Transcriptional control of CCAAT/enhancer binding protein zeta gene in chicken adipose tissue

Lingyu Gao; Yingjun Wang; Qin Gao; Yuechan Chen; Zhiwei Zhang

doi:10.1016/j.psj.2024.103540

. 2024 Feb 14;103(4):103540. doi: 10.1016/j.psj.2024.103540

Transcriptional control of CCAAT/enhancer binding protein zeta gene in chicken adipose tissue

Lingyu Gao ^*,^‡,¹, Yingjun Wang ^*,¹, Qin Gao ^*, Yuechan Chen ^†, Zhiwei Zhang ^⁎,²

PMCID: PMC10907851 PMID: 38417330

Abstract

CCAAT/enhancer binding protein zeta (C/EBPZ) was differentially expressed in abdominal adipose tissues of fat and lean broilers and regulated adipogenesis in chicken. The objective of this study was to elucidate the transcriptional regulation of C/EBPZ gene in chicken adipose tissue. A 2,031-base pair (bp) chicken C/EBPZ sequence (2,025 nucleotides upstream to 6 nucleotides downstream from the initiator codon, -2,025/+6) was studied. The sequence exhibited a significant promoter activity (P < 0.05) and had some cis-acting elements, notably, a core promoter was identified in nucleotides −94 to +6. Additionally, DNA pull-down assay showed that proteins interacted with chicken C/EBPZ promoter (−173/+6) in preadipocytes were implicated in transcription, post-transcriptional regulation and translation. In addition, KLF2 facilitated the activities of chicken C/EBPZ promoter (−2,025/+6, −1,409/+6, −793/+6, −485/+6, −173/+6, and −94/+6) in preadipocytes (P < 0.05). The expression levels of KLF2 and C/EBPZ in chicken abdominal adipose tissue were substantially associated (r = 0.5978278, P < 0.0001), and KLF2 increased C/EBPZ expression in vitro (P < 0.05). Additionally, chromatin immunoprecipitation (ChIP)-PCR analysis revealed that KLF2 has the ability to interact with the chicken C/EBPZ promoter regions at least at the positions −1,245/−1,048 and −571/−397. Mutation analysis showed that the CGCAGCGCCCG motif located in the chicken C/EBPZ promoter at positions -45 to -35 is involved in regulating transcription and facilitates trans activation by KLF2. These results provided some information of transcription control of C/EBPZ in chicken adipose tissue.

Key words: Chicken, adipose tissue, transcription regulation, promoter, CCAAT/enhancer binding protein zeta

INTRODUCTION

Adipose tissue which composed mostly of adipocytes plays important roles in maintaining lipid and glucose homeostasis (Chait Alan et al., 2020). Adipogenesis, formation of adipocytes, involves a temporally regulated set of gene-expression events (Rosen and MacDougald, 2006), and associated with a variety of diseases, including obesity, cardiovascular disease, type 2 diabetes mellitus, nonalcoholic fatty liver disease, lipodystrophy and some cancers. Approaches aimed at increasing adipogenesis might be means of treating metabolic diseases (Ghaben and Scherer, 2019).

A complex transcriptional cascade regulates adipogenesis, at least involving the nuclear hormone receptor peroxisome proliferators-activated receptor γ (PPARγ), the basic leucine zipper (bZIP) family members CCAAT/enhancer binding protein alpha (C/EBPα) and C/EBPβ, and zinc-finger transcription factors ZFP423, Krüppel-like factors (KLFs) and GATA2/3 (Mota et al., 2017; Ghaben and Scherer, 2019).

C/EBPZ, also names CBF, CBF-2, NOC1 and HSP-CBF, is a ubiquitous and highly conserved protein in animals (Pulido-Salgado et al., 2015). Early research showed that C/EBPZ facilitates HSP70 promoter activity in a CCAAT-dependent manner by forming a protein complex with nuclear factor Y (NF-Y) (Lum et al., 1990; Imbriano et al., 2001). Recent studies showed that C/EBPZ is a mRNA binding protein (Baltz et al., 2012; Castello et al., 2012) and nucleolar protein (Andersen et al., 2002), and it plays a role in m6A methylation of RNA by recruiting methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit (METTL3) to the transcription start sites of target genes in acute myeloid leukemia (AML) (Barbieri et al., 2017). In addition, C/EBPZ is a recurrently mutated gene in AML with isolated trisomy 13 (Herold et al., 2014), a genetic associated gene with schizophrenia (Ripke et al., 2013), and a player in the viral-human protein-protein interaction of SARS-CoV-1, MERS-CoV, and SARS-CoV-2 in human beings (Gordon et al., 2020).

Chicken is an important farm animal and an ideal animal model on obesity and metabolic diseases (Namya et al., 2013; Dupont et al., 2009). Studying chicken adipogenesis is crucial for the lean broiler breeding and beneficial for understanding of human diseases. Our previous study showed that C/EBPZ is a new player of chicken adipogenesis, and its transcripts of abdominal fat tissues are differentially expressed between fat and lean broilers (Chen et al., 2022).

This study aimed to elucidate the transcription control of C/EBPZ in chicken adipose tissue, and the results provided a promoter information of chicken C/EBPZ, an atlas of nucleoproteins combined with chicken C/EBPZ core promoter, and evidence that KLF2 activates chicken C/EBPZ transcription in preadipocytes. These findings shed light on the understanding the transcriptional regulatory processes involved in the development of adipose tissue in chickens, as well as the factors that contribute to the different levels of C/EBPZ transcripts in abdominal adipose tissue between fat and lean broiler lines.

MATERIALS AND METHODS

Cell Culture

Several 12-day-old male Arbor Acres (AA) broilers were sacrificed after ether anesthesia to isolate stromal-vascular cells. As described in the previous method (Zhang et al., 2013), the stromal-vascular cells isolated from the abdominal fat of 12-day-old male broilers were considered as chicken preadipocytes, and cultured in DMEM/F12 medium supplemented with 10% fetal bovine serum under a condition of 37ºC, humidified, and 5% CO₂ atmosphere. Esophageal carcinoma Eca109 cells (a gift from Professor Mu X. of Shihezi University) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum under the same condition as chicken preadipocytes.

Cell Transfection

Approximately 1 × 10⁶ and 2.5 × 10⁵ cells were seeded into one well of 6-well and 24-well culture plate, respectively. After 12 to 24 h, once the cellular confluence reached a range of 70% to 80%, the plasmids, the mixture of plasmids and siRNA duplexes, or siRNA duplexes were transfected. The FuGENE HD transfection reagent (Promega, Madison, WI) was used for cell transfection. Briefly, the transfection system, consisted of 2 μg plasmids, the mixture of 2 μg plasmids and 152 pmol siRNA duplexes, or 152 pmol siRNA duplexes in each 100 μL serum-free medium containing 5 μL FuGENE HD transfection reagent, was incubated at room temperature for 15 min before transfection. For the cells cultured in one well of the 6-well and 24-well culture plates, the amount of 100 μL and 25 μL of the transfection system were used, respectively.

Plasmid Construction

The overexpression plasmids of chicken GATA2, GATA3, KLF2, KLF3, and C/EBPZ, namely pCMV-myc-GATA2 (Zhang et al., 2012), pCMV-myc-GATA3 (Zhang et al., 2012), pCMV-myc-KLF2 (Zhang et al., 2014a), pCMV-myc-KLF3 (Zhang et al., 2014b), and pCMV-HA-C/EBPZ (Chen et al., 2022), were constructed as described in literatures. The 5′-flanking sequences of chicken C/EBPZ were amplified by PCR using 10 ng chicken genomic DNA as template. The genomic DNA was extracted from chicken preadipocytes with FastPure Cell/Tissue DNA Isolation mini kit (#DC102-01, Vazyme, Nanjing, China), and evaluated with agarose gel electrophoresis and a Nanodrop spectrophotometer (Thermo Scientific, Carlsbad, CA) before use. Only the genomic DNA with OD260/OD280 ratios ranging from 1.7 to 2.0 was utilized. The primers (Table 1) were designed referring to the sequences of chicken genome (GRCg6a/galGal6), chicken C/EBPZ mRNA (GenBank accession number: NM_001031060.2/NM_001396807.1) and pGL4.10 plasmid (Promega) using the CE Design online tool (https://crm.vazyme.com/cetool/singlefragment.html), and they were synthesized by Sangon Biotech company (Shanghai, China). The PCR products were cloned into pGL4.10 using ClonExpress II One Step Cloning Kit (Vazyme Biotech, Nanjing, China) to obtain the luciferase reporter constructs of chicken C/EBPZ promoter (−2,025/+6, −1,409/+6, −793/+6, −485/+6, −173/+6 and −94/+6). The plasmid of mut-pGL4.10-C/EBPZ (-94/+6), harboring a mutation in its sequence from −45 to −35, specifically altering the nucleotide sequence from CGGGCGTGCG to CGGTATCTGCG, was synthesized by BGI Company (Beijing, China).

Table 1.

Primers used for plasmids construction.

Primer name	Oligonucleotides (5′-3′)
C/EBPZ(−2,025F)	cctgagctcgctagcctcgagAATTGTGTTCAGTATTACATATTTCCCTG
C/EBPZ(−1,409F)	cctgagctcgctagcctcgagCATTCTGTTTACCCATGGCCA
C/EBPZ(−793F)	cctgagctcgctagcctcgagGTCCCCCCTAACGCCTGC
C/EBPZ(−485F)	cctgagctcgctagcctcgagCGGGGGGAGGAGATGAGC
C/EBPZ(−173F)	cctgagctcgctagcctcgagGTTACCGCGGTGACAGGGA
C/EBPZ(−94F)	cctgagctcgctagcctcgagGGCGGCATGATCGGCTGC
C/EBPZ(+6R)	ccagatcttgatatcctcgagCGCCATGGCAGGCTGCAG

Open in a new tab

Overexpression Experiment

The overexpressions of chicken GATA2, GATA3, KLF2, KLF3, and C/EBPZ were achieved through transfection of their respective plasmids (pCMV-myc-GATA2, pCMV-myc-GATA3, pCMV-myc-KLF2, pCMV-myc-KLF3, pCMV-HA-C/EBPZ, pCMV-myc or pCMV-HA) with chicken preadipocytes. After 48 h of transfection, the overexpression effect was detected by western blot using myc-tag or HA-tag antibody.

RNA Interference

Three different siRNA duplexes used for KLF2 knockdown (Table 2) were designed and synthesized by Genepharma company (Shanghai, China). The 152 pmol given siRNA duplexes or the mixtures of 152 pmol given siRNA duplexes and 2 μg pCMV-myc-KLF2 were transfected into the chicken preadipocytes cultured in one well of the 6-well culture plate using FuGENE HD transfection reagent (Promega). After transfection for 48 h, semi-quantitative RT-PCR and western blot was employed to detect the knockdown efficiency of these siRNA duplexes. Only the siRNA duplexes with the highest knockdown efficiency were used for subsequent studies. Briefly, an amount of 152 pmol given siRNA duplexes was transfected into the chicken preadipocytes cultured in each well of 6-well culture plate using FuGENE HD transfection reagent (Promega). After transfection for 48 h, western blot and real-time RT-PCR were recruited to study the effect of KLF2 knockdown on C/EBPZ expression.

Table 2.

The siRNA sequences used for KLF2 knockdown.

Name	Sense (5′→3′)	Antisense (5′→3′)
siRNA-KLF2-1	GAGAAAGCGCUCCACGAAATT	UUUCGUGGAGCGCUUUCUCTT
siRNA-KLF2-2	GGAGGCUUCUACCAGACAATT	UUGUCUGGUAGAAGCCUCCTT
siRNA-KLF2-3	GCCCUGAGAUGGACUCCAATT	UUGGAGUCCAUCUCAGGGCTT
siRNA-NC	CCAAGAGCAGCUCCUUUAATT	UUAAAGGAGCUGCUCUUGGTT

Open in a new tab

Western Blot

After transfection of the corresponding overexpression plasmid, the given siRNA duplexes used for KLF2 knockdown, or the mixture of siRNA duplexes used for KLF2 knockdown and pCMV-myc-KLF2 for 48 h, the cells were lysed in RIPA buffer (Beyotime, Shanghai, China). The BCA protein quantification kit (#P1511, Applygen, Beijing, China) was used to quantify the proteins. The cell lysates were boiled in 1× denaturing loading buffer for 5 min and then separated by 8 to 10% SDS-PAGE and transferred to nitrocellulose membrane (PALL Gelman Laboratory, Ann Arbor, MI). The loading amount of protein used for western blot is approximately 800 ng. After incubation with the primary antibodies against myc-tag (c-Myc Monoclonal Antibody #631206, 1:1,000; Clontech, Mountain View, CA), ACTB (anti-β actin mAB #TA-09, 1:1000; ZSGB-BIO, Beijing, China), HA-tag [HA-tag (C29F4) rabbit mAB #3742, 1:1,000; Cell Signaling Technology, Danvers, MA] or C/EBPZ [Rabbit anti-CBF (CEBPZ) (C-term) Polyclonal Antibody #abs106120, 1:1,000; Absin, Shanghai, China] overnight at 4ºC, the membranes were washed and followed by incubation with a corresponding horseradish peroxide-conjugated secondary antibody (1:10,000; TransGen Biotech, Beijing, China). At last, an ECL Plus kit (#WBKLS0100, Millipore, MA) was used for detection, and Tanon 5200 Multi Fully Automatic Chemiluminescence/Fluorescence Image Analysis System (Tanon, Shanghai, China) was used to get images. The quantitative analysis of proteins was conducted using Image J software.

Quantitative Reverse Transcription PCR

Approximately 1 × 10⁶ chicken preadipocytes were passage into one well of the 6-well cell culture plate. Once the cellular confluence reached a range of 70% to 80%, the given plasmids or siRNA were transfected. After transfection for 48 h, the cells were rinsed 3 times with PBS and subsequently gathered in 1 mL of TRK Lysis buffer (OMEGA, Norcross, GA) supplemented with β-Mercaptoethanol cocktail (Gibco, Waltham, MA). RNA was extracted using total RNA extraction kit (#R6834-01; OMEGA). The RNA quality was assessed by formaldehyde denaturation gel electrophoresis. The RNA concentration and purity were assessed using a Nanodrop spectrophotometer (Thermo Scientific). The RNA concentration was determined by measuring the OD260 value, while the purity of the RNA was assessed by comparing the ratios of OD260/OD280. Only the RNA with OD260/OD280 ratios ranging from 1.9 to 2.0 was utilized.

Reverse transcription was performed using 1 μg total RNA, an oligo (dT) anchor primer, and ImProm-II reverse transcriptase (Promega). The primers used in semi-quantitative RT-PCR and real-time PCR (Table 3) were synthesized by Sangon Biotech company. Semi-quantitative RT-PCR was performed with premix Taq version 2.0 plus dye (Takara, Dalian, China) in a 25-μL system, and the amplification conditions were shown in Table 4. A volume of 10 μL of PCR products with DNA loading buffer was utilized for electrophoresis on a 1% agarose gel, and Tanon 5200 Multi Fully Automatic Chemiluminescence/Fluorescence Image Analysis System (Tanon) was used to get images. The quantitative analysis of proteins was conducted using Image J software.

Table 3.

Primers used for RT-qPCR analysis.

Gene	GenBank accession	Oligonucleotides (5′-3′)
C/EBPZ	NM_001031060	F: GGCCCAGACCTTAACAATGA
C/EBPZ	NM_001031060	R: GTCAAACTTGGACCCAGCAT
KLF2	JQ687128	F: ATACCATCCTGCCCTCCTTC R: CTGCCCATGGAAAGGATAAA
ACTB	NM_205518	F: TCTTGGGTATGGAGTCCTG R: TAGAAGCATTTGCGGTGG
GAPDH	NM_204305	F: CTGTCAAGGCTGAGAACG
GAPDH	NM_204305	R: GATAACACGCTTAGCACCA

Open in a new tab

Table 4.

Conditions for semi-quantitative reverse transcription-PCR.

Gene	Initial denaturation	Denaturation	Annealing	Extension	Cycle number	Final extension
C/EBPZ	95°C for 7 min	95°C for 30 s	57°C for 30 s	72°C for 30 s	33	72°C for 7 min
KLF2	95°C for 7 min	95°C for 30 s	61℃ for 30 s	72°C for 30 s	31	72°C for 7 min
GAPDH	95°C for 7 min	95°C for 30 s	58°C for 30 s	72°C for 30 s	25	72°C for 7 min

Open in a new tab

Real-time PCR was performed using the SYBR Premix Ex Taq (Takara) on a 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA). The GAPDH or ACTB were used as reference genes. In real time PCR analysis, the relative amounts of transcripts were calculated using 2^−ΔΔCt method, and the cells transfected with siRNA-NC were assigned as calibration sample for ΔΔCT calculation. The samples from a batch of cells were treated as a biological replicate, and all reactions were performed in triplicate.

Luciferase Reporter Assay

Approximately 2.5 × 10⁵ cells were seeded into each well of the 24-well culture plate, respectively. After 12 to 24 h, once the cellular confluence reached a range of 70% to 80%, the cells were transfected. The transfection system was shown in Table 5. In addition, 5 kinds of plasmids mixtures of pCMV-myc-KLF2 and pCMV-myc were used to investigate the dose effect of KLF2 overexpression on the promoter activity of chicken C/EBPZ (-94/+6). The mass ratios of pCMV-myc: pCMV-myc-KLF2 in these plasmid mixtures were 3:0, 2:1, 1:1, 1:2, 0:3, respectively. After transfection for 48 h, Luciferase activity was measured by the Dual Luciferase Assay system (Promega) on a Varioskan Flash 5250030 spectral scanning multimode reader (Thermo Scientific). In general, firefly luciferase activity was normalized to Renilla luciferase activity (Luc/Rluc), however, when the base activities of C/EBPZ autonomous promoters were studied, the un-normalized firefly luciferase activities (LUC) were also demonstrated simultaneously. The biological replicate was defined as the cells in a single well, and all reactions were performed in triplicate or quadruplicate.

Table 5.

The components of transfection mixtures for luciferase reporter assay (per well).

	C/EBPZ promoter reporter plasmids	pRL-TK¹	Other plasmids or double-stranded siRNA duplexes
Promoter analysis	500 ng	25 ng	0 ng
Regulation analysis	200 ng	10 ng	EV or Overexpression Plasmids²: 300 ng/Double-stranded siRNA duplexes: 22.5 pmol
Dose effect analysis	200 ng	10 ng	Plasmid mixture³: 300 ng

Open in a new tab

From Promega.

The empty vector (EV) was pCMV-myc or pCMV-HA, and the overexpression plasmids were pCMV-myc-GATA2 (GATA2), pCMV-myc-GATA3 (GATA3), pCMV-myc-KLF2 (KLF2), pCMV-myc-KLF3 (KLF3) and pCMV-HA-C/EBPZ (C/EBPZ).

Five plasmids mixtures of pCMV-myc-KLF2 and pCMV-myc were used, and the mass ratios of pCMV-myc-KLF2 and pCMV-myc were 3:0, 2:1, 1:1, 1:2, and 0:3, respectively.

Chromatin Immunoprecipitation-PCR

A SimpleChIP Plus Enzymatic Chromatin IP Kit (Agarose Beads, #9004; Cell Signaling Technology) was used to conducted ChIP experiment. Briefly, chicken preadipocytes transfected with pCMV-Myc-KLF2 for 48 h were digested with micrococcal nuclease digestion and ultrasonic fragmentation to obtained 100 to 900 bp DNA/protein fragments. The samples were immunoprecipitated with myc-tag antibody (Myc Monoclonal Antibody #631206; Clontech) to analyze the binding of KLF2 to C/EBPZ promoter, and the samples immunoprecipitated with mouse IgG (Beyotime) were used as negative control. The 2% nonimmunoprecipitated DNA was used as input. The purified DNA was amplified by PCR with the primers shown in Table 6, and results were displayed by agarose gel electrophoresis. A volume of 10 μL of PCR products with DNA Loading Buffer was utilized for electrophoresis on a 1% agarose gel, and Tanon 5200 Multi Fully Automatic Chemiluminescence/Fluorescence Image Analysis System (Tanon) was used to capture images. The quantitative analysis of bands was conducted using Image J software. The biological replicate referred to the cells of a single batch, and all reactions were performed twice.

Table 6.

Primers used for ChIP-PCR analysis.

Name	Oligonucleotides (5′-3′)	Product (bp)
C/EBPZ(-1,245/-1,048)	F: TGCTCGTCACCTCTCCAAAT R: CGGAGTACATGCGGGAAG	198
C/EBPZ-(-571/-397)	F: CAGATGGTGTCCCAGGCTAT	193
C/EBPZ-(-571/-397)	R: CAGAACCTGTGTGGATGTGG	193
C/EBPZ-(-163/+2)	F: GTGACAGGGAAGCCGATG	166
C/EBPZ-(-163/+2)	R: ATGGCAGGCTGCAGGAAG	166

Open in a new tab

DNA Pull Down

Approximately 1 × 10⁶ chicken preadipocytes were plated into a well of 6-well culture plate, and the cells were harvested when the cellular confluence reached a range of 70% to 80%. Nucleoproteins extracted from chicken preadipocytes using NE-PER Nuclear and Cytoplasmic Extraction Reagents (#78833; Thermo Fisher, Waltham, MA) and chicken C/EBPZ (−173/ +6) containing biotin on 5′ nucleotide were used in DNA pull-down assays. The DNA pull down and LC-MS/MS analysis were performed by GeneCreate Biotech company (Wuhan, China). The DNA pull down sample was initially subjected to analysis using SDS-PAGE gel electrophoresis, and then the resultant colloid was used for LC-MS/MS analysis. The Ultraflex III mass spectrometer (Bruker, Germany) was utilized in LC-MS/MS analysis, employing the parameter settings of reflection mode. The ion source acceleration voltage 1 was 24 kilovolts (kV), the acceleration voltage 2 ranged from 2 to 22 kV, the ion delayed extraction was 0.000 nanoseconds (ns), and the vacuum degree was 1.4 × 10⁻⁷ Torr. The mass spectrometry signals were accumulated 200 times for a single scan. The mass spectrometry peak was corrected using the standard Maker peak as the external standard. Positive ion spectroscopy was performed with a determination range controlled between 700 and 4,000. The peptide mass fingerprinting analysis automatically excluded peaks corresponding to trypsin auto-degradation and impurities. The 5 peaks with the highest PMF intensities were analyzed by tandem mass spectrometry (peak intensities >300) using LIFT software.

In Silico Analysis

The TATA boxes, initiator elements, GC boxes and KLF2 binding sites were predicted using the matrix of TATA-box HMM trained from 600 unrelated vertebrate promoter sequences (https://epd.expasy.org/epd/promoter_elements.php), the cap signal base frequency table (https://epd.expasy.org/epd/promoter_elements/init.php), GC-box base frequency table (https://epd.expasy.org/epd/promoter_elements/gc.php) and the matrix of KLF2 binding sites (https://jaspar.genereg.net/matrix/MA1515.1/), respectively, with a Hidden Markov model as follow:

S = \prod_{i = 1}^{n} p (i) / m a x S .

Where S is the prediction score by hidden Markov model, p(i) is the probability of occurrence of given base referred to scoring matrix, and maxS is the score from ideal sequence in which bases at all positions had the maximum probability. Bootstrap tests are used to test the robustness of predictions. Briefly, the sequence tested was disrupted for 1,000 times, and the prediction scores were calculated. If the scores at N times of disruption were higher than the score before it was disrupted, the P value was N/1,000.

The promoter predictions were performed by Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html) and Promoter 2.0 Prediction Server (https://services.healthtech.dtu.dk/service.php?Promoter-2.0). CpG island was predicted by EMBOSS Cpgplot (https://www.ebi.ac.uk/Tools/seqstats/emboss_cpgplot/).

Correlation between the transcripts of KLF2 and C/EBPZ in 54 kinds of normal human tissues in GTEx projects was studied using the Spearman rank correlation tests of GEPIA online tool.

Statistical Analysis

The normality of data was studied by Shapiro-Wilk test. The difference between 2 groups were analyzed using 2 tailed Student's t test or Wilcoxon rank sum test. The differences in more than 2 groups were analyzed using ANOVA test, and comparisons among more than 2 groups were performed by Duncan's multiple tests. Dunnett's test was used to examine the comparison between many experimental groups and a single control group.

The relationship between the dose effect of pCMV-myc-KLF2 transfected on the promoter activity of chicken C/EBPZ (−94/+6) was analyzed by Kendall rank correlation test. The transcripts data of C/EBPZ and KLF2 in chicken abdominal adipose tissue were obtained from the our previously published literatures (Zhang et al., 2014a; Chen et al., 2022), and only the KLF2 and C/EBPZ transcripts data of the same individuals were used for correlation analysis by Spearman rank tests.

All the statistical analyses were performed using the R software (version R 3.5.1). The data were presented as mean ± standard deviations (SD) and the differences were considered significant at P < 0.05 unless otherwise indicated.

RESULTS

Promoter Analysis of Chicken C/EBPZ

A 2,031 bp-long 5′ flanking sequence of chicken C/EBPZ (2025 nucleotides upstream to 6 nucleotides downstream from initiator codon, −2,025/+ 6) was studied as a candidate autonomous promoter in this study (Figure 1A). Bioinformatics analysis showed that there were predicted promoters, transcription start sites, TATA boxes, initiator elements, and CpG island in this sequence (Figure 1B). This sequence was constructed into pGL4.10 to get the resultant construct, pGL4.10-C/EBPZ (−2,025/+6). Compared with the promoter-less pGL4.10, the pGL4.10-C/EBPZ (−2,025/+6) showed a luciferase reporter activity in chicken preadipocytes (Figure 1C, P < 0.001).

Promoter activity analysis of chicken *C/EBPZ*. (A). The physical map of the 5′ flanking sequence of chicken *C/EBPZ*. (B). Bioinformatics analysis of chicken *C/EBPZ* (-2,025/+6). (C). Promoter activity of chicken *C/EBPZ* (-2,025/+6). Left, the firefly luciferase activity; Right, the relative luciferase activity (ratios of Firefly:Renilla). Error bars represented the SD of 4 biological replicates. *** P < 0.001 (Student's t test).

Identification of a Core Promoter of Chicken C/EBPZ

To delineate nucleotides required for C/EBPZ transcription, the luciferase reporter constructs containing sequences of chicken C/EBPZ (−1,409/+6, −793/+6, −485/+6, −173/+6 and −94/+6), respectively, were constructed according to 5′ deletion strategy (Figure 1A). Compared with cells transfected with pGL4.10, chicken preadipocytes transfected with the constructs of chicken C/EBPZ (−2,025/+6, −1,409/+6, −485/+6, −173/+6 and −94/+6), respectively, showed significant promoter activities (Figures 2A–2B, P < 0.001).

Truncated mutation analysis of chicken *C/EBPZ* (−2,025/+6). (A). The firefly luciferase activity of chicken *C/EBPZ* promoter constructs. (B). The relative activity (ratios of Firefly:Renilla) of chicken *C/EBPZ* promoter constructs. The plasmids of pGL3-basic and pGL3-promoter were used as negative and positive controls, respectively. The left showed the chicken *C/EBPZ* promoter constructs, and the right showed the luciferase activities. Error bars on right represented the SD of 4 biological replicates. Asterisks indicated significant differences between given group and negative control (**P < 0.01; *** P < 0.001; Dunnett's test). The uppercase letters above columns indicated significant differences in promoter activities among groups (Duncan's multiple tests, P < 0.01).

The data of relative activities (ratios of Firefly: Renilla) did not conform to normal distribution (W = 0.78147, P = 0.0001489), and Kruskal-Wallis tests showed that there were differences in relative activities among them (H = 20.03, P = 0.001234). Duncan's multiple tests showed that the cells transfected with pGL4.10-C/EBPZ (−2,025/+6) or pGL4.10-C/EBPZ (−173/+6) showed the greatest relative activities, the cells transfected with pGL4.10-C/EBPZ (−485/+6), pGL4.10-C/EBPZ (−1,409/+6) or pGL4.10-C/EBPZ (−94/+6) showed moderate relative activities, and the cells transfected with pGL4.10-C/EBPZ (−753/+6) showed the lowest relative activities (P < 0.01, Figure 2B).

DNA Pull-Down Analysis of Chicken C/EBPZ Promoter

DNA pull-down assay was used to study the interaction of chicken C/EBPZ (−173/+6, Figure 3A) with nucleoproteins of chicken preadipocytes. There were obvious differences in stripmaps between experimental (C/EBPZ probe and beads-treated chicken preadipocyte nucleoproteins) and control (beads-treated chicken preadipocyte nucleoproteins) groups (Figure 3B). Totally, 348 and 259 proteins were detected in experimental and control groups by LC-MS/MS assay, respectively (Supplementary Table 1). Venn diagram analysis showed that 189 proteins was specific in experimental group (Figure 3C and Supplementary Table 2).

Atlas of nucleoproteins combined with chicken *C/EBPZ* (-173 /+6). The nucleoproteins combined with chicken *C/EBPZ* (-173 /+6) was studied using DNA pull down-LC-MS/MS analysis in preadipocytes. (A) Probe sequence used in DNA pull down analysis. (B) Electrophoretic analysis of DNA pull down results. M, protein molecular weight marker; con, beads-treated chicken preadipocyte nucleoproteins; C/EBPZ, C/EBPZ probe and beads-treated chicken preadipocyte nucleoproteins; Input, untreated chicken preadipocyte nucleoproteins. (C) The summary of proteins detected by DNA pull down-LC-MS/MS analysis. (D) COG analysis of the proteins detected by DNA pull down-LC-MS/MS analysis. (E) Gene Ontology (GO) terms enrichment analysis of proteins specific to experimental group. (F) Pathway enrichment analysis of proteins specific to experimental group. The enriched terms and adjusted P values were showed, and the size of bubble dot denoted the number of genes. The pink bubbles symbolize the pathways from KEGG database, whereas the blue bubbles represent the pathways from Reactome database.

Clusters of Orthologous Groups (COG) analysis showed that the 348 proteins detected in experimental group were categorized in 22 functional ontologies. Briefly, most proteins were categorized in J (Translation, ribosomal structure and biogenesis) group, many proteins were categorized in L (Replication, recombination and repair), O (Posttranslational modification, protein turnover, chaperones), R (General function prediction only) and T (Signal transduction mechanisms) groups, and few proteins were categorized in X (Mobilome: prophages, transposons), W (Extracellular structures) and H (Coenzyme transport and metabolism) groups (Figure 3D and Supplementary Table 3).

The 189 proteins specific (Supplementary Table 2) were subjected to functional enrichment and protein-protein interaction (PPI) analysis. There were 13 gene ontology (GO) terms enriched at the level of adjusted P value < 0.01. They were the cellular component terms of nucleolus (GO:0005730), catalytic step 2 spliceosome (GO:0071013/GO:0071007), nuclear periphery (GO:0034399) and cytosolic large ribosomal subunit (GO:0022625); the molecular function terms of structure constituent of ribosome (GO:0003735), structure constituent of nuclear pore (GO:0017056) and RNA binding (GO:0003723); and the biological process terms of translation (GO:0006412/GO:0002181), protein import into nucleus (GO:0006606), nuclear pore complex assembly (GO:0051292) and maturation of LSU-rRNA from tricistronic rRNA transcript (GO:0000463). Interestingly, the GO term of TFIID−class transcription factor complex binding (GO:0001094) was significantly enriched (adjusted P = 0.04667, Figure 3E and Supplementary Table 4). In addition, 2 KEGG terms, ribosome (gga03010) and ribosome biogenesis in eukaryotes (gga03008), were enriched at the level of adjusted P value < 0.01 (Figure 3F). Thirteen Reactome terms were enriched at the level of adjusted P value < 0.01, namely, metabolism of RNA (R-GGA-8953854), transport of mature mRNA (R-GGA-159227/159230/159234/159236), transport of mature transcript to cytoplasm (R-GGA-72202), nonsense-mediated decay (R-GGA-975957/ 927802), processing of capped intron-containing pre-mRNA (R-GGA-72203), SUMOylation of proteins (R-GGA-3108232/ 2990846), post-translational protein modification (R-GGA-597592) and metabolism of proteins (R-GGA-392499) (Figure 3F). None PANTHER term was enriched at the level of P < 0.05 (Figure 3F and Supplementary Table 5). Additionally, PPI analysis showed that the hub proteins were mainly enriched in ribosome (GO:0005840), ribosome biogenesis (GO:0042254), ribosomal scanning and start codon recognition (R-GGA-72702), RNA polymerase II general transcription initiation factor binding (GO:0001091) and RNA transport (GO:0050658) (Figure 4).

Protein-protein interaction (**PPI**) analysis of the proteins specific to experimental group. The PPI analysis was conducted by STRING (Version: 11.5, https://cn.string-db.org/). The disconnected nodes in the network were hid. The interaction sources used included text mining, experiments, databases, coexpression, neighborhood, gene fusion, and co‑occurrence, and the required interaction scores were more than 0.9. Proteins displayed with the balls of green, yellow, blue, red and pink were involved in ribosome, ribosome biogenesis, ribosomal scanning and start codon recognition, RNA polymerase II general transcription initiation factor binding and RNA transport, respectively.

Chicken KLF2 Facilitated C/EBPZ Transcription

Our previous studies showed that GATA2, GATA3, KLF2, KLF3, and C/EBPZ act as regulatory factors in the chicken adipogenesis (Zhang et al., 2012; Zhang et al., 2014a; Zhang et al., 2014b; Chen et al., 2022). Nevertheless, it is unclear if these factors exert any influence on the transcription of C/EBPZ in chicken preadipocytes. In this study, the results demonstrated that the upregulation of KLF2 enhanced the promoter activity of chicken C/EBPZ (−2,025/+6), while the upregulation of KLF3 inhibited it, as compared to the EV group (P < 0.05, Figures 5A and 5B). However, the overexpression of GATA2, GATA3, or C/EBPZ did not have a significant effect on the promoter activity in chicken preadipocytes compared to the EV group (P > 0.05, Figures 5A and 5B). In addition, KLF2 overexpression facilitated the promoter activities of chicken C/EBPZ (−2,025/+6, −1,409/+6, −793/+6, −485/+6, −173/+6 and −94/+6) in preadipocytes (P < 0.05, Figure 5C). Additionally, the transfected dose of pCMV-myc-KLF2 was positively correlated with the promoter activity of chicken C/EBPZ (−94/+6; τ_b=0.6767764, P < 0.0001). ANOVA analysis showed that there were significant differences in promoter activities of chicken C/EBPZ (−94/+6) among different transfected doses of pCMV-myc-KLF2 (F = 18.43, P < 0.0001), and the cells transfected with pCMV-myc-KLF2 in any concentrations showed greater promoter activities of chicken C/EBPZ (−94/+6) than EV group (P < 0.01; Figure 5D).

KLF2 facilitated chicken *C/EBPZ* transcription. (A) Effect of overexpression of KLF2, KLF3, GATA2, GATA3 and C/EBPZ on the promoter activity of chicken *C/EBPZ* (-2,015/+6), respectively. The diagrams show the ratios of Firefly: Renilla luciferase activity, and error bars represented the SD of 4 biological replicates. Asterisks indicate significant difference between the given and its EV groups (*P < 0.05 and ***P < 0.001; Dunnett's Test). (B) Western blot analysis of myc-tag and HA-tag proteins in chicken preadipocytes after transfection for 48 h. (C) Effects of KLF2 overexpression on the promoter activities of chicken *C/EBP*Z (−2,025/+6, −1,409/+6, −793/+6, −485/+6, −179/+6, and −94/+6). The diagrams show the ratios of Firefly: Renilla luciferase activity, and error bars represented the SD of 3 biological replicates. Asterisks indicate significant difference between the given and its EV groups (*P < 0.05 and **P < 0.01; Student's t test). (D). Dose effect of KLF2 overexpression on the promoter activity of chicken *C/EBPZ* (−94/+6). The mass ratios of pCMV-myc: pCMV-myc-KLF2 in the plasmid mixtures (designated as 1 to 5) were 3:0, 2:1, 1:1, 1:2, 0:3, respectively. The diagrams show the ratios of Firefly: Renilla luciferase activity, and error bars represented the SD of 4 biological replicates. The different uppercase letters above columns indicated significant differences among groups (Duncan's multiple tests, P < 0.01). (E) The correlation of the transcripts of *KLF2* and *C/EBPZ* in chicken abdominal adipose tissue during development (n = 100, biological replicates). (F) Semi-quantitative RT-PCR analysis of *C/EBPZ* expression in chicken preadipocytes (n = 3, biological replicates). The Student's T test was used to analyze the differences between 2 groups. (G) Western blot analysis of C/EBPZ expression in chicken preadipocytes. (H). Semi-quantitative RT-PCR analysis of *C/EBPZ* expression in chicken preadipocytes (n = 3, biological replicates). The Dunnett's test was used to analyze the differences between the given group and the group of siRNA-NC. (I–J) Western blot analysis of C/EBPZ expression in chicken preadipocytes. (K) Real time-PCR analysis of *C/EBPZ* and *KLF2* expression in chicken preadipocytes. The diagrams show the relative expression of given gene, and error bars represented the SD of 3 biological replicates. (L) Effects of KLF2 knockdown on the promoter activity of chicken *C/EBP*Z (−2,025/+6). The diagrams show the ratios of Firefly: Renilla luciferase activity, and error bars represented the SD of 4 biological replicates. Note, the protein molecular weight marker was denoted as M. The cells transfected with empty vector (pCMV-myc or pCMV-HA) was labeled as EV. The labels of KLF2, KLF3, GATA2, GATA3, C/EBPZ, siRNA-NC, siRNA-KLF2-1, siRNA-KLF2-2, and siRNA-KLF2-3 were the cells transfected with pCMV-myc-KLF2, pCMV-myc-KLF3, pCMV-myc-GATA2, pCMV-myc-GATA3, pCMV-HA-C/EBPZ, siRNA-NC, siRNA-KLF2-1, siRNA-KLF2-2, and siRNA-KLF2-3, respectively. In parts of F–J, the numbers above bands were the expression data standardized with its control group.

Additionally, Spearman's rank test showed that the relative transcripts levels of KLF2 (KLF2/GAPDH) were significantly correlated with those of C/EBPZ (C/EBPZ/GAPDH) in chicken abdominal adipose tissue during development (r = 0.5978278, P < 0.0001; Figure 5E). Semiquantitative RT-PCR and western blot showed that KLF2 overexpression facilitated endogenous C/EBPZ expression in chicken preadipocytes (P < 0.05, Figures 5F–5H). Vice versa, real-time PCR, western blot and luciferase reporter assay showed that knockdown of KLF2 expression downregulated C/EBPZ expression in chicken preadipocytes (Figures 5I–5L).

The Combination of KLF2 With Chicken C/EBPZ Promoter

There were many predicted KLF2 binding sites in chicken C/EBPZ (−2,025 /+6), especially around nucleotide −1,101 or −485 (Figure 6B). In addition, a special attention was paid to nucleotides −94/+6 because KLF2 facilitated its promoter activity. ChIP-PCR were employed to study the combination of KLF2 with these 3 regions (Figure 6A). Agarose gel electrophoresis showed that the DNA sizes of DNA/protein fragments after ultrasonic fragmentation were mainly between 100 bp and 250 bp (Figure 6C) and suitable for ChIP analysis. ChIP-PCR showed that the nucleotides −1,245/−1,048 and −571 / −397 were highly enriched in the experimental group immunoprecipitated with myc-tag antibody than in the negative control group immunoprecipitated with IgG (Figure 6D).

The CGCAGCGCCCG Motif Might be a Target Site for KLF2

GC box was the Sp1 binding site and a common element in core promoter (Dynan and Tjian, 1985). The nucleotides −45/−35 (CGCAGCGCCCG) was predicted as a GC box and KLF2 binding site (Figure 6B), and it was mutated into ‘CGGTATCTGCG’ in mut-pGL4.10-C/EBPZ (−94/+6, Figure 7A). The mutated construct showed a lower promoter activity than its wild type (P < 0.05, Figure 7B). After transfection for 48 h, western blot analysis showed that cells transfected with pCMV-myc-KLF2 expressed myc-tag KLF2 protein, while cells transfected with the pCMV-myc did not express this protein (Figure 7E). Luciferase assay showed that KLF2 overexpression facilitated promoter activities of both mutated and wild-type constructs in chicken preadipocytes (P < 0.05, Figures 7C–7E). However, the facilitated action of KLF2 overexpression on the wild-type construct was greater than that on its mutated counterpart (P < 0.05, Figure 7D).

The CGGGCGCTGCG motif inflected promoter activity of chicken *C/EBPZ* (-94/+6). (A). The inserted sequences of pGL4.10-*C/EBPZ* (94/+6) and its mutation construct, mut-pGL4.10-*C/EBPZ* (94/+6). (B). The promoter activities of chicken *C/EBPZ* (94/+6) and its mutation counterpart in chicken preadipocytes. The promoter activities were expressed as the ratios of Firefly: Renilla luciferase activity. The error bars represented the SD of 4 biological replicates. (C). The effects of KLF2 overexpression on the promoter activities of chicken *C/EBPZ* (94/+6) and its mutation version. The promoter activities were expressed as the ratios of Firefly: Renilla luciferase activity. The error bars represented the SD of 3 or 4 biological replicates. (D). The promoter activities in part C normalized by the average value of EV group. The error bars represented the SD of 3 or 4 biological replicates. (E). Western blot analysis of myc-tag protein in chicken preadipocytes. The label of M represented protein molecular weight marker. The labels of EV and KLF2 represented the cells transfected with pCMV-myc and pCMV-myc-KLF2 after 48 h, respectively. Asterisks indicated significant differences between the 2 given groups (** P < 0.01; *** P < 0.001; *** P < 0.0001; Student's t test).

DISCUSSION

Cis-Elements Analysis of Chicken C/EBPZ Promoter

To date, despite great ongoing progress in the control of adipogenesis (Mota et al., 2017), identifying novel mechanism remains an important goal. Our previous studies identified chicken C/EBPZ was a new regulator of adipogenesis and differentially expressed in the abdominal adipose tissues of lean and fat broilers during development (Chen et al., 2022). The aim of this study is to reveal the transcriptional control of C/EBPZ expression in chicken adipose tissue.

A distinct promoter activity and some predicted signals of promoter and transcription start site were detected in the sequence of chicken C/EBPZ (−2,025/+6), indicated that it contains necessary cis-elements supporting transcription. TATA boxes and initiator elements, the 2 important elements for eukaryotic RNA polymerase II promoter (Butler and Kadonaga, 2002; Kadonaga et al., 2012), and a CpG island (−702/−49), the most vertebrate promoter regions carry enrichment for (Saxonov et al., 2006; Deaton and Bird, 2011), were found in this sequence, illustrated that the sequence of chicken C/EBPZ (−2,025/+6) was an autonomous promoter.

The autonomous promoter function is assigned by sequences of core promoter and other cis regulatory elements (Haberle and Stark, 2018). The core promoter is a short DNA sequence around transcription start site, which is sufficient to assemble the transcription mechanism of RNA polymerase II and guide the transcription start (Roeder, 1996), and typically spans between −50 and +50 relative to transcription start site (Muller and Tora, 2014). The nucleotides -94 to +6 showed a measurable promoter activity, indicated that it might sever as a core promoter for C/EBPZ transcription. The TATA boxes and CpG islands had been used for core promoter classification, and corresponded to the promoters of “focused” or “sharp” type and “dispersed” or “extensive” type, respectively (Haberle and Stark, 2018). There was no TATA box but a CpG island in chicken C/EBPZ (-94/+6), suggested that it is a “dispersed” or “broad” promoter, consistent with the ubiquitous tissue-expression pattern of chicken C/EBPZ (Chen et al., 2022; Li et al., 2021).

The promoter activities were different among the 5′ flanking sequences of chicken C/EBPZ, suggested that other transcriptional cis elements existed. In detail, the nucleotides −2,025/−793 and −173/ −94 might be facilitated for transcription, and the nucleotides −793/−485 might be inhibitory for transcription. Core-promoter motifs in enhancer may have promoter function (Mikhaylichenko et al., 2018), TATA-box and initiator element were detected in transcriptional facilitating sequence of chicken C/EBPZ (-2,025/-793), indicated that a "focused" or "sharp" core promoter might exist in this sequence and it might be activated under some conditions. However, more research needs to test this.

Atlas of Nucleoproteins Combined With Chicken C/EBPZ Promoter

To further reveal the mechanism of C/EBPZ expression control in chicken preadipocytes, the atlas of nucleoproteins combined with the sequence of chicken C/EBPZ (−173/+6) was studied using DNA pull-down and LC-MS/MS assays. The proteins specifically detected on chicken C/EBPZ (−173/+6) were subjected to function enrichment and PPI analysis. Seven of the 13 GO terms enriched at the level of adjusted P < 0.01 were associated with structure or function of nucleus, namely, nucleolus (GO:0005730), catalytic step 2 spliceosome (GO:0071013/GO:0071007), nuclear periphery (GO:0034399), structure constituent of nuclear pore (GO:0017056), protein import into nucleus (GO:0006606), and nuclear pore complex assembly (GO:0051292), in line with the nucleoproteins used in this study.

The general transcription factor IID (TFIID) nucleates pre-initiation complex assembly at core promoter and plays a crucial role in the initiation of RNA polymerase II-dependent transcription (Louder et al., 2016). The GO term of TFIID−class transcription factor complex binding (GO:0001094) was significantly enriched, and the hub proteins of PPI were enriched in the term of RNA polymerase II general transcription initiation factor binding (GO:0001091), provided another evidence to support that a core promoter was in the sequence of chicken C/EBPZ (−173/+6).

RNA processing affects post-transcriptional mechanisms and plays a role in translating genotype to phenotype (Manning and Cooper, 2017). Eleven terms (2 GO and 9 Reactome terms) enriched at the level of adjusted P < 0.01 were associated with RNA processing, namely catalytic step 2 spliceosome (GO:0071013/GO:0071007), metabolism of RNA (R-GGA-8953854), transport of mature mRNA (R-GGA-159227/159230/159234/159236), transport of mature transcript to cytoplasm (R-GGA-72202), nonsense-mediated decay (NMD) (R-GGA-975957/927802), and processing of capped intron-containing pre-mRNA (R-GGA-72203). In addition, the hub proteins of PPI were enriched in RNA transport (GO:0050658). These results suggested that information in cis that acts in post-transcriptional regulation existed in the sequence of chicken C/EBPZ (−173/+6).

Translation of the genetic code on mRNA into protein is performed on the ribosome (Ramakrishnan, 2002). Five of the 13 GO terms enriched at the level of adjusted P < 0.01 were associated with translation or ribosome, namely translation (GO:0006412/GO:0002181), cytosolic large ribosomal subunit (GO:0022625), structure constituent of ribosome (GO:0003735) and maturation of LSU-rRNA from tricistronic rRNA transcript (GO:0000463). Additionally, the hub proteins of PPI were enriched in the terms of ribosome (GO:0005840), ribosome biogenesis (GO:0042254) and ribosomal scanning and start codon recognition (R-GGA-72702). These results showed that the sequence of chicken C/EBPZ (-173/+6) was involved in translation, consistent with that Kozak motif (Kozak, 1987) and part of coding sequences existed in this sequence.

Post-translational modifications can modify components of the transcription machinery and the surrounding nucleosomes, and small ubiquitin-like modification (SUMOylation) associated with repressor complexes and modulate transcription regulation (Garcia-Dominguez and Reyes, 2009). Reactome terms of SUMOylation of proteins (R-GGA-3108232/2990846), post-translational protein modification (R-GGA-597592), and metabolism of proteins (R-GGA-392499) were enriched at the level of adjusted P < 0.01, suggested that post-translational protein modification, especially SUMOylation, might control C/EBPZ transcription by modification of trans factors targeting the sequence of chicken C/EBPZ (−173/ +6).

KLF2 Facilitated Chicken C/EBPZ Transcription

To gain a better understanding of the regulation mechanism of C/EBPZ transcriptional, the effect of KLF2, KLF3, GATA2, GATA3 and C/EBPZ on the C/EBPZ transcription were further studied in chicken preadipocytes. Among these 5 transcription factors, only the overexpression of KLF2 or KLF3 had a significant effect on the promoter activity of chicken C/EBPZ (−2,025/+6) as compared to the EV group, and overexpression of KLF2 had a greater significance on this promoter than that of KLF3 from the P-value perspective, indicated that KLF2 might be a specific regulator of C/EBPZ transcription.

Consistent with that KLF2 overexpression facilitated the promoter activity of chicken C/EBPZ (−2,025/+6) in chicken preadipocytes, KLF2 transcripts were positively correlated with those of C/EBPZ in chicken abdominal adipose tissue during development. Additionally, KLF2 facilitated endogenous C/EBPZ expression in vitro. These results indicated that KLF2 promotes C/EBPZ transcription in adipose tissue. Both KLF2 and C/EBPZ inhibited chicken adipogenesis (Zhang et al., 2014a; Chen et al., 2022), it is possible that upregulation of C/EBPZ expression might be another way of KLF2 to inhibit chicken adipogenesis.

Combination with cis elements is a way of transcription factors to regulate transcription (Morgan et al., 2007). Krüppel-like factors2 is a member of Sp1-like and Krüppel-like factors (Sp1/KLFs) (Kaczynski et al., 2003). Most Sp1-like/KLF proteins have similar affinities for different GC-rich sites, and KLFs preferentially bind the 5′-CACCC-3′ motif (Kaczynski et al., 2003). Methylation of CpG did not influence the combination of KLF2 to DNA (Yin et al., 2017). There were predicted KLF2 binding sites and GC box in chicken C/EBPZ (−2,025/+6). ChIP-PCR analysis showed that KLF2 enriched in the nucleotides −1,245/−1,048 and −571/−397, indicated that KLF2 could combine with chicken C/EBPZ promoter to facilitate C/EBPZ transcription.

Krüppel-like factors2 overexpression facilitated the promoter activities of chicken C/EBPZ (−2,025 /+6, −1,409 /+6, −793/+6, −485/+6, −173/+6, and −94/+6), and its facilitation on the promoter activity of chicken C/EBPZ (−94/+6) was dose-dependent, indicated that KLF2 could regulate C/EBPZ transcription at least by acting on nucleotides −94/+6. The ‘CGCAGCGCCCG’ motif (−45/−35) was studied as a target of KLF2, and the mutation in this motif impaired either the promoter activity of chicken C/EBPZ (−94/+6) or the facilitation of KLF2 on this promoter in vitro, indicated that this motif might play a role in chicken C/EBPZ transcription control and mediated the facilitation of KLF2 partly. In addition, bioinformatics analysis and western blot analysis showed the regulation of KLF2 on C/EBPZ transcription might exist in human being too (Supplementary Figure 1), indicated that the facilitation of KLF2 on C/EBPZ expression might be conserved in higher vertebrates.

In conclusion, this study discovered an autonomous promoter of chicken C/EBPZ, provided some information in cis and trans that acts in this promoter, and demonstrated that KLF2 increased C/EBPZ transcription in chicken preadipocytes (Figure 8). The mechanism that controls the transcription of C/EBPZ in chicken preadipocytes discovered in this study might aid in the breeding of low-fat broilers and the identification of food additives that can control abdominal fat, which has the potential to increase profitability in the poultry industry. In addition, this study also augments understanding of the molecular pathways behind clinical conditions associated with obesity using chicken as a model animal.

Schematic diagram of molecular mechanism and biologic role of *C/EBPZ* expression control in chicken preadipocytes. (A) Function annotation of chicken *C/EBPZ* (-2,025/+6). (B) The relationship between C/EBPZ and KLF2 in chicken adipogenesis. (C) Summary of nucleoproteins combined with chicken *C/EBPZ* (-173 /+6).

Supplementary Table 1 The proteins detected in the DNA pull-down-LC-MS/MS assay of chicken C/EBPZ (−173/+6) with nucleoproteins of chicken preadipocytes. C/EBPZ and Con represents the experimental and control groups, respectively.

ACKNOWLEDGMENTS

This study was supported by the grant from the National Natural Science Foundation of China (No. 32360825, 31960647 and 31501947) and Youth Innovative Talents Project of Shihezi University (No. CXBJ201905 and ZZZC202183).

Ethics Declaration: All animal experiments were approved by the Animal Experiment Ethics Committee of the First Affiliated Hospital of Shihezi University Medical School (Approval number: A2019-009-01).

DISCLOSURES

The authors declare that they have no competing interests.

Footnotes

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.103540.

Appendix. Supplementary materials

Supplementary Table 2 The 189 proteins specific detected in the DNA pull-down-LC-MS/MS assay of chicken C/EBPZ (−173/+6) with nucleoproteins of chicken preadipocytes.

mmc1.csv^{(72.5KB, csv)}

Supplementary Table 3 Clusters of Orthologous Groups (COG) analysis of the total 348 proteins detected in experimental group and the 189 proteins specific detected in experimental group, respectively.

mmc2.csv^{(57.2KB, csv)}

Supplementary Table 4 Gene Ontology (GO) enrichment analysis of the 189 proteins specific detected in experimental group of DNA pull-down-LC-MS/MS assay.

mmc3.pdf^{(632.8KB, pdf)}

Supplementary Table 5 Pathway enrichment analysis of the 189 proteins specific detected in experimental group of DNA pull-down-LC-MS/MS assay.

mmc4.csv^{(459.5KB, csv)}

Supplementary Figure 1 Effect of KLF2 overexpression on human C/EBPZ expression. (A) Correlation analysis of the transcripts of KLF2 and C/EBPZ in 54 kinds of normal human tissues in GTEx projects using the GEPIA online tool. (B) Prediction of KLF2 binding sites in human C/EBPZ (the 5′ flanking sequence -2,031 to +1 upstream the coding sequence, -2,031/+1) using hidden Markov model. (C) Alignment of human C/EBPZ (-219/+6) and chicken C/EBPZ (-209/+6). (D) Western blot analysis of C/EBPZ expression in ECa109 cells. The label of M represented protein molecular weight marker. The labels of EV and KLF2 represented the cells transfected with pCMV-myc and pCMV-myc-KLF2 after 48 h.

mmc5.csv^{(20.5KB, csv)}

mmc6.csv^{(4.4KB, csv)}

REFERENCES

Andersen J.S., Lyon C.E., Fox A.H. Directed proteomic analysis of the human nucleolus. Curr. Biol. 2002;12:1–11. doi: 10.1016/s0960-9822(01)00650-9. [DOI] [PubMed] [Google Scholar]
Baltz A.G., Munschauer M., Schwanhausser B., Vasile A., Murakawa Y., Schueler M., Landthaler M. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol. Cell. 2012;46:674–690. doi: 10.1016/j.molcel.2012.05.021. [DOI] [PubMed] [Google Scholar]
Barbieri I., Tzelepis K., Pandolfini L., Shi J., Millán-Zambrano G., Robson S.C., Kouzarides T. Promoter-bound METTL3 maintains myeloid leukaemia by m(6)A-dependent translation control. Nature. 2017;552:126–131. doi: 10.1038/nature24678. [DOI] [PMC free article] [PubMed] [Google Scholar]
Butler J.E., Kadonaga J.T. The RNA polymerase II core promoter: a key component in the regulation of gene expression. Genes Dev. 2002;16:2583–2592. doi: 10.1101/gad.1026202. [DOI] [PubMed] [Google Scholar]
Castello A., Fischer B., Eichelbaum K., Horse R., Beckmann B.M., Strein C., Hentze M.W. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 2012;149:1393–1406. doi: 10.1016/j.cell.2012.04.031. [DOI] [PubMed] [Google Scholar]
Chait A., Laura J., Hartigh D. Adipose tissue distribution, inflammation and its metabolic consequences, including diabetes and cardiovascular disease. Front. Cardiovasc. Med. 2020;7:22. doi: 10.3389/fcvm.2020.00022. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chen Y.C., Gao L.Y., Lin T., Pei X.L., Gao Q., Chen J.J., Zhang Z.W. C/EBPZ modulates the differentiation and proliferation of preadipocytes. Int. J. Obesity. 2022;46:523–534. doi: 10.1038/s41366-021-01020-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
Deaton A.M., Bird A. CpG islands and the regulation of transcription. Genes. Dev. 2011;25:1010–1022. doi: 10.1101/gad.2037511. [DOI] [PMC free article] [PubMed] [Google Scholar]
Dupont J., Tesseraud S., Simon J. Insulin signaling in chicken liver and muscle. Gen. Comparative Endocrinol. 2009;163:52–57. doi: 10.1016/j.ygcen.2008.10.016. [DOI] [PubMed] [Google Scholar]
Dynan W.S., Tjian R. Control of eukaryotic messenger RNA synthesis by sequence-specific DNA-binding proteins. Nature. 1985;316:774–778. doi: 10.1038/316774a0. [DOI] [PubMed] [Google Scholar]
Garcia-Dominguez M., Reyes J.C. SUMO association with repressor complexes, emerging routes for transcriptional control. Biochim Biophys Acta. 2009;1789:451–459. doi: 10.1016/j.bbagrm.2009.07.001. [DOI] [PubMed] [Google Scholar]
Ghaben A.L., Scherer P.E. Adipogenesis and metabolic health. Nat. Rev. Mol. Cell Biol. 2019;20:242–258. doi: 10.1038/s41580-018-0093-z. [DOI] [PubMed] [Google Scholar]
Gordon D.E., Hiatt J., Bouhaddou M., Rezelj V.V., Ulferts S., Braberg H., Dorward M. Comparative host-coronavirus protein interaction networks reveal pan-viral disease mechanisms. Science. 2020;370:e9403. doi: 10.1126/science.abe9403. [DOI] [PMC free article] [PubMed] [Google Scholar]
Haberle V., Stark A. Eukaryotic core promoters and the functional basis of transcription initiation. Nat. Rev. Mol. Cell Biol. 2018;19:621–637. doi: 10.1038/s41580-018-0028-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
Herold T., Metzeler K.H., Vosberg S., Hartmann L., Röllig C., Stölzel F., Greif P.A. Isolated trisomy 13 defines a homogeneous AML subgroup with high frequency of mutations in spliceosome genes and poor prognosis. Blood. 2014;124:1304–1311. doi: 10.1182/blood-2013-12-540716. [DOI] [PubMed] [Google Scholar]
Imbriano C., Bolognese F., Gurtner A., Piaggio G., Mantovani R. HSP-CBF is an NF-Y-dependent coactivator of the heat shock promoters CCAAT boxes. J. Biol. Chem. 2001;276:26332–26339. doi: 10.1074/jbc.M101553200. [DOI] [PubMed] [Google Scholar]
Kaczynski J., Cook T., Urrutia R. Sp1- and Kruppel-like transcription factors. Genome. Biol. 2003;4:206. doi: 10.1186/gb-2003-4-2-206. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kadonaga J.T. Perspectives on the RNA polymerase II core promoter. Wiley Interdiscip. Rev. Dev. Biol. 2012;1:40–51. doi: 10.1002/wdev.21. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kozak M. At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 1987;196:947–950. doi: 10.1016/0022-2836(87)90418-9. [DOI] [PubMed] [Google Scholar]
Li Z., Liu X., Li Y., Wang W., Wang N., Xiao F., Wang S. Chicken C/EBPζ gene: expression profiles, association analysis, and identification of functional variants for abdominal fat. Domest. Anim. Endocrinol. 2021;76 doi: 10.1016/j.domaniend.2021.106631. [DOI] [PubMed] [Google Scholar]
Louder R.K., He Y., López-Blanco J.R., Fang J., Chacón P., Nogales E. Structure of promoter-bound TFIID and model of human pre-initiation complex assembly. Nature. 2016;531:604–609. doi: 10.1038/nature17394. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lum L.S., Sultzman L.A., Kaufman R.J., Linzer D.I., Wu B.J.A. cloned human CCAAT-box-binding factor stimulates transcription from the human hsp70 promoter. Mol. Cell Biol. 1990;10:6709–6717. doi: 10.1128/mcb.10.12.6709. [DOI] [PMC free article] [PubMed] [Google Scholar]
Manning K.S., Cooper T.A. The roles of RNA processing in translating genotype to phenotype. Nat. Rev. Mol. Cell Biol. 2017;18:102–114. doi: 10.1038/nrm.2016.139. [DOI] [PMC free article] [PubMed] [Google Scholar]
Mikhaylichenko O., Bondarenko V., Harnett D., Schor I.E., Males M., Viales R.R., Furlong E.E. The degree of enhancer or promoter activity is reflected by the levels and directionality of eRNA transcription. Genes Dev. 2018;32:42–57. doi: 10.1101/gad.308619.117. [DOI] [PMC free article] [PubMed] [Google Scholar]
Morgan X.C., Ni S., Miranker D.P., Iyer V.R. Predicting combinatorial binding of transcription factors to regulatory elements in the human genome by association rule mining. BMC Bioinform. 2007;8:1–14. doi: 10.1186/1471-2105-8-445. [DOI] [PMC free article] [PubMed] [Google Scholar]
Mota D.S.P., Richard A.J., Hang H. Transcriptional regulation of adipogenesis. Compr. Physiol. 2017;7:635–674. doi: 10.1002/cphy.c160022. [DOI] [PubMed] [Google Scholar]
Muller F., Tora L. Chromatin and DNA sequences in defining promoters for transcription initiation. Biochim. Biophys. Acta. 2014;1839:118–128. doi: 10.1016/j.bbagrm.2013.11.003. [DOI] [PubMed] [Google Scholar]
Namya M., Christelle R., Alix B., Grandhaye J., Froment P., Dupont J. Chicken is a useful model to investigate the role of adipokines in metabolic and reproductive diseases. Int. J. Endocrinol. 2013;2018 doi: 10.1155/2018/4579734. [DOI] [PMC free article] [PubMed] [Google Scholar]
Pulido-Salgado M., Vidal-Taboada J.M., Saura J. C/EBPβ and C/EBPδ transcription factors: basic biology and roles in the CNS. Prog. Neurobiol. 2015;132:1–33. doi: 10.1016/j.pneurobio.2015.06.003. [DOI] [PubMed] [Google Scholar]
Ramakrishnan V. Ribosome structure and the mechanism of translation. Cell. 2002;108:557–572. doi: 10.1016/s0092-8674(02)00619-0. [DOI] [PubMed] [Google Scholar]
Ripke S., O'Dushlaine C., Chambert K., Moran J.L., Kähler A.K., Akterin S., Publications Committee Genome-wide association analysis identifies 13 new risk loci for schizophrenia. Nat. Genet. 2013;45:1150–1159. doi: 10.1038/ng.2742. [DOI] [PMC free article] [PubMed] [Google Scholar]
Roeder R.G. The role of general initiation factors in transcription by RNA polymerase II. Trends Biochem. Sci. 1996;21:327–335. [PubMed] [Google Scholar]
Rosen E.D., MacDougald O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006;12:885–896. doi: 10.1038/nrm2066. [DOI] [PubMed] [Google Scholar]
Saxonov S., Berg P., Brutlag D.L. A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters. Proc. Natl. Acad. Sci. U S A. 2006;103:1412–1417. doi: 10.1073/pnas.0510310103. [DOI] [PMC free article] [PubMed] [Google Scholar]
Yin Y., Morgunova E., Jolma A., Kaasinen E., Sahu B., Khund-Sayeed S., Taipale J. Impact of cytosine methylation on DNA binding specificities of human transcription factors. Science. 2017;356:e2239. doi: 10.1126/science.aaj2239. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zhang Z.W., Chen Y.C., Pei W.Y., Wang N., Li H. Overexpression of chicken Gata2 or Gata3 suppressed the transcription of Pparγ gene. Chin. J. Biochem. Mol. Biol. 2012;28:835–842. [Google Scholar]
Zhang Z.W., Rong E.G., Shi M.X., Wu C.Y., Sun B., Wang Y.X., Li H. Expression and functional analysis of Kruppel-like factor 2 in chicken adipose tissue. J. Anim. Sci. 2014;92:4797–4805. doi: 10.2527/jas.2014-7997. [DOI] [PubMed] [Google Scholar]
Zhang Z.W., Wang H., Sun Y., Li H., Wang N. Klf7 modulates the differentiation and proliferation of chicken preadipocyte. Acta. Biochim. Biophys. Sin. (Shanghai) 2013;45:280–288. doi: 10.1093/abbs/gmt010. [DOI] [PubMed] [Google Scholar]
Zhang Z.W., Wu C.Y., Li H., Wang N. Expression and functional analyses of Kruppel-like factor 3 in chicken adipose tissue. Biosci. Biotechnol. Biochem. 2014;78:614–623. doi: 10.1080/09168451.2014.896735. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table 2 The 189 proteins specific detected in the DNA pull-down-LC-MS/MS assay of chicken C/EBPZ (−173/+6) with nucleoproteins of chicken preadipocytes.

mmc1.csv^{(72.5KB, csv)}

mmc2.csv^{(57.2KB, csv)}

Supplementary Table 4 Gene Ontology (GO) enrichment analysis of the 189 proteins specific detected in experimental group of DNA pull-down-LC-MS/MS assay.

mmc3.pdf^{(632.8KB, pdf)}

Supplementary Table 5 Pathway enrichment analysis of the 189 proteins specific detected in experimental group of DNA pull-down-LC-MS/MS assay.

mmc4.csv^{(459.5KB, csv)}

mmc5.csv^{(20.5KB, csv)}

mmc6.csv^{(4.4KB, csv)}

[bib0001] Andersen J.S., Lyon C.E., Fox A.H. Directed proteomic analysis of the human nucleolus. Curr. Biol. 2002;12:1–11. doi: 10.1016/s0960-9822(01)00650-9. [DOI] [PubMed] [Google Scholar]

[bib0002] Baltz A.G., Munschauer M., Schwanhausser B., Vasile A., Murakawa Y., Schueler M., Landthaler M. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol. Cell. 2012;46:674–690. doi: 10.1016/j.molcel.2012.05.021. [DOI] [PubMed] [Google Scholar]

[bib0003] Barbieri I., Tzelepis K., Pandolfini L., Shi J., Millán-Zambrano G., Robson S.C., Kouzarides T. Promoter-bound METTL3 maintains myeloid leukaemia by m(6)A-dependent translation control. Nature. 2017;552:126–131. doi: 10.1038/nature24678. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0004] Butler J.E., Kadonaga J.T. The RNA polymerase II core promoter: a key component in the regulation of gene expression. Genes Dev. 2002;16:2583–2592. doi: 10.1101/gad.1026202. [DOI] [PubMed] [Google Scholar]

[bib0005] Castello A., Fischer B., Eichelbaum K., Horse R., Beckmann B.M., Strein C., Hentze M.W. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 2012;149:1393–1406. doi: 10.1016/j.cell.2012.04.031. [DOI] [PubMed] [Google Scholar]

[bib0006] Chait A., Laura J., Hartigh D. Adipose tissue distribution, inflammation and its metabolic consequences, including diabetes and cardiovascular disease. Front. Cardiovasc. Med. 2020;7:22. doi: 10.3389/fcvm.2020.00022. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0007] Chen Y.C., Gao L.Y., Lin T., Pei X.L., Gao Q., Chen J.J., Zhang Z.W. C/EBPZ modulates the differentiation and proliferation of preadipocytes. Int. J. Obesity. 2022;46:523–534. doi: 10.1038/s41366-021-01020-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0008] Deaton A.M., Bird A. CpG islands and the regulation of transcription. Genes. Dev. 2011;25:1010–1022. doi: 10.1101/gad.2037511. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0009] Dupont J., Tesseraud S., Simon J. Insulin signaling in chicken liver and muscle. Gen. Comparative Endocrinol. 2009;163:52–57. doi: 10.1016/j.ygcen.2008.10.016. [DOI] [PubMed] [Google Scholar]

[bib0010] Dynan W.S., Tjian R. Control of eukaryotic messenger RNA synthesis by sequence-specific DNA-binding proteins. Nature. 1985;316:774–778. doi: 10.1038/316774a0. [DOI] [PubMed] [Google Scholar]

[bib0011] Garcia-Dominguez M., Reyes J.C. SUMO association with repressor complexes, emerging routes for transcriptional control. Biochim Biophys Acta. 2009;1789:451–459. doi: 10.1016/j.bbagrm.2009.07.001. [DOI] [PubMed] [Google Scholar]

[bib0012] Ghaben A.L., Scherer P.E. Adipogenesis and metabolic health. Nat. Rev. Mol. Cell Biol. 2019;20:242–258. doi: 10.1038/s41580-018-0093-z. [DOI] [PubMed] [Google Scholar]

[bib0013] Gordon D.E., Hiatt J., Bouhaddou M., Rezelj V.V., Ulferts S., Braberg H., Dorward M. Comparative host-coronavirus protein interaction networks reveal pan-viral disease mechanisms. Science. 2020;370:e9403. doi: 10.1126/science.abe9403. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0014] Haberle V., Stark A. Eukaryotic core promoters and the functional basis of transcription initiation. Nat. Rev. Mol. Cell Biol. 2018;19:621–637. doi: 10.1038/s41580-018-0028-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0015] Herold T., Metzeler K.H., Vosberg S., Hartmann L., Röllig C., Stölzel F., Greif P.A. Isolated trisomy 13 defines a homogeneous AML subgroup with high frequency of mutations in spliceosome genes and poor prognosis. Blood. 2014;124:1304–1311. doi: 10.1182/blood-2013-12-540716. [DOI] [PubMed] [Google Scholar]

[bib0016] Imbriano C., Bolognese F., Gurtner A., Piaggio G., Mantovani R. HSP-CBF is an NF-Y-dependent coactivator of the heat shock promoters CCAAT boxes. J. Biol. Chem. 2001;276:26332–26339. doi: 10.1074/jbc.M101553200. [DOI] [PubMed] [Google Scholar]

[bib0017] Kaczynski J., Cook T., Urrutia R. Sp1- and Kruppel-like transcription factors. Genome. Biol. 2003;4:206. doi: 10.1186/gb-2003-4-2-206. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0018] Kadonaga J.T. Perspectives on the RNA polymerase II core promoter. Wiley Interdiscip. Rev. Dev. Biol. 2012;1:40–51. doi: 10.1002/wdev.21. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0019] Kozak M. At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 1987;196:947–950. doi: 10.1016/0022-2836(87)90418-9. [DOI] [PubMed] [Google Scholar]

[bib0020] Li Z., Liu X., Li Y., Wang W., Wang N., Xiao F., Wang S. Chicken C/EBPζ gene: expression profiles, association analysis, and identification of functional variants for abdominal fat. Domest. Anim. Endocrinol. 2021;76 doi: 10.1016/j.domaniend.2021.106631. [DOI] [PubMed] [Google Scholar]

[bib0021] Louder R.K., He Y., López-Blanco J.R., Fang J., Chacón P., Nogales E. Structure of promoter-bound TFIID and model of human pre-initiation complex assembly. Nature. 2016;531:604–609. doi: 10.1038/nature17394. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0022] Lum L.S., Sultzman L.A., Kaufman R.J., Linzer D.I., Wu B.J.A. cloned human CCAAT-box-binding factor stimulates transcription from the human hsp70 promoter. Mol. Cell Biol. 1990;10:6709–6717. doi: 10.1128/mcb.10.12.6709. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0023] Manning K.S., Cooper T.A. The roles of RNA processing in translating genotype to phenotype. Nat. Rev. Mol. Cell Biol. 2017;18:102–114. doi: 10.1038/nrm.2016.139. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0024] Mikhaylichenko O., Bondarenko V., Harnett D., Schor I.E., Males M., Viales R.R., Furlong E.E. The degree of enhancer or promoter activity is reflected by the levels and directionality of eRNA transcription. Genes Dev. 2018;32:42–57. doi: 10.1101/gad.308619.117. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0025] Morgan X.C., Ni S., Miranker D.P., Iyer V.R. Predicting combinatorial binding of transcription factors to regulatory elements in the human genome by association rule mining. BMC Bioinform. 2007;8:1–14. doi: 10.1186/1471-2105-8-445. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0026] Mota D.S.P., Richard A.J., Hang H. Transcriptional regulation of adipogenesis. Compr. Physiol. 2017;7:635–674. doi: 10.1002/cphy.c160022. [DOI] [PubMed] [Google Scholar]

[bib0027] Muller F., Tora L. Chromatin and DNA sequences in defining promoters for transcription initiation. Biochim. Biophys. Acta. 2014;1839:118–128. doi: 10.1016/j.bbagrm.2013.11.003. [DOI] [PubMed] [Google Scholar]

[bib0028] Namya M., Christelle R., Alix B., Grandhaye J., Froment P., Dupont J. Chicken is a useful model to investigate the role of adipokines in metabolic and reproductive diseases. Int. J. Endocrinol. 2013;2018 doi: 10.1155/2018/4579734. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0029] Pulido-Salgado M., Vidal-Taboada J.M., Saura J. C/EBPβ and C/EBPδ transcription factors: basic biology and roles in the CNS. Prog. Neurobiol. 2015;132:1–33. doi: 10.1016/j.pneurobio.2015.06.003. [DOI] [PubMed] [Google Scholar]

[bib0030] Ramakrishnan V. Ribosome structure and the mechanism of translation. Cell. 2002;108:557–572. doi: 10.1016/s0092-8674(02)00619-0. [DOI] [PubMed] [Google Scholar]

[bib0031] Ripke S., O'Dushlaine C., Chambert K., Moran J.L., Kähler A.K., Akterin S., Publications Committee Genome-wide association analysis identifies 13 new risk loci for schizophrenia. Nat. Genet. 2013;45:1150–1159. doi: 10.1038/ng.2742. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0032] Roeder R.G. The role of general initiation factors in transcription by RNA polymerase II. Trends Biochem. Sci. 1996;21:327–335. [PubMed] [Google Scholar]

[bib0033] Rosen E.D., MacDougald O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006;12:885–896. doi: 10.1038/nrm2066. [DOI] [PubMed] [Google Scholar]

[bib0034] Saxonov S., Berg P., Brutlag D.L. A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters. Proc. Natl. Acad. Sci. U S A. 2006;103:1412–1417. doi: 10.1073/pnas.0510310103. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0035] Yin Y., Morgunova E., Jolma A., Kaasinen E., Sahu B., Khund-Sayeed S., Taipale J. Impact of cytosine methylation on DNA binding specificities of human transcription factors. Science. 2017;356:e2239. doi: 10.1126/science.aaj2239. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0036] Zhang Z.W., Chen Y.C., Pei W.Y., Wang N., Li H. Overexpression of chicken Gata2 or Gata3 suppressed the transcription of Pparγ gene. Chin. J. Biochem. Mol. Biol. 2012;28:835–842. [Google Scholar]

[bib0037] Zhang Z.W., Rong E.G., Shi M.X., Wu C.Y., Sun B., Wang Y.X., Li H. Expression and functional analysis of Kruppel-like factor 2 in chicken adipose tissue. J. Anim. Sci. 2014;92:4797–4805. doi: 10.2527/jas.2014-7997. [DOI] [PubMed] [Google Scholar]

[bib0038] Zhang Z.W., Wang H., Sun Y., Li H., Wang N. Klf7 modulates the differentiation and proliferation of chicken preadipocyte. Acta. Biochim. Biophys. Sin. (Shanghai) 2013;45:280–288. doi: 10.1093/abbs/gmt010. [DOI] [PubMed] [Google Scholar]

[bib0039] Zhang Z.W., Wu C.Y., Li H., Wang N. Expression and functional analyses of Kruppel-like factor 3 in chicken adipose tissue. Biosci. Biotechnol. Biochem. 2014;78:614–623. doi: 10.1080/09168451.2014.896735. [DOI] [PubMed] [Google Scholar]

PERMALINK

Transcriptional control of CCAAT/enhancer binding protein zeta gene in chicken adipose tissue

Lingyu Gao

Yingjun Wang

Qin Gao

Yuechan Chen

Zhiwei Zhang

Abstract

INTRODUCTION

MATERIALS AND METHODS

Cell Culture

Cell Transfection

Plasmid Construction

Table 1.

Overexpression Experiment

RNA Interference

Table 2.

Western Blot

Quantitative Reverse Transcription PCR

Table 3.

Table 4.

Luciferase Reporter Assay

Table 5.

Chromatin Immunoprecipitation-PCR

Table 6.

DNA Pull Down

In Silico Analysis

Statistical Analysis

RESULTS

Promoter Analysis of Chicken C/EBPZ

Figure 1.

Identification of a Core Promoter of Chicken C/EBPZ

Figure 2.

DNA Pull-Down Analysis of Chicken C/EBPZ Promoter

Figure 3.

Figure 4.

Chicken KLF2 Facilitated C/EBPZ Transcription

Figure 5.

The Combination of KLF2 With Chicken C/EBPZ Promoter

Figure 6.

The CGCAGCGCCCG Motif Might be a Target Site for KLF2

Figure 7.

DISCUSSION

Cis-Elements Analysis of Chicken C/EBPZ Promoter

Atlas of Nucleoproteins Combined With Chicken C/EBPZ Promoter

KLF2 Facilitated Chicken C/EBPZ Transcription

Figure 8.

ACKNOWLEDGMENTS

DISCLOSURES

Footnotes

Appendix. Supplementary materials

REFERENCES

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases