Halocercus lagenorhynchi infection in a stranded striped dolphin Stenella coeruleoalba (Meyen, 1833) on the Southwest coastline of India

Abstract

Necropsy on a striped dolphin Stenella coeruleoalba (Meyen, 1833) entangled in ghost fishing net and dead while rescuing yielded some helminth parasites, later identified as Halocercus lagenorhynchi. DNA barcoding of the host and parasite and the phylogenetic analysis of the parasite was conducted. This study provides valuable information towards establishing basal data of marine mammal parasite diversity and distribution in the Indian waters. We believe this is the first report of the occurrence of Halocercus lagenorhynchi in marine mammals in India.

Introduction

India’s marine mammal diversity is recognized as one of the highest in the Indian Ocean Sanctuary, as declared by the International Whaling Commission (Kumaran 2012). Previous reports have documented the presence of 25 species of marine mammals in Indian waters (Kumaran 2002) out of a total of 40 cetacean species recorded in the Indian Ocean region. Despite this rich diversity, marine mammal research remains limited and that related to their parasites is almost non-existent. Parasites are identified as the causative agents behind the population decreases of an increasing number of wild animal species (Abbott 2006; Wyatt et al. 2008; Robinson et al. 2010; Cameron et al. 2011; Ewen et al. 2012; MacPhee and Greenwood 2013). Wildlife populations are known to harbour a variety of parasitic organisms, (Ogunji et al. 1984; Muriuki et al. 1998; Oyeleke & Edungbola 2001; Karere & Munene 2002; Moudgil & Singla 2013).- ectoparasites (Kalema-Zikusoka et al. 2002; Jongejan & Uilenberg 2004) and haemoparasites (Nizeyi et al. 2001; Mutani et al.2003; Munangandu et al. 2012; Thompson 2013; Gałęcki et al. 2015), and the frequency of parasitic illnesses, as well as the emergence of new diseases (Cunningham et al. 2018; Morens and Fauci 2020; Cupertino et al. 2020), can serve as valuable bioindicators of marine animal health and ecology. Therefore, it is imperative to gather data on the parasite diversity of marine mammals, which will establish a vital baseline for evaluating their impact on both host and ecosystem ecology (Rohde 1984; Geraci and Aubin 1987; McLaughlin et al. 2020; Lehnert et al. 2019).

Worldwide, there have been an increasing number of reports of cetacean stranding (Alvarado-Rybak et al. 2020; Sepúlveda et al. 2020; Warlick et al. 2022; Yang et al. 2023). Cetacean stranding are the results of intricate interaction of several ecological factors like biological (diseases, parasitism (Gonzales-Viera et al. 2011; Cuvertoret-Sanz et al. 2020; hearing impairments (Mann et al. 2010), environmental (ocean bathymetry and ocean processes (McGovern et al. 2018; Hamilton 2018), electrical storms (Walker et al. 2005; cyclones-Rosel & Watts 2008), geomagnetic anomalies -Granger et al. 2020; Vanselow 2020; Vanselow et al. 2009, 2018), echolocation distortion Sundaram et al. 2006) and anthropogenic factors (Laist et al. 2011; entanglement in fisheries gear– Arbelo, et al. 2013; Cassoff et al. 2011; Vishnyakova and Goldin 2015; Bouchard et al. 2019; noise pollution due to dredging, oil drilling, naval exercises -Southall et al. 2013; Brownlow et al. 2015) and marine pollution- Secchi and Zarzur 1999; Nelms et al. 2019; Page-Karjian et al. 2020). Along the numerous human and environmental variables, parasitic infections also have been suggested as contributing to cetacean stranding behaviours. The causes is still a topic of current debate, as according to some authors, parasites should be included among the potential causes of the cetacean debilitation and death. Multiple variables, such as the parasite species, its number, and the host's health state, influence the harm and death that parasitic diseases bring to individuals and populations (Oliveira et al. 2011).

In addition to affecting host behaviour and fitness (Poulin 2010; Moore 2013; Klein 2003; Richardson et al. 2022; Morton et al. 2023), parasites can control host population levels (Pedersen and Greives 2008; Dickinson et al. 2023; Scott 2023), which can sometimes have significant implications on trophic interactions, food webs(Laferty et al. 2008; McLaughlin et al. 2020; Koltz et al. 2022; Shanebeck et al. 2022), competition, biodiversity, and keystone species (Heard et al. 2013; Preston and Johnson 2010). Determining the influence of parasites on the ecology and health of marine mammals, is therefore regarded a critical step towards the implementation of appropriate management and conservation measures (Poulin et al. 2016; Lehnert et al. 2012). As any fluctuation in parasite diversity may be an indication of "ecosystem distress syndrome," parasites can be utilised as markers of environmental changes (Aznar et al.1995; Sures and Reimann 2003; Marcogliese 2004; Marcogliese 2005; van Bressem et al. 2009; Pretorius and Avenant-Oldewage 2022; Keke et al. 2020; Vidal-Martínez et al. 2010; Sures et al. 2017; 2023). Marine mammal parasitological researches in this part of the world are relatively scanty. Though Cetacean research in India has significantly advanced, following the start of a lengthy study on Indian marine mammals in 2002 (Anoop et al. 2008; Jayasankar et al. 2008; Kumarran 2009; Yousuf et al. 2008), marine mammal parasitology is not upto par. Amphimerus lancea in the Irrawaddy River dolphin (Orcaella brevirostris) from a north-eastern province of India (Price 1932); Amphimerus lancea in the dolphins - Sotalia tucuxii (= S. fluviatilis) and Orcaella brevirostris from the Pacific and Indian oceans (Brazil and India) Delyamure 1955a, b; Cyclorchis campula in the Susu or Blind River dolphin (Platanista gangetica) from Asia (India) Delyamure 1955a, b, Contracaecum gypsophocae in the dolphin Delphinus (= Platanista gangeticus (Yamaguti 1961); P. halicoris and three species of trematode parasites from dugongs in the Gulf of Mannar (Nair et al. 1975); Paradujardinia halicoris in Dugongs (Blair 1981); Paradujardinia halicoris in dugong (Anand et al. 2018), constitutes the marine mammal parasite research in India. By influencing variables like survival (Marcus et al. 2015, Seguel et al. 2017, Seguel et al. 2018), reproductive efficiency (Geraci et al. 1978; Raga and Balbuena 1993), or behavior (Balbuena and Raga 1994; Moore 2002), parasites appear to have a significant impact on the population dynamics of their hosts (Lafferty et al. 2008; Morand and Deter 2009; Measures 2018). This may result in a drop in host populations or have an impact on hosts in many subtle ways, by consuming resources and changing metabolic rate, territorial behaviour, phenology, intra- and interspecific relationships, mating and foraging success, among other subtle effects (Møller 1997).

Marine mammals are prone to infection by a wide range of parasites, both endo- and ectoparasites (Aznar et al. 2001; Colón-Llavina et al. 2019; Lehnert et al. 2019). The respiratory, cardiovascular, and even the auditory systems of mammals are all often parasitized by Metastrongyloidea (Nematoda: Strongylida), known as lungworms, lung nematodes or metastrongyloids (Measures 2001). Several nematode species belonging to the Pseudaliidae (Metastrongyloidea) family, parasitize their ultimate hosts' respiratory tracts, resulting in severe lesions within the pulmonary structures (Dougherty 1944; Testi and Pilleri 1969; Stockdale 1976; Bolt et al. 1994; Measures 2018; Pool et al. 2023). Stenurus minor, another pseudodaliid nematode, is known to create an ecological niche in the eustachian tubes, auditory peri-bullar cavity, and nasal sinuses of harbour porpoises. It frequently occurs in great numbers (Lehnert et al. 2005a, b, c; Siebert et al. 2001a, b). Of the nine Stenurus species known to exist in odontocetes worldwide (Zylber et al. 2002), a small number of species are located in bronchi and bronchioles, while the majority are found in the middle ear, cranial sinuses, and the eustachian tube (Measures 2001). It has been suggested that Stenurus, which is frequently seen in large clusters, may have a role in the stranding of Odontoceti due to its association with osseous lesions and occlusion of the auditive ducts (Delyamure 1955a, b; Dailey and Stroud 1978; Dailey and Walker 1978; Morimitsu et al. 1992). Three pseudaliid nematode species infecting harbour porpoises in German waters are Pseudalius inflexus (Pseudaliinae, Rudolphi, 1808), Torynurus convolutus (Stenurinae, Kuhn 1829) and Halocercus invaginatus (Halocercinae, Quekett 1841), all residing in the lungs (Delyamure 1955a, b; Arnold and Gaskin 1974). These nematode species often co-occur (Balbuena et al. 1994; Lehnert et al. 2005a, b, c), but inhabit different niches within the respiratory tract. While P. inflexus and T. convolutus reside in the bronchi, bronchioles and blood vessels, H. invaginatus is found in the pulmonary parenchyma, often forming encapsulated nodules (Measures 2001; Siebert et al. 2001a, b), and has also been observed in the blood vessels of Greenlandic porpoises. Parasitism of these host compartments by metastrongyles could be associated with negative health consequences (subclinical infection to bronchopneumonia) for the host or even stranding and death (Measures 2001; Bergeron et al. 1997; Seibel et al. 2010). Lungworms are known to negatively affect marine mammal health (e.g. Arnold and Gaskin 1974; Dailey and Stroud, 1978; Bishop 1979; Baker and Martin 1992). They can cause respiratory distress, influence foraging abilities and weight gain, and instigate secondary bacterial infections, which can lead to severe and often fatal bronchopneumonia (Jepson et al. 2000; Wünschmann et al. 2001; Siebert et al. 2001a, b, 2006, 2020; Jauniaux et al. 2002a, b; Lehnert et al. 2005a, b, c). However, clinical symptoms due to lungworms are sparse, difficult to observe in free-ranging cetaceans and can be non-specific (Measures 2001; van Elk et al. 2019). Nevertheless, metastrongyle nematodes are one of the most diagnosed parasites in marine mammals (Geraci and Aubin 1987). Metastrongyloid lungworm infections negatively affect odontocetes and phocids causing bronchopneumonia and secondary bacterial infections (Bergeron et al. 1997; Houde et al. 2003; Lehnert et al. 2005a, b, c; 2007; 2010; 2023; Reckendorf et al. 2021; Measures 2001; Siebert et al. 2006) resulting in mortality (Pool et al. 2020a; 2020b; 2021; 2023; Balseiro et al. 2023). Severe lung nematode loads cause respiratory discomfort, clog airways, and make it difficult for the animals to forage and dive (Geraci and Lounsbury 2001; Rojano-Doñate et al. 2018; Siebert et al. 2001a, b). Young (<1 year old) harbour seals (Phoca vitulina) and grey seals (Halichoerus grypus) are primarily susceptible to infections with Otostrongylus circumlitus like bronchitis and bronchiolitis (Field et al. 2018) and can result in several lesions in the lungs, including bronchitis, bronchopneumonia, areas of pulmonary haemorrhage and pulmonary arteritis (Measures 2018). The connection between metastrongyle infections and cetacean strandings has been reported (Tomo et al. 2010; Fauquier et al. 2009), however, the impact of Stenurus sp is debatable. Marine mammals are home to three groups of metastrongyloids that span seven genera and have a wide variety of species within each genus (Fischbach and Seguel 2023). The Pseudaliidae are a family of metastrongyloid lungworms that infect the lungs or cranial sinuses of cetaceans worldwide (Measures 2001; Anderson et al. 2009), except for Stenuroides herpestis, which is found in the lungs of the Egyptian mongoose, Herpestis ichneumon (Gerichter, 1951; Blanco et al. 1993).

Delphinids and porpoises in both hemispheres frequently have pseudaliid nematodes in their pterygoid sinuses and respiratory tracts (Lehnert et al. 2005a, b, c). Data regarding the specificity of these nematodes are very rare, partly because host sampling is very difficult and experimental work is almost impossible (Pool et al. 2021). With regard to the ecology of these two families, information is scanty but there is evidence of direct transmission in both Pseudaliidae and Filaroididae (Dailey 1978; Anderson 2000, 2009; Reckendorf et al. 2018; Pool et al. 2020a, 2021). Similarly, some species of Halocercus, and Ps. inflexus (within the Pseudaliidae), and Pa. decorus (within the Filaroididae), are known to use fish as intermediate hosts (Houde et al. 2003; Anderson et al. 2009), whereas terrestrial filaroidids rely mainly on gastropods (Anderson 2000, 2009).Opportunistic finding and molecular identification of a lung worm Halocercus lagenorhynchi, in a stranded marine striped dolphin, Stenella coeruleoalba is reported here. To the best of our knowledge, this is the first report of the infection of Halocercus lagenorhynchi, and the molecular analysis of the same. Strandings offer important information on the existence and relative abundance of cetacean species as well as on their physiology, behaviour, and health state (Soares-Castro et al. 2019, García de los Ríos et al. 2021). However, only a very few studies have dealt on parasitic diversity and prevalence in marine mammals stranded in Indian waters.

Materials and methods

Necropsy was conducted on a striped dolphin entangled in ghost fishing net and dead while rescuing (Pathissery and Sancia 2021). Tissue samples were collected from the dead striped dolphin for analysis and to confirm the identification by the sequencing of two mitochondrial genes, cox 1 and cyt b. The samples in absolute ethanol were processed by the extraction of Genomic DNA using NucleoSpin® Tissue Kit (Macherey–Nagel) following manufacturer’s instructions. The abdominal and thoracic cavities were opened and lungs and other organs were inspected. Parasites samples were collected from the severely infested lungs during the on-site necropsy, cleaned in 0.9% saline, fixed and preserved in 70% ethanol for morphological and molecular analysis. Following Delyamure 1955a, b, specimens were inspected using a light microscope and identified through their morphological similarities with the Halocercus sp. Photos were taken with a stereo microscope (Leica EZ4 HD). As noted by Pool et al 2021, it was challenging to remove complete worms, because some lungworm species have a propensity to bury their anterior ends in the parenchyma. In the case of this stranded dolphin, only presence/absence data for lungworm species could be recorded. So we confirmed the species through molecular identification.

Molecular identification of species

Genomic DNA was isolated from the tissues using NucleoSpin® Tissue Kit (Macherey-Nagel) following manufacturer’s instructions. Tissues were placed in a 1.5 ml microcentrifuge tube. 180 µl of T1 buffer and 25 µl of proteinase K was added and incubated at 56 °C in a water bath until the tissue was completely lysed. After lysis, 5 µl of RNase A (100 mg/ml) was added and incubated at room temperature for 5 minutes. 200 µl of B3 buffer was added and incubated at 70 °C for 10 minutes. 210 µl of 100% ethanol was added and mixed thoroughly by vortexing. The mixture was pipetted into NucleoSpin® Tissue column placed in a 2 ml collection tube and centrifuged at 11000 ×  g for 1 minute. The NucleoSpin® Tissue column was transferred to a new 2 ml tube and washed with 500 µl of BW buffer. Wash step was repeated using 600 µl of B5 buffer. After washing the NucleoSpin® Tissue column was placed in a clean 1.5 ml tube and DNA was eluted out using 50 µl of BE buffer.

Agarose gel electrophoresis for DNA quality check

The quality of the DNA isolated was checked using agarose gel electrophoresis. 1 µl of 6X gel-loading buffer (0.25% bromophenol blue, 30% sucrose in TE buffer pH-8.0) was added to 5 µl of DNA. The samples were loaded to 0.8% agarose gel prepared in 0.5X TBE (Tris-Borate-EDTA) buffer containing 0.5 µg/ml ethidium bromide. Electrophoresis was performed with 0.5X TBE as electrophoresis buffer at 75 V until bromophenol dye front has migrated to the bottom of the gel. The gels were visualized in a UV transilluminator (Genei) and the image was captured under UV light using Gel documentation system (Bio-Rad). The mitochondrial cytochrome oxidase I (COI) gene was amplified using the Universal primer set LCO (GGTCAACAAATCATAAAGATATTGG) and HCO (TAAACTTCAGGGTGACCAAAAAATCA) (Folmer et al. 1994). The PCR amplification was carried out in a PCR thermal cycler (GeneAmp PCR System 9700, Applied Biosystems) using the standard procedures, and Gene sequencing was done at Rajiv Gandhi Centre for Biotechnology (RGCB), Trivandrum, India and the sequence quality was checked using Sequence Scanner Software v1 (Applied Biosystems) and the final sequences and the obtained sequences from GenBank database and sequence alignment and required editing of the obtained sequences were carried out using Geneious Pro v5.1.

The 575 bp partial sequence of cox1 gene of Halocercus lagenorhynchi was searched for homology against nr database using NCBI BLASTN algorithm. We have retrieved the sequences of closest organisms in FASTA format from blast hits. The sequence alignment of retrieved sequences was performed with MUSCLE algorithm. A phylogenetic tree was constructed from alignment using maximum likelihood tree method. Both algorithms were part of Molecular Evolutionary Genetics Analysis across Computing Platforms (MEGA-X) tool.

Scanning electron microscopy (SEM)

Specimen preparation was done at Sophisticated Test and Instrumentation Centre at Cochin University of Science &Technology Campus, Cochin, India, as per the specific protocol. Adult worms were kept overnight in 2.5 % glutaraldehyde immediately after collection. Specimens were washed thrice with 0.2 M rinsing buffer at 4 °C for 15 min each. Rinsing buffer was drained off and specimens were kept in osmium tetroxide for 2–4 h at 4 °C. Then specimens were again washed thrice with 0.2 M rinsing buffer at 4 °C for 15 min each and drained off with rinsing buffer. Specimens were kept in different concentrations of ethanol viz; 30, 50, 70 and 90 % for 15–20 min each at 4 °C followed by three changes in absolute alcohol for 20 min. Finally, after complete decanting of the sampling container, specimens were placed in desiccators for overnight. Stubbing was done for SEM analysis. High quality SEM pictures of adult parasites were obtained depicting different morphological features.

Result and discussion

The stomach was found to be empty at autopsy, indicating that the entangled net over the head, had caused long-term hunger (Pathissery and Sancia 2021). Results obtained in this study confirmed the presence of Halocercus lagenorhynchi in the lungs of stranded dolphin (Fig. 1, 2 and 3). The Genbank Accession number of COX 1 sequence data generated in the study is given in Table 1.

Fig. 1.

Parasite Halocercus lagenorhynchi in Stenella coeruleoalba (Meyen, 1833) stranded in Kollam, Kerala

Fig. 2.

Images of parasite Halocercus lagenorhynchi on Stereo microscope (Leica EZ4 HD)

Fig. 3.

SEM Images of Lungworm parasite Halocercus lagenorhynchi at various magnifications

Table 1.

Genbank accession number of cox1 sequences Stenella coeruleoalba and Halocercus lagenorhynchi sequence data generated in the study

Species	Genbank accession number
Stenella coeruleoalba	MZ 292149
Halocercus lagenorhynchi	OP185229

Phylogenetic analysis

Pseudalius sequence has only 84% identity with our sequence and other Halocercus sequences and calculated a similarity score of 579 by BLAST algorithm against the maximum score of 1062. In our study pseudaliids shows highest similarity with Parafilaroids (Fig. 4).

Fig. 4.

Phylogenetic relationship of the parasite Halocercus lagenorhynchi based on maximum likelihood method

The knowledge of the parasite fauna in a specific geographical area may contribute not only to the acquisition of new information on pathogens of these animals but also to possible tools for parasite control in the area. To date, data about parasite infections of cetaceans stranded along the Indian coastline are still scarce.

Knowledge about the life cycles of pseudaliids is scanty (Pool et al 2021). It is unclear how metastrongyloids develop in marine animals (Reckendorf et al 2018). Those of pinnipeds and cetaceans are known to have prey intermediate hosts (Dailey 1970; Houde et al. 2003). However, other studies have suggested that direct infections of Halocercus species may occur in bottlenose dolphins (Tursiops truncatus) (Dailey et al., 1991; Fauquier et al. 2009) and Australian short-beaked common dolphins (Delphinus delphis) (Tomo et al. 2010).

While zoonotic diseases associated with marine mammals are relatively rare, some parasites found in these animals can potentially infect humans. Marine mammal Brucella strains capable of infecting humans and livestock (Perret et al. 2004; Sohn et al. 2003; Whatmore et al 2008), global re-emergence of Leptospirosis (Bharti et al. 2003) and the emergence of lobomycosis (Rotstein et al 2009) have all raised concerns. Since the recent COVID-19 pandemic and avian flu outbreaks, the public's awareness of the seriousness of zoonotic threats has grown. This has made it more important than ever to implement surveillance of known zoonosis and to focus research efforts on the identification of potential new pathogenic agents in order to stop epidemic consequences (Holmes 2022). In a One Health approach, it's crucial to take into account the crucial role of the "shared environment" between aquatic species and people in order to reduce any possible hazards to world health. Study of the parasites of marine mammals can inform wildlife managers, conservationists and stakeholders to devise effective conservation strategy for the protection of biodiversity and welfare of humans.

Conclusion

With the necropsy of a stranded dolphin in the Southwest coast of India, we report the first confirmed case of Halocercus lagenorhynchi in Stenella coeruleoalba (Meyen, 1833) dolphins in India. Even though the incidental find did not yield the best samples, this study still provided useful data on the prevalence of Halocercus lagenorhynchi infestation in dolphin populations that can be used as a baseline for future monitoring projects of both the population's and the environment's health. Parasites of marine mammals serve as useful markers of host habitat utilisation, diet, migration, and population dynamics (Balbuena and Raga 1994). This may prove particularly important for the conservation and management of Stenella coeruleoalba (Meyen, 1833), a protected species in India, prone to a number of threats, including anthropogenic impacts. Parasitic surveys on dead or stranded marine mammals or faeces would enlighten us on the parasite diversity, prevalence, epidemiology, zoonotic potential, implications to fisheries and or seafood safety.

Author contributions

S and PJ contributed to the study conception and design. Material preparation, and analysis were performed by S and S. Data collection and literature review was done by SM, JAT, G and M. Photographs and measurements were done by SM. The first draft of the manuscript was written by S and PJ and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

The authors declare that no funds, grants, or other support were received during the study or preparation of this manuscript.

Declarations

Conflict of interest

The authors have no financial or non-financial interests to disclose, that are directly or indirectly related to the work submitted for publication.

Ethical approval

The manuscript describes an incidental finding of a parasite in a necropsied dolphin that does not require ethical approval.