plant), and 400 bp (Prince cv: in vivo-grown plant). The percentage of polymorphism, total amplified PCR amplicons, and polymorphic PCR amplicons from two cucumber cultivars (Prince and Beith Alpha) of control plants, regenerated plants without pathogen filtrate (PF), and after PF treatment are shown in Table 4. The in vivo-grown Prince cv plants and regenerated plants after PF treatment showed the highest percentage of polymorphism, 81.3 % and 72.7 %, respectively compared to regenerated plants without PF treatment (Table 4). Cluster analysis, using the Jaccard similarity index, unveiled distinct separation between control (in vivo grown) plants of cucumber cultivars (Beith Alpha and Prince) and regenerated plants both untreated and treated with PF-regenerated plants, regardless of PF treatment, clustered together (Fig. 7A and B).

Table 3.

Total amplified fragments, monomorphic and polymorphic fragments using ISSR primers.

Primers	TAF	MF	PF	Polymorphism %
UBC807	4	1	3	75
UBC828	3	1	0	0
UBC878	5	1	3	60
UBC822	4	0	3	75
UBC874	4	0	3	75
Total	20	3	12	60

TAF: Total Amplified Fragments PF: Polymorphic Fragment MF: Monomorphic Fragment.

Fig. 6.

Agarose gels of amplified PCR fragments from control (in vivo-grown) plants, regenerated plants without PF and after PF treatment of two cucumber cultivars (Prince and Beith Alpha) of using ISSR primers. M: 100 bp DNA ladder 1: Prince (in vivo-grown) plants. 2: Prince regenerated plants without PF treatment 3: Prince regenerated plants after PF treatment. 4: Beith Alpha (in vivo-grown) plants. 5: Beith Alpha regenerated plants without PF treatment. 6: Beith Alpha regenerated plants after PF treatment.

Table 4.

Percentage of polymorphism (%), total amplified PCR amplicons, and polymorphic PCR amplicons from two cucumber cultivars (Prince and Beith Alpha) of control plants, regenerated plants without PF, and after PF treatment using ISSR primers.

Plant samples	TAF	PA	Polymorphism (%)
In vivo-grown Prince cv plants	16	13	81.3 %
Prince cv regenerated plants without PF treatment	9	6	66.6 %
Prince cv regenerated plants after PF treatment	11	8	72.7 %
In vivo-grown Beith Alpha cv plants	11	8	72.7 %
Beith Alpha cv regenerated plants without PF treatment	5	2	40 %
Beith Alpha cv regenerated plants after PF treatment	5	2	40 %

TAA: Total Amplified Amplicons PA: Polymorphic Amplicons PF: Pathogen Filtrate.

Fig. 7.

Cluster analysis of ISSR banding patterns of control (in vivo-grown) plants, regenerated plants without PF, and after PF treatment of Prince (A) and Beith Alpha (B) cultivars. 1: Prince in vivo-grown plants. 2: Prince regenerated plants without PF treatment 3: Prince regenerated plants after PF treatment. 4: Beith Alpha in vivo-grown plants. 5: Beith-Alpha regenerated plants without PF treatment. 6: Beith Alpha regenerated plants after PF treatment.

4. Discussion

4.1. Embryogenesis system development

Effective establishment of a cucumber regeneration protocol for Egyptian varieties depends on reliable explant sources that are consistently available, aseptic, and responsive to induction and propagation methods. Cucumber plant regeneration from somatic tissues can follow organogenesis or embryogenesis pathways. Subsequent studies reported more cases of cucumber organogenesis but faced reproducibility challenges, leading to infrequent regeneration.[26], [27] Yet, Tan et al.²⁶ and Anjanappa and Gruissem²⁸ achieved some success regenerating somatic embryos from cotyledonary calluses and/or protoplasts. Our research initially explored the organogenesis pathway, but our chosen cultivars displayed minimal responsiveness to the prescribed culture media, prompting a shift toward investigating the somatic embryogenesis system.

In our cucumber somatic embryogenesis system, we divided the process into two distinct stages, as depicted in Fig. 1: the induction and development stages. Through our optimization efforts during the induction stage for the two genotypes, we found that the optimal concentrations of BA and 2,4-D for inducing proembryonic masses were 0.125 mg/L and 1 mg/L, respectively, resulting in the highest embryogenic capacity at 53.3 %. These results align with Usman et al.'s findings,²⁹ who achieved significant callus induction rates using 2 mg/L 2,4-D, NAA, and BAP at 1.5 mg/L each in cucumber leaf disc explants, albeit with a high occurrence of malformed embryos.

Notably, our developed system did not exhibit any morphological abnormalities. Additionally, our data indicated that cotyledonary leaf explants outperformed other types, with 60 % of the explants responding and developing proembryonic masses. This suggests that cells within cotyledon leaves possess a higher degree of competence and a more favorable response to exogenous hormones compared to other explant types, consistent with findings by Koochani et al.,³⁰ Li,³¹ and Zheng,³² albeit with a slightly lower embryo count. Further optimization of culture media showed that MS basal salt, combined with optimized concentrations of BA, 2,4-D, and cotyledonary leaf explants, yielded the best results. MS basal salt's widespread use as a foundational component in tissue culture across various plant species stems from its significant role in somatic embryo induction and its intricate interactions within the growth environment.³³

Our studies indicated that both full-strength MS media variants were most effective in promoting fully mature embryo development. Remarkably, full MS medium led to the formation of 10 embryos per explant, while the half-MS basal salt medium performed even better, yielding 17 embryos per explant. These results are consistent with those reported by Moreno et al.,³³ who studied mineral solutions' effects on cucumber calli-derived organogenesis from cotyledons, favoring the MS solution. In contrast, B5 solution, under the same cultural conditions, produced somatic embryos in only half of the tested explants, while other mineral solutions inadequately promoted organogenic responses, as noted by Moreno and Roig.³⁴ However, it's important to acknowledge the discrepancies with Thiruvengadam et al.'s³⁵ findings in bitter melon.

The responses of Prince (approximately 10 SE/explant) and Bieth Alpha (about 18 SE/explant) cucumber genotypes to varying cultural conditions were influenced by 2,4-D uptake kinetics, pH dynamics, and rates of ammonium and nitrate uptake. To mitigate genotype-related variations and enhance somatic embryogenesis, modifications to the nutritional medium may be needed, as proposed by Corredoira et al.³⁶. Another study involving two cucumber lines reveals genotype-specific influences on medium parameters, such as ammonium and nitrate uptake rates, 2,4-D utilization kinetics, and pH dynamics, which can facilitate or hinder somatic embryogenesis, consistent with prior research by Nadolska-Orczyk and Malepszy³⁷ and Plader et al.³⁸.

To confirm the developmental pathway in our system, whether it is embryogenesis or organogenesis, we measured the transcript levels of Cucumis sativus splicing factor 3B subunit 2 (CUS1, Accession #: XM_004152766), a well-established marker gene indicating embryogenic competence. This assessment covered both embryogenic and non-embryogenic calli during the induction stage (Fig. 3c). CsCUS1 serves as a validated somatic embryogenesis marker gene during cucumber embryogenesis's induction stage.²⁴ Our results clearly demonstrate significant CsCUS1 expression in embryogenic calli, peaking at the 2-week mark of the induction stage and subsequently declining during the developmental stage. Additionally, using CsSEM1 and CsSECAD1 as indicators, known for their elevated expressions in fully developed somatic embryos across diverse cucumber organs as observed by Wiśniewska et al.,²⁵ we assessed their transcription levels during both the induction and developmental stages of the cucumber embryogenesis system (Fig. 3d). Our findings reveal consistent gene expression throughout both stages, confirming our system follows the somatic embryogenesis pathway. This aligns with Wiśniewska et al.'s outcomes²⁵ and underscores the connection of developmental pathways across plant species, enriching our understanding of somatic embryogenesis mechanisms, as also demonstrated in lettuce and Arabidopsis.[39], [40], [41], [42]

4.2. Selection method development

After developing and validating the somatic embryogenesis system in cucumber, we utilized it to select a cucumber line resistant to Fusarium oxysporum f. sp. cucumerinum filtrate, as outlined in Fig. 4. The implementation of the selection processes within the optimized embryogenesis system resulted in a noticeable reduction in the number of somatic embryos per plate, as seen in Fig. 5a, reflecting our efforts to enhance the cucumber embryonic calli's resistance to Fusarium oxysporum f. sp. cucumerinum filtrate. This approach aligns with Rai's findings,⁴³ which propose that exposure to culture filtrate (CF), phytotoxins, and even the pathogen itself can lead to the development of resistant cell/callus lines, effectively generating disease-resistant somatic variants of cucumber.[44], [45], [46] Our investigation primarily focused on the in vitro selection technique's effectiveness in imparting resistance to Fusarium wilt, a phenomenon validated in numerous studies across various plant species, including tomato, tobacco, cereals, sugar beets, oil-producing plants, and medicinally important plants.[43], [45], [46], [47] These collective findings underscore the broad applicability and significance of the in vitro selection method for enhancing resistance against Fusarium wilt and similar pathogens in diverse plant species.

Fig. 4.

Illustration shows the selection process using the cucumber in vitro embryogenesis protocol to develop wilt-resistant lines.

Our examination of selection procedures on somatic embryo germination showed that S1, S2, and S3 (Fig. 5b) had no significant differences compared to the control group (no selection). In contrast, S4 exhibited lower germination percentages than the control, in line with Yerzhebayeva et al.'s findings⁴⁷ on sugar beet callus cells subjected to culture filtrate concentrations. The morphological appearance of the calli under the selection regime became darker and more compacted (Fig. 5c). To assess genetic impact, ISSR analysis with five primers produced 20 amplified fragments, with 10 showing polymorphisms, 4 being monomorphic, and 6 distinctive bands (Fig. 6). A previous study indicated that Start Codon Targeted Polymorphism (SCoT) and Conserved DNA-Derived Polymorphism (CDDP) techniques hold promise in predicting the physiological and agronomic outcomes of the selection process⁴⁸. Our study determined that ISSR primers can effectively discern changes in cucumber plants' band profiles under selection conditions. Cluster analysis results (Fig. 7) clearly separated control plants from regenerated ones, forming distinct groups based on the Jaccard similarity index, confirming the effectiveness of our developed protocol.

5. Conclusions

Our research focused on optimizing the induction stage to enhance the embryogenic capacity of a cucumber embryogenesis system. Through systematic experimentation, we identified the optimal concentrations of BA and 2,4-D that resulted in high embryogenic capacity. Cotyledonary leaf explants exhibited superior performance in responding and generating pro-embryonic masses compared to other types of explants. Furthermore, our investigation highlighted that the full-strength MS medium and half-MS basal salt medium were the most effective in promoting the growth of fully developed embryos. The transcriptomic analysis indicated a peak of somatic embryogenesis marker genes at the 2-week mark, which marks the induction stage in embryogenic calli. This peak declined in non-embryogenic calli. Moreover, our research addressed the development of a somatic embryogenesis system to identify cucumber lines resistant to Fusarium wilt. The implemented strategy successfully enhanced the resistance of cucumber embryonic calli. ISSR analysis was applied to evaluate the effects of selection at the genomic level. The findings demonstrated that ISSR primers accurately identified changes in the band profile of cucumber plants exposed to selection conditions. This insight contributes to our understanding of the molecular mechanisms underlying resistance in cucumber lines. In summary, our research not only optimized the induction stage for increased embryogenic capacity but also provided valuable insights into the molecular aspects of cucumber embryogenesis and resistance to Fusarium wilt. These findings contribute to the advancement of cucumber breeding programs and hold promise for the development of more resilient cucumber varieties.

Declarations

Not applicable.

Consent for publication

Not applicable.

Availability of data and material

All data generated or analyzed during this study are included in this published article.

Competing interests

The authors declare that they have no competing interests.

Funding

Not applicable.

CRediT authorship contribution statement

Hamdy M. Hamza: Investigation, Visualization. Rana H. Diab: Writing - review & editing, Investigation, Visualization. Ismael A. Khatab: Supervision and Writing – review & editing. Reda M. Gaafar: Conceptualization, Data curation, and Supervision, Writing - review & editing. Mohamed Elhiti: Conceptualization, Data curation, Supervision, Writing - review & editing, Investigation, Visualization.