Abstract
The high incidence of oral carcinomas is due to its multifactorial etiology and the presence of various risk factors. Human Papillomavirus (HPV) has a proven role in the pathogenesis of oral carcinomas, but in the recent times there has been an increasing incidence of oral cancers who are negative for HPV infection. Also, these patients are non-smokers and non-drinkers so it could be speculated that these oral cancers are due to some other etiological factor probably of other viral infections. Therefore, this study examined the prevalence of Epstein Barr Virus (EBV) and Herpes Simplex Virus (HSV) among oral cancer patients. This cross-sectional study was conducted from January 2019 to June 2020. Biopsy samples from 47 newly diagnosed untreated patients with oral malignancies were collected along with their demographic and clinicopathological information. DNA extracted from the biopsies was processed for nested PCR for the detection of EBV and HSV. All the samples tested negative for HPV and HSV infection. Nested PCR detected 29 cases (70.7%) to be positive for EBV. The non-cancerous adjacent tissues also were negative for HPV, EBV and HSV. The prevalence of EBV was found to be more in males (62.1%) and the highest number of cases was of the left buccal mucosa compromising 34% of the total cases. From the present study it can be concluded that EBV but not HSV infection is associated with an increased risk of developing oral cancers. Although, 70.7% of the patients were found to be positive for EBV whether the viral infection played any role in the driving the malignancy needs to be further elucidated.
Keywords: Oral cancer, Oncogenic virus, EBV, HSV, Co-infection, Nested PCR
Introduction
Oral cancer is the second most common type of malignancy in India, which accounts for 40% of the total number of malignancies, as opposed to western nations where they comprise of only 3–4% of all cancers [1]. As per the Globocan 2020 data, it is estimated 1,36,000 new cases were diagnosed with cancer of the lip and oral cavity, with males being more affected than females [2]. Patients with oral cancers have worse health related quality of life as compared to general population with mortality rate and incidence being highest in India [3, 4]. This higher frequency of oral cancer in India is because of the regular propensity of tobacco consumption, betel nut chewing, and alcohol [5–7]. Although tobacco and alcohol comprise as risk factors in three fourths of the tumours, in about one fourth of the cases, definite etiological factor cannot be identified. In addition to these risk factors, chronic viral infections also play a role in the development of the malignancy [8]. Human Papillomavirus (HPV) was earlier thought to be an etiological factor in the development of only cervical cancers but the last decade has provided enough scientific data revealing the role of HPV in the cancers of other anatomical sites [9, 10]. There is substantial evidence from epidemiological and molecular studies suggesting the role of high-risk HPV infection in oral cancers [11, 12]. Although varying, the incidence of HPV-associated oral cancers especially of the oropharynx ranges from 0 to 70% based on the geographical locations and method of detection [13–18]. In the recent times, there has been an increasing incidence of oral cancers who are negative for HPV infection [19]. Also, these patients are non-smokers and non-drinkers so it could be speculated that these oral cancers are due to some other etiological factor probably of other viral infections. Herpes Simplex virus (HSV) and Epstein-Barr virus (EBV) are also known to be drivers of oral cancers but their role remains unclear [20].
EBV, a double stranded DNA virus belongs to a family of gamma herpesvirus that has an ability to persistently infect the oral cavity [21]. EBV exhibits dual tropism as it can infect both epithelial cells and B lymphocytes [22]. The mode of transmission of EBV is via saliva through which it enters the epithelium of waldeyer’s tonsillar ring, where the lytic infection is initiated which leads to amplification of the virus [22]. Then the virus infects the naïve B cells present in the lymphoid tissues and becomes activated lymphoblasts. The infected cell then migrates into the follicle to initiate a germinal centre reaction and establishes a default transcription programme. This default programme provides survival signals that permits the cell to exit as memory B cell from the germinal centre where all the virion protein expression is turned off. After maintaining homeostasis these memory B cells finally return to the tonsils where it triggers the viral replication [23, 24]. EBV infection are generally benign and is associated with diseases such as infectious mononucleosis, oral leucoplakia and in latent stages it is associated with variable malignancies such as endemic Burkitt’s lymphoma, B-cell non-Hodgkin’s lymphoma and undifferentiated nasopharyngeal carcinoma [25–27]. The scientific evidence associating EBV infection with oral malignancies is sparse and it is still unclear whether EBV drives tumor initiation or is only involved in tumor progression. Since the oral cavity serves as the starting point of EBV infection and is a reservoir for viral particles, oral malignancies driven by EBV infection cannot be ruled out.
HSV is a double stranded DNA virus which reactivates at the site of infection after residing in host neurons and get transported to the mucosa along axons [28]. HSV are primarily present in the form of blisters on the lips commonly referred as cold sores and in most cases the absence of blisters and other visible changes in the oral mucosa implies presence of abundant viral load which serves as a purpose for viral transmission [29]. However, the possibility that oral cancer is associated with HSV has been largely less investigated. The mechanism involved in oral carcinogenesis by HSV is difficult to study as the cells transformed by HSV do not retain any specific viral genes also do not express specific viral antigens. However, there is evidence supporting that HSV may act by a hit and run mutagenic effect which is responsible for its oncogenicity [30]. The synergistic action of HSV along with tobacco products reaffirms the oncogenic potential of HSV [31]. Co-infection by two pathogenic virus species has been implicated in doubling the risk for driving malignancy and it would be interesting to investigate whether the oral mucosa is a niche for multiple viral infections with oncogenic potential. Therefore, this study was designed to investigate the proportion of EBV and HSV in oral cancer specimens from Indian population admitted in tertiary care centre.
Materials and Methods
Patients and Specimen Collection
This time bound prospective cross-sectional study was carried out from January 2019 to June 2020. All patients presenting with oral lesions at Justice K.S Hegde Charitable hospital, Mangalore were enrolled in the study after obtaining Institutional ethical clearance (INST.EC/EC/183/2018-19). A written informed consent was obtained from 47 cases who fulfilled the study criteria and were recruited for the study. Newly diagnosed, untreated, histologically proven cases of oral malignancy who gave consent to participate were included. Patients who did not give consent, patients with nasal, nasopharyngeal and salivary gland malignancy and patients with recurrent lesions were excluded. Tumour specimen was collected from biopsy of suspicious lesions for malignancy and stored at -20 °C freezer until further molecular analysis. The non-cancerous adjacent tissue was also collected from each subject for comparative analysis. Data collection was done in case report format where the demographic details, habits such as alcohol consumption, tobacco and betel chewing were documented. A detailed oral examination and cancer staging as per AJCC TNM classification were noted.
DNA Extraction
The samples were subjected to DNA extraction using E.Z.N.A. ® Tissue DNA (Omega biotek, Cat. No. D3396-01) according to the manufacturer’s instructions. The DNA was quantified using a Nanodrop spectrophotometer (DeNovix) and the quality of the DNA was assessed by agarose gel electrophoresis.
Nested PCR for the Detection of HPV, EBV and HSV
Before testing the clinical samples, the specificity of the method was evaluated using positive and negative controls. DNA from HeLa (cervical carcinoma) cell line was used as a positive control for HPV detection as described previously [16]. EBV B95-8 Strain quantitated viral DNA purchased from Advanced Biotechnologies Inc (Cat. No. 08-926-000) served as a positive control for EBV. DNA from green monkey cells (harbouring HSV) were isolated and served as a positive control for HSV infection. EBV and HSV infection in the clinical samples was confirmed by PCR targeting genes coding for EBNA1 and HSV1 respectively. The commercially synthesized primer sequences for the same are listed in Table 1. All the samples were subjected to a standardized PCR protocol as described earlier [13, 16].
Table 1.
Oligonucleotide sequences used in the study
| Primers | Sequence |
|---|---|
| GAPDH (F) | 5’-GAAATCCCATCACCATCTTCCAGG − 3’ |
| GAPDH (R) | 5’- GAGCCCCAGCCTTCTCCATG-3’ |
| MY09 (F) | 5’- CGTCCMARRGGAWACTGATC-3’ |
| MY11 (R) | 5’-GCMCAGGGWCATAAYAATGG-3’ |
| EBNA1 (F) | 5’-GATTTGGACCCGAAATCTGA-3’ |
| EBNA1 (R) | 5’-CCTCCCTAGAACTGACAATTGG-3’ |
| HSV 1 (F) | 5’CATCACCGACCCGGAGAGGGAC3’ |
| HSV 1 (R) | 5’GGGCCAGGCGCTTGTTGTTGTA3’ |
Confirmation of PCR Products by Sequencing
Positively amplified products of PCR were further subjected to sequencing of DNA and were compared with the standard strain sequence in order to determine the percentage of homology. Briefly, the PCR products from the oral cancer samples were sequenced for EBV with fluorescent dye-labelled dideoxynucleotides and cycle sequencing methods utilizing Big Dye Terminator Cycle Sequencing kit (PE Applied Biosystems). Direct DNA sequence analysis was performed using a capillary sequencer (ABI Prism 310); with primers targeting EBNA1 gene of EBV genome. Sequences were analysed by matching the sequence homology through NCBI BLAST algorithm.
Statistical Analysis
The data collected was entered in Microsoft excel spreadsheet and analysed using IBM SPSS statistics version 20. The results were presented as frequencies and proportions. Proportion of HSV and EBV were calculated.
Results
The workflow of sample collection and processing is depicted in Fig. 1. In this study the age distribution ranged between 27 and 74 years. The most common age group at presentation was between 41 and 60 years (43%, n = 20) followed by above 60 years (40%, n = 19). Males were more commonly affected than females accounting for 70% (n = 33) and 30% (n = 14) of the cases evaluated respectively. The male to female ratio was 2.3:1. A detailed clinical history obtained from the patients showed that tobacco and betelnut chewing was the most prevalent risk factor accounting for 72.3% (n = 34). The most common site of the tumor was buccal mucosa accounting for 57.4% (n = 27) of all the cases followed by lateral border of tongue accounting for 25.3% (n = 12) of all the cases. The demographic profile and baseline clinic-pathological characteristics of the study population is tabulated in Table 2. Histopathological assessment revealed that 44.6% (n = 21) tumors were well differentiated, 42.5% (n = 20) were moderately differentiated and 12.7% (n = 6) were poorly differentiated squamous cell carcinoma. The representative microscopic images are depicted in Fig. 2.
Fig. 1.
Workflow for the detection of EBV and HSV in the study population
Table 2.
Demographic profile, habitual risk factors and histopathological characteristics of the study population (n = 47) stratified based on EBV status
| Baseline characteristics | Total, n = 47 (%) | EBV positive, n = 29 (%) | EBV negative, n = 18 (%) |
|---|---|---|---|
| Age (in years) | |||
| Less than 40 | 08 (17) | 02 (6.8) | 06 (33.3) |
| 41–60 | 20 (42.5) | 13 (44.8) | 07 (38.8) |
| Above 60 | 19 (40.4) | 14 (48.2) | 05 (27.7) |
| Gender | |||
| Male | 33 (70.2) | 18 (62) | 15 (83.3) |
| Female | 14 (29.7) | 11 (37.9) | 03 (16.6) |
| H/o tobacco, betel nut chewing | |||
| Present | 34 (72.3) | 22 (75.8) | 12 (66.6) |
| Absent | 13 (27.6) | 07 (24.1) | 06 (33.3) |
| H/o alcohol consumption | |||
| Present | 09 (19.1) | 05 (17.2) | 04 (22.2) |
| Absent | 38 (80.8) | 24 (82.7) | 14 (77.7) |
| H/o smoking | |||
| Present | 19 (40.4) | 10 (34.4) | 09 (50) |
| Absent | 28 (59.5) | 19 (65.5) | 09 (50) |
| Oral cavity tumor subsites | |||
| Hard palate | 01 (2.1) | 00 | 01 (5.5) |
| Buccal mucosa | 27 (57.4) | 18 (62) | 09 (50) |
| Lateral border of tongue | 12 (25.3) | 06 (20.6) | 06 (33.3) |
| Lip and alveolar ridge | 04 (8.5) | 03 (10.3) | 01 (5.5) |
| Oropharynx tumor subsites | |||
| Base of the tongue | 01 (2.1) | 01 (3.4) | 00 |
| Vallecula | 01 (2.1) | 01 (3.4) | 00 |
| Anterior tonsillar pillar | 01 (2.1) | 00 | 01 (5.5) |
| Histopathology | |||
| Poorly differentiated | 06 (12.7) | 05 (17.2) | 01 (5.5) |
| Moderately differentiated | 20 (42.5) | 11 (37.9) | 09 (50) |
| Well-differentiated | 21 (44.6) | 13 (44.8) | 08 (44.4) |
Fig. 2.
Representative microscopic images (10x) depicting different histopathological grades of cancer tissues. (A) Well differentiated squamous cell carcinoma. Prominent keratin pearls with tumor islands in the basal layer are visible. (B) Moderately differentiated squamous cell carcinoma. Few areas of keratinisation with basal layers at few places are visible. (C) Poorly differentiated squamous cell carcinoma. Pleomorphism with abnormal mitosis are seen with no evidence of differentiation and keratinisation
Of the DNA isolated from the 47 oral cancer samples, only 41 were subjected to nested PCR for the detection of HPV, EBV and HSV as the cancer biopsies from 6 cases (12.8%) did not yield any amplifiable DNA. The non-cancerous adjacent tissues yielded good amplifiable DNA. All the cancer biopsies and adjacent tissue samples were negative for any HPV infection as determined using consensus MY09/11 primer pairs. Molecular analysis revealed that out of 41 cases, 29 cases (70.7%) were found to be positive for EBV and 12 cases (29.2%) were found to be negative. DNA samples with amplifiable EBNA1 gene that matched with the positive control were considered positive for EBV infection (Fig. 3). The positive amplicons were further confirmed by sanger sequencing and matching the sequence homology through NCBI BLAST algorithm using the GenBank database as the reference. Similarly, all the clinical samples were subjected for the detection of HSV infection and it was found that all the 41 samples (100%) were negative for HSV. The non-cancerous adjacent tissues were negative for EBV and HSV DNA.
Fig. 3.
EBV detection in oral cancer samples. Electrophoretogram of PCR products on a 2% agarose gel stained with ethidium bromide. A PCR product at 336 bp was considered positive for EBNA1 gene (L- 100 bp DNA ladder, A to E- oral cancer samples, F- positive control and empty lane- negative control)
Comparative analysis of EBV status with habitual risk factors revealed that patients who consumed betel nut and tobacco were more prone to EBV infection when compared to patients who smoked and consumed alcohol (Table 2). The highest prevalence of EBV was found in the tumors of buccal mucosa (62%, n = 18) followed by lateral border of the tongue (20.6%, n = 6). Histopathological analysis revealed that majority of the EBV positive samples (44.8%, n = 13) were well-differentiated (Table 2).
Discussion
In India approximately five people die every hour due to oral cancers [32]. Many cases remain unrecorded as registration of cancers are not yet streamlined in India, so the correct incidence, morbidity and mortality might be even higher. This high incidence of oral malignancies in India can be attributed to betelnut and tobacco chewing [13]. Oral hygiene, diet, body mass index and viral infections are the other risk factors in oral cancers [33]. The tumorigenic role of HPV in cervical cancers is well defined and many studies also prove the role of HPV in the pathogenesis of oral malignancies. The variable presence of HPV in oral and pharyngeal squamous cell carcinoma tissue especially the genotypes whose oncogenic potential is very high such as HPV-18 and HPV-16 has been widely demonstrated [34, 35]. HPV positive oral malignancies have a good prognosis and better survival rate compared to HPV negative oral cancers caused due to reasons unknown [36, 37]. There are many hypotheses and theories that have been put forward to explain the same [38], however the mechanistic understanding is still lacking. Other than HPV, there are other synergistic viruses that are most likely to be involved in the pathogenesis of oral malignancies. As shown by both epidemiological and molecular data, few members of herpesviridae family like EBV and HSV are also implicated in driving oral cancers but the data in the literature is inconsistent.
The association of EBV with oral malignancies have been studied previously. However, significant association of EBV was noted only in few studies. EBNA1 gene plays an important role in replication of EBV episomes and also contributes to the cellular immortalization by activating latency phase genes [39, 40]. Hence a nested PCR targeting EBNA1 gene was utilized in this study and the results demonstrated that 70.7% cases that were subjected to molecular analysis were positive for EBV infection. A meta-analysis by She et al., included 13 case-control studies which resulted in a total of 686 oral cancer patients and 433 controls. After estimating the odd’s ratio and 95% confidence interval, it was concluded that EBV infection was indeed associated with increased risk of oral cancers [41]. It can be speculated that the type of sample and the differences in the method of detecting the infection could determine the end result. A study conducted by Pratyusha et al., in the state of Andhra Pradesh, India, evaluated 20 histopathologically proven oral cancer FFPE tissue blocks along with 20 FFPE blocks of normal mucosa. Out of 20 cases, 20% (n = 4) were found to be positive for EBV infection. Surprisingly, 50% (n = 10) control samples were found to be EBV positive [42]. In another study from a south Indian tobacco chewing population, the expression of EBV was evaluated among healthy controls, subjects with potentially malignant disorders and oral cancers. Immunohistochemical analysis of EBV Latent Membrane Protein 1 (LMP1) revealed that 8% (n = 6) of the study population was positive for EBV. The positivity was observed among two healthy controls, two cases of leucoplakia and two cases of moderately differentiated oral squamous cell carcinoma [43]. Although the study could not find any significant association between EBV positivity and oral malignancy, it did provide evidence of EBV involvement in the malignant changes of oral mucosa.
Despite the findings from invitro studies and animal models, it is still unclear whether HSV infection contributes to the development of oral cancers. Early evidences from epidemiological studies showed that oral cancer cases had higher levels of HSV antibodies than healthy controls. A study by Starr et al., tested the antibody response to HSV1 in the serum samples from 445 controls and 260 patients diagnosed with oral cancers. The study revealed that the serological positivity of HSV1 was well associated with increased risk of patients developing oral cancers [44]. The literature also suggests that HSV infection may influence the development of oral cancer strongly when other risk factors are present. However, the fact that HSV infected cells do not stably express any viral antigens or any specific genes which makes the association difficult to study. In a study conducted by Mokhtari et al., the presence of HSV DNA was detected only in 5% (3/60) of the study population [45].
Both EBV and HSV have shown to possess the ability to transform normal cells and drive oral malignancy independent of each other [46, 47]. However, the existence of coinfections cannot be ruled out since some cases of oral cancers are presented with aggressive tumors. There are very few studies investigating the association of HSV and EBV with oral malignancy. A study by Jalouli et al., evaluated the prevalence of viral infections in oral malignancy and oral submucous fibrosis. Using the PCR/DNA sequencing techniques, the study detected EBV DNA in 29%, HSV DNA in 5%, and HPV DNA in 24% of the samples from OSCC patients [48]. A larger multi-centre study was conducted by the same authors including FFPE tissue blocks of oral cancers from eight different countries. The results demonstrate a high overall prevalence of EBV which was seen in 55% (n = 85) of the cases followed by 35% (n = 54) of HPV positivity and HSV infection in 15% (n = 24) cases [49].
The literature regarding the role of EBV and HSV in oral malignancy is conflicting and this study aimed at assessing the prevalence of the same. The study was limited by small sample size and hence it warrants for larger multi-centre studies to provide more accurate results. Further studies focussing on coinfection and coexistence of oncogenic viruses are needed to elucidate disease patterns which will enable in the development of new treatment options or in developing safe and effective vaccines.
HPV status in head and neck cancers especially oropharyngeal cancers has been well established as a prognostic marker. The improved survival and better treatment response of HPV-positive oropharyngeal cancers has initiated plethora of clinical studies exploring de-escalation treatment strategies for better management of these patient subtypes. Although a handful of studies have examined the survival outcomes of EBV associated oral cancers, the evidence is not substantial. Through this study, we draw the attention of the scientific community to investigate the impact of EBV positivity on the overall and disease-free survival of oral cancer patients.
Conclusion
From the present study it can be concluded that EBV but not HSV infection is associated with an increased risk of developing oral cancers. Although, 70.7% of the patients were found to be positive for EBV whether the viral infection played any role in the driving the malignancy needs to be further elucidated. Moreover, comprehensive mechanistic studies describing the host-virus interactions would provide dynamic views into understanding the pathogenesis of these viral infections in tumorigenesis. Also, there is a need to assess the association of viral infections with the clinical outcomes of the non-HPV oral cancer patients.
Acknowledgements
The authors thank Nitte (Deemed to be University) for providing the facilities to conduct the study. The authors thank Dr. Avinash Shetty, Wake Forest University School of Medicine, Winston-Salem for his constructive feedback and proofreading the manuscript for English language.
Authors’ Contributions
Paras Jain: Conceptualization, Data curation, Investigation, Methodology; Nawin Kumar: Conceptualization, Project administration, Resources, Supervision; Shriya Shetty: Formal analysis, Methodology, Investigation; Shwetha Shetty: Formal analysis, Methodology, Investigation; Pushkal Ramesh: Data curation, Software, Validation, Writing- Original draft preparation, reviewing and editing; Prakash Patil: Supervision, Validation, Writing- Reviewing and editing; Mohan Kumar: Supervision, Validation, Writing- Reviewing and editing; Vinay Rajendra: Data curation, Investigation, Resources; Devanand Devegowda: Validation, Writing- Original draft preparation, reviewing and editing; Veena Shetty: Conceptualization, Project administration, Resources, Supervision, Writing- Reviewing and editing; All the authors: Approval of the final version of the manuscript.
Funding
This study was not supported by any funding.
Declarations
Ethics approval and consent to participate
All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. The study was approved by Institutional Review Board (INST.EC/EC/183/2018-19).
Informed Consent
Informed consent was obtained from all individual participants included in the study.
Consent for Publication
Consent for publication was obtained for every individual person’s data included in the study.
Competing Interests
The authors declare that they have no conflict of interest.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Subash A, Bylapudi B, Thakur S, Rao VU. Oral cancer in India, a growing problem: is limiting the exposure to avoidable risk factors the only way to reduce the disease burden? Oral Oncol. 2022;125:105677. doi: 10.1016/j.oraloncology.2021.105677. [DOI] [PubMed] [Google Scholar]
- 2.Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. Cancer J Clin. 2021;71(3):209–249. doi: 10.3322/caac.21660. [DOI] [PubMed] [Google Scholar]
- 3.Barrios R, Bravo M, Gil-Montoya JA, Martínez-Lara I, García-Medina B, Tsakos G. Oral and general health-related quality of life in patients treated for oral cancer compared to control group. Health Qual Life Outcomes. 2015;13(1):1–8. doi: 10.1186/s12955-014-0201-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Moore K, Ford P, Farah C. Support needs and quality of life in oral cancer: a systematic review. Int J Dental Hygiene. 2014;12(1):36–47. doi: 10.1111/idh.12051. [DOI] [PubMed] [Google Scholar]
- 5.Anantharaman D, Chabrier A, Gaborieau V, Franceschi S, Herrero R, Rajkumar T, et al. Genetic variants in nicotine addiction and alcohol metabolism genes, oral cancer risk and the propensity to smoke and drink alcohol: a replication study in India. PLoS ONE. 2014;9(2):e88240. doi: 10.1371/journal.pone.0088240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Lee CH, Ko AMS, Warnakulasuriya S, Yin BL, Zain RB, Ibrahim SO, et al. Intercountry prevalences and practices of betel-quid use in south, southeast and eastern Asia regions and associated oral preneoplastic disorders: an international collaborative study by asian betel‐quid consortium of south and east Asia. Int J Cancer. 2011;129(7):1741–1751. doi: 10.1002/ijc.25809. [DOI] [PubMed] [Google Scholar]
- 7.Sankaranarayanan R, Ramadas K, Amarasinghe H, Subramanian S, Johnson N (2015) Oral cancer: prevention, early detection, and treatment. Cancer: disease control priorities, third edition (volume 3). 10.1596/978-1-4648-0349-9_ch5
- 8.Hillbertz NS, Hirsch J-M, Jalouli J, Jalouli MM, Sand L. Viral and molecular aspects of oral cancer. Anticancer Res. 2012;32(10):4201–4212. [PubMed] [Google Scholar]
- 9.Giuliano AR, Nyitray AG, Kreimer AR, Pierce Campbell CM, Goodman MT, Sudenga SL, et al. E UROGIN 2014 roadmap: differences in human papillomavirus infection natural history, transmission and human papillomavirus-related cancer incidence by gender and anatomic site of infection. Int J Cancer. 2015;136(12):2752–2760. doi: 10.1002/ijc.29082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Gillison ML, Shah KV. Human papillomavirus–associated head and neck squamous cell carcinoma: mounting evidence for an etiologic role for human papillomavirus in a subset of head and neck cancers. Curr Opin Oncol. 2001;13(3):183–188. doi: 10.1097/00001622-199905000-00010. [DOI] [PubMed] [Google Scholar]
- 11.Westra WH. The changing face of head and neck cancer in the 21st century: the impact of HPV on the epidemiology and pathology of oral cancer. Head Neck Pathol. 2009;3(1):78–81. doi: 10.1007/s12105-009-0100-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Herrero R, Castellsagué X, Pawlita M, Lissowska J, Kee F, Balaram P, et al. Human papillomavirus and oral cancer: the International Agency for Research on Cancer multicenter study. J Natl Cancer Inst. 2003;95(23):1772–1783. doi: 10.1093/jnci/djg107. [DOI] [PubMed] [Google Scholar]
- 13.Bandhary SK, Shetty V, Saldanha M, Gatti P, Devegowda D, Pushkal S, et al. Detection of human papilloma virus and risk factors among patients with head and neck squamous cell carcinoma attending a tertiary referral centre in South India. Asian Pac J cancer Prevention: APJCP. 2018;19(5):1325. doi: 10.22034/APJCP.2018.19.5.1325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Nagpal JK, Patnaik S, Das BR. Prevalence of high-risk human papilloma virus types and its association with P53 codon 72 polymorphisms in tobacco addicted oral squamous cell carcinoma (OSCC) patients of Eastern India. Int J Cancer. 2002;97(5):649–653. doi: 10.1002/ijc.10112. [DOI] [PubMed] [Google Scholar]
- 15.Sannigrahi M, Singh V, Sharma R, Panda N, Radotra B, Khullar M. Detection of active human papilloma virus-16 in head and neck cancers of asian north indian patients. Oral Dis. 2016;22(1):62–68. doi: 10.1111/odi.12382. [DOI] [PubMed] [Google Scholar]
- 16.Ramesh PS, Devegowda D, Naik PR, Doddamani P, Nataraj SM (2018) Evaluating the feasibility of nested PCR as a screening tool to detect HPV infection in saliva of oral squamous cell carcinoma subjects. J Clin Diagnostic Res 12. 10.7860/JCDR/2018/34880.11806
- 17.Ajila V, Babu S, Shetty V, Shetty P, Devegowda D, Ramesh P, et al. Human papillomavirus in oral squamous cell carcinoma: an institutional study. Clin Cancer Invest J. 2021;10(3):102–108. doi: 10.4103/ccij.ccij_152_20. [DOI] [Google Scholar]
- 18.Laprise C, Madathil SA, Allison P, Abraham P, Raghavendran A, Shahul HP, et al. No role for human papillomavirus infection in oral cancers in a region in southern I ndia. Int J Cancer. 2016;138(4):912–917. doi: 10.1002/ijc.29827. [DOI] [PubMed] [Google Scholar]
- 19.Sand L, Jalouli J. Viruses and oral cancer. Is there a link? Microbes Infect. 2014;16(5):371–378. doi: 10.1016/j.micinf.2014.02.009. [DOI] [PubMed] [Google Scholar]
- 20.Slots J, Saygun I, Sabeti M, Kubar A. Epstein–Barr virus in oral diseases. J Periodontal Res. 2006;41(4):235–244. doi: 10.1111/j.1600-0765.2006.00865.x. [DOI] [PubMed] [Google Scholar]
- 21.Guidry JT, Birdwell CE, Scott RS. Epstein–Barr virus in the pathogenesis of oral cancers. Oral Dis. 2018;24(4):497–508. doi: 10.1111/odi.12656. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Roughan JE, Thorley-Lawson DA. The intersection of Epstein-Barr virus with the germinal center. J Virol. 2009;83(8):3968–3976. doi: 10.1128/JVI.02609-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Thorley-Lawson DA, Hawkins JB, Tracy SI, Shapiro M. The pathogenesis of Epstein–Barr virus persistent infection. Curr Opin Virol. 2013;3(3):227–232. doi: 10.1016/j.coviro.2013.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Khammissa RAG, Fourie J, Chandran R, Lemmer J, Feller L (2016) Epstein-Barr virus and its association with oral hairy leukoplakia: a short review. International Journal of Dentistry. ;2016. 10.1155/2016/4941783 [DOI] [PMC free article] [PubMed]
- 25.Mundo L, Del Porro L, Granai M, Siciliano MC, Mancini V, Santi R, et al. Frequent traces of EBV infection in Hodgkin and non-hodgkin lymphomas classified as EBV-negative by routine methods: expanding the landscape of EBV-related lymphomas. Mod Pathol. 2020;33(12):2407–2421. doi: 10.1038/s41379-020-0575-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Busson P, Keryer C, Ooka T, Corbex M. EBV-associated nasopharyngeal carcinomas: from epidemiology to virus-targeting strategies. Trends Microbiol. 2004;12(8):356–360. doi: 10.1016/j.tim.2004.06.005. [DOI] [PubMed] [Google Scholar]
- 27.Wilson AC, Mohr I. A cultured affair: HSV latency and reactivation in neurons. Trends Microbiol. 2012;20(12):604–611. doi: 10.1016/j.tim.2012.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Whitley RJ, Roizman B. Herpes simplex virus infections. The Lancet. 2001;357(9267):1513–1518. doi: 10.1016/S0140-6736(00)04638-9. [DOI] [PubMed] [Google Scholar]
- 29.Grinde B. Herpesviruses: latency and reactivation–viral strategies and host response. J oral Microbiol. 2013;5(1):22766. doi: 10.3402/jom.v5i0.22766. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Niller HH, Wolf H, Minarovits J. Viral hit and run-oncogenesis: genetic and epigenetic scenarios. Cancer Lett. 2011;305(2):200–217. doi: 10.1016/j.canlet.2010.08.007. [DOI] [PubMed] [Google Scholar]
- 31.Jain M. Assesment of correlation of herpes simplex virus-1 with oral cancer and precancer-a comparative study. J Clin Diagn Research: JCDR. 2016;10(8):ZC14. doi: 10.7860/JCDR/2016/18593.8229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Gupta B, Ariyawardana A, Johnson NW. Oral cancer in India continues in epidemic proportions: evidence base and policy initiatives. Int Dent J. 2013;63(1):12–25. doi: 10.1111/j.1875-595x.2012.00131.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Gupta B, Bray F, Kumar N, Johnson NW. Associations between oral hygiene habits, diet, tobacco and alcohol and risk of oral cancer: a case–control study from India. Cancer Epidemiol. 2017;51:7–14. doi: 10.1016/j.canep.2017.09.003. [DOI] [PubMed] [Google Scholar]
- 34.Michaud DS, Langevin SM, Eliot M, Nelson HH, Pawlita M, McClean MD, et al. High-risk HPV types and head and neck cancer. Int J Cancer. 2014;135(7):1653–1661. doi: 10.1002/ijc.28811. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Fakhry C, Gillison ML. Clinical implications of human papillomavirus in head and neck cancers. J Clin Oncology: Official J Am Soc Clin Oncol. 2006;24(17):2606. doi: 10.1200/JCO.2006.06.1291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Wang MB, Liu IY, Gornbein JA, Nguyen CT. HPV-positive oropharyngeal carcinoma: a systematic review of treatment and prognosis. Otolaryngology–Head and Neck Surgery. 2015;153(5):758–769. doi: 10.1177/0194599815592157. [DOI] [PubMed] [Google Scholar]
- 37.Kimple RJ, Smith MA, Blitzer GC, Torres AD, Martin JA, Yang RZ, et al. Enhanced radiation sensitivity in HPV-positive head and neck cancer. Cancer Res. 2013;73(15):4791–4800. doi: 10.1158/0008-5472.CAN-13-0587. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Ramesh PS, Devegowda D, Singh A, Thimmulappa RK. NRF2, p53, and p16: predictive biomarkers to stratify human papillomavirus associated head and neck cancer patients for de-escalation of cancer therapy. Crit Rev Oncol/Hematol. 2020;148:102885. doi: 10.1016/j.critrevonc.2020.102885. [DOI] [PubMed] [Google Scholar]
- 39.Humme S, Reisbach G, Feederle R, Delecluse H-J, Bousset K, Hammerschmidt W et al (2003) The EBV nuclear antigen 1 (EBNA1) enhances B cell immortalization several thousandfold. Proceedings of the National Academy of Sciences. 100(19):10989-94. 10.1073/pnas.1832776100 [DOI] [PMC free article] [PubMed]
- 40.Frappier L. Contributions of Epstein–Barr nuclear antigen 1 (EBNA1) to cell immortalization and survival. Viruses. 2012;4(9):1537–1547. doi: 10.3390/v4091537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.She Y, Nong X, Zhang M, Wang M. Epstein-Barr virus infection and oral squamous cell carcinoma risk: a meta-analysis. PLoS ONE. 2017;12(10):e0186860. doi: 10.1371/journal.pone.0186860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Prathyusha MM, Kattappagari KK, Chowdary D, Shekar PC, Alivelu D, Reddy BVR. A study on association of epstein barr virus in oral squamous cell carcinoma using polymerase chain reaction technique. J Dr NTR Univ Health Sci. 2019;8(4):233. doi: 10.4103/JDRNTRUHS.JDRNTRUHS_102_18. [DOI] [Google Scholar]
- 43.Reddy SS, Sharma S, Mysorekar V. Expression of Epstein–Barr virus among oral potentially malignant disorders and oral squamous cell carcinomas in the south indian tobacco-chewing population. J Oral Pathol Med. 2017;46(6):454–459. doi: 10.1111/jop.12508. [DOI] [PubMed] [Google Scholar]
- 44.Starr JR, Daling JR, Fitzgibbons ED, Madeleine MM, Ashley R, Galloway DA, et al. Serologic evidence of herpes simplex virus 1 infection and oropharyngeal cancer risk. Cancer Res. 2001;61(23):8459–8464. [PubMed] [Google Scholar]
- 45.Mokhtari M, Beiraghdar M (2015) Evaluation of the prevalence of herpes simplex-1 infection in oral squamous cell carcinoma specimens in Alzahra and Kashani Hospitals with polymerase chain reaction method in 2012–2013. Adv Biomedical Res 4. 10.4103/2277-9175.163996 [DOI] [PMC free article] [PubMed]
- 46.Gondivkar SM, Parikh RV, Gadbail AR, Solanke V, Chole R, Mankar M, Balsaraf S. Involvement of viral factors with head and neck cancers. Oral Oncol. 2012;48(3):195–199. doi: 10.1016/j.oraloncology.2011.10.007. [DOI] [PubMed] [Google Scholar]
- 47.Gupta K, Metgud R (2013) Evidences suggesting involvement of viruses in oral squamous cell carcinoma. Pathology research international. 2013. 10.1155/2013/642496 [DOI] [PMC free article] [PubMed]
- 48.Jalouli J, Ibrahim SO, Mehrotra R, Jalouli MM, Sapkota D, Larsson P-A, et al. Prevalence of viral (HPV, EBV, HSV) infections in oral submucous fibrosis and oral cancer from India. Acta Otolaryngol. 2010;130(11):1306–1311. doi: 10.3109/00016481003782041. [DOI] [PubMed] [Google Scholar]
- 49.Jalouli J, Jalouli MM, Sapkota D, Ibrahim SO, Larsson P-A, Sand L. Human papilloma virus, herpes simplex virus and epstein barr virus in oral squamous cell carcinoma from eight different countries. Anticancer Res. 2012;32(2):571–580. [PubMed] [Google Scholar]