Skip to main content
Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology logoLink to Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology
. 2024 Jan 23;48(1):168–179. doi: 10.1007/s12639-024-01646-6

Halocercus lagenorhynchi infection in a stranded striped dolphin Stenella coeruleoalba (Meyen, 1833) on the Southwest coastline of India

Pathissery John Sarlin 1, Sancia Morris 2,, Siby Bhasi Geethambika 3, Lijin Gopi 4, Megha Muraleedharan 1, Jeniffer Ann Thomas 1, Gayathry Savitha 1, Polycarp Joseph 5
PMCID: PMC10908710  PMID: 38440750

Abstract

Necropsy on a striped dolphin Stenella coeruleoalba (Meyen, 1833) entangled in ghost fishing net and dead while rescuing yielded some helminth parasites, later identified as Halocercus lagenorhynchi. DNA barcoding of the host and parasite and the phylogenetic analysis of the parasite was conducted. This study provides valuable information towards establishing basal data of marine mammal parasite diversity and distribution in the Indian waters. We believe this is the first report of the occurrence of Halocercus lagenorhynchi in marine mammals in India.

Keywords: Marine mammal, Parasite, Lungworm, Metastrongyle, Molecular identification, Halocercus

Introduction

India’s marine mammal diversity is recognized as one of the highest in the Indian Ocean Sanctuary, as declared by the International Whaling Commission (Kumaran 2012). Previous reports have documented the presence of 25 species of marine mammals in Indian waters (Kumaran 2002) out of a total of 40 cetacean species recorded in the Indian Ocean region. Despite this rich diversity, marine mammal research remains limited and that related to their parasites is almost non-existent. Parasites are identified as the causative agents behind the population decreases of an increasing number of wild animal species (Abbott 2006; Wyatt et al. 2008; Robinson et al. 2010; Cameron et al. 2011; Ewen et al. 2012; MacPhee and Greenwood 2013). Wildlife populations are known to harbour a variety of parasitic organisms, (Ogunji et al. 1984; Muriuki et al. 1998; Oyeleke & Edungbola 2001; Karere & Munene 2002; Moudgil & Singla 2013).- ectoparasites (Kalema-Zikusoka et al. 2002; Jongejan & Uilenberg 2004) and haemoparasites (Nizeyi et al. 2001; Mutani et al.2003; Munangandu et al. 2012; Thompson 2013; Gałęcki et al. 2015), and the frequency of parasitic illnesses, as well as the emergence of new diseases (Cunningham et al. 2018; Morens and Fauci 2020; Cupertino et al. 2020), can serve as valuable bioindicators of marine animal health and ecology. Therefore, it is imperative to gather data on the parasite diversity of marine mammals, which will establish a vital baseline for evaluating their impact on both host and ecosystem ecology (Rohde 1984; Geraci and Aubin 1987; McLaughlin et al. 2020; Lehnert et al. 2019).

Worldwide, there have been an increasing number of reports of cetacean stranding (Alvarado-Rybak et al. 2020; Sepúlveda et al. 2020; Warlick et al. 2022; Yang et al. 2023). Cetacean stranding are the results of intricate interaction of several ecological factors like biological (diseases, parasitism (Gonzales-Viera et al. 2011; Cuvertoret-Sanz et al. 2020; hearing impairments (Mann et al. 2010), environmental (ocean bathymetry and ocean processes (McGovern et al. 2018; Hamilton 2018), electrical storms (Walker et al. 2005; cyclones-Rosel & Watts 2008), geomagnetic anomalies -Granger et al. 2020; Vanselow 2020; Vanselow et al. 2009, 2018), echolocation distortion Sundaram et al. 2006) and anthropogenic factors (Laist et al. 2011; entanglement in fisheries gear– Arbelo, et al. 2013; Cassoff et al. 2011; Vishnyakova and Goldin 2015; Bouchard et al. 2019; noise pollution due to dredging, oil drilling, naval exercises -Southall et al. 2013; Brownlow et al. 2015) and marine pollution- Secchi and Zarzur 1999; Nelms et al. 2019; Page-Karjian et al. 2020). Along the numerous human and environmental variables, parasitic infections also have been suggested as contributing to cetacean stranding behaviours. The causes is still a topic of current debate, as according to some authors, parasites should be included among the potential causes of the cetacean debilitation and death. Multiple variables, such as the parasite species, its number, and the host's health state, influence the harm and death that parasitic diseases bring to individuals and populations (Oliveira et al. 2011).

In addition to affecting host behaviour and fitness (Poulin 2010; Moore 2013; Klein 2003; Richardson et al. 2022; Morton et al. 2023), parasites can control host population levels (Pedersen and Greives 2008; Dickinson et al. 2023; Scott 2023), which can sometimes have significant implications on trophic interactions, food webs(Laferty et al. 2008; McLaughlin et al. 2020; Koltz et al. 2022; Shanebeck et al. 2022), competition, biodiversity, and keystone species (Heard et al. 2013; Preston and Johnson 2010). Determining the influence of parasites on the ecology and health of marine mammals, is therefore regarded a critical step towards the implementation of appropriate management and conservation measures (Poulin et al. 2016; Lehnert et al. 2012). As any fluctuation in parasite diversity may be an indication of "ecosystem distress syndrome," parasites can be utilised as markers of environmental changes (Aznar et al.1995; Sures and Reimann 2003; Marcogliese 2004; Marcogliese 2005; van Bressem et al. 2009; Pretorius and Avenant-Oldewage 2022; Keke et al. 2020; Vidal-Martínez et al. 2010; Sures et al. 2017; 2023). Marine mammal parasitological researches in this part of the world are relatively scanty. Though Cetacean research in India has significantly advanced, following the start of a lengthy study on Indian marine mammals in 2002 (Anoop et al. 2008; Jayasankar et al. 2008; Kumarran 2009; Yousuf et al. 2008), marine mammal parasitology is not upto par. Amphimerus lancea in the Irrawaddy River dolphin (Orcaella brevirostris) from a north-eastern province of India (Price 1932); Amphimerus lancea in the dolphins - Sotalia tucuxii (= S. fluviatilis) and Orcaella brevirostris from the Pacific and Indian oceans (Brazil and India) Delyamure 1955a, b; Cyclorchis campula in the Susu or Blind River dolphin (Platanista gangetica) from Asia (India) Delyamure 1955a, b, Contracaecum gypsophocae in the dolphin Delphinus (= Platanista gangeticus (Yamaguti 1961); P. halicoris and three species of trematode parasites from dugongs in the Gulf of Mannar (Nair et al. 1975); Paradujardinia halicoris in Dugongs (Blair 1981); Paradujardinia halicoris in dugong (Anand et al. 2018), constitutes the marine mammal parasite research in India. By influencing variables like survival (Marcus et al. 2015, Seguel et al. 2017, Seguel et al. 2018), reproductive efficiency (Geraci et al. 1978; Raga and Balbuena 1993), or behavior (Balbuena and Raga 1994; Moore 2002), parasites appear to have a significant impact on the population dynamics of their hosts (Lafferty et al. 2008; Morand and Deter 2009; Measures 2018). This may result in a drop in host populations or have an impact on hosts in many subtle ways, by consuming resources and changing metabolic rate, territorial behaviour, phenology, intra- and interspecific relationships, mating and foraging success, among other subtle effects (Møller 1997).

Marine mammals are prone to infection by a wide range of parasites, both endo- and ectoparasites (Aznar et al. 2001; Colón-Llavina et al. 2019; Lehnert et al. 2019). The respiratory, cardiovascular, and even the auditory systems of mammals are all often parasitized by Metastrongyloidea (Nematoda: Strongylida), known as lungworms, lung nematodes or metastrongyloids (Measures 2001). Several nematode species belonging to the Pseudaliidae (Metastrongyloidea) family, parasitize their ultimate hosts' respiratory tracts, resulting in severe lesions within the pulmonary structures (Dougherty 1944; Testi and Pilleri 1969; Stockdale 1976; Bolt et al. 1994; Measures 2018; Pool et al. 2023). Stenurus minor, another pseudodaliid nematode, is known to create an ecological niche in the eustachian tubes, auditory peri-bullar cavity, and nasal sinuses of harbour porpoises. It frequently occurs in great numbers (Lehnert et al. 2005a, b, c; Siebert et al. 2001a, b). Of the nine Stenurus species known to exist in odontocetes worldwide (Zylber et al. 2002), a small number of species are located in bronchi and bronchioles, while the majority are found in the middle ear, cranial sinuses, and the eustachian tube (Measures 2001). It has been suggested that Stenurus, which is frequently seen in large clusters, may have a role in the stranding of Odontoceti due to its association with osseous lesions and occlusion of the auditive ducts (Delyamure 1955a, b; Dailey and Stroud 1978; Dailey and Walker 1978; Morimitsu et al. 1992). Three pseudaliid nematode species infecting harbour porpoises in German waters are Pseudalius inflexus (Pseudaliinae, Rudolphi, 1808), Torynurus convolutus (Stenurinae, Kuhn 1829) and Halocercus invaginatus (Halocercinae, Quekett 1841), all residing in the lungs (Delyamure 1955a, b; Arnold and Gaskin 1974). These nematode species often co-occur (Balbuena et al. 1994; Lehnert et al. 2005a, b, c), but inhabit different niches within the respiratory tract. While P. inflexus and T. convolutus reside in the bronchi, bronchioles and blood vessels, H. invaginatus is found in the pulmonary parenchyma, often forming encapsulated nodules (Measures 2001; Siebert et al. 2001a, b), and has also been observed in the blood vessels of Greenlandic porpoises. Parasitism of these host compartments by metastrongyles could be associated with negative health consequences (subclinical infection to bronchopneumonia) for the host or even stranding and death (Measures 2001; Bergeron et al. 1997; Seibel et al. 2010). Lungworms are known to negatively affect marine mammal health (e.g. Arnold and Gaskin 1974; Dailey and Stroud, 1978; Bishop 1979; Baker and Martin 1992). They can cause respiratory distress, influence foraging abilities and weight gain, and instigate secondary bacterial infections, which can lead to severe and often fatal bronchopneumonia (Jepson et al. 2000; Wünschmann et al. 2001; Siebert et al. 2001a, b, 2006, 2020; Jauniaux et al. 2002a, b; Lehnert et al. 2005a, b, c). However, clinical symptoms due to lungworms are sparse, difficult to observe in free-ranging cetaceans and can be non-specific (Measures 2001; van Elk et al. 2019). Nevertheless, metastrongyle nematodes are one of the most diagnosed parasites in marine mammals (Geraci and Aubin 1987). Metastrongyloid lungworm infections negatively affect odontocetes and phocids causing bronchopneumonia and secondary bacterial infections (Bergeron et al. 1997; Houde et al. 2003; Lehnert et al. 2005a, b, c; 2007; 2010; 2023; Reckendorf et al. 2021; Measures 2001; Siebert et al. 2006) resulting in mortality (Pool et al. 2020a; 2020b; 2021; 2023; Balseiro et al. 2023). Severe lung nematode loads cause respiratory discomfort, clog airways, and make it difficult for the animals to forage and dive (Geraci and Lounsbury 2001; Rojano-Doñate et al. 2018; Siebert et al. 2001a, b). Young (<1 year old) harbour seals (Phoca vitulina) and grey seals (Halichoerus grypus) are primarily susceptible to infections with Otostrongylus circumlitus like bronchitis and bronchiolitis (Field et al. 2018) and can result in several lesions in the lungs, including bronchitis, bronchopneumonia, areas of pulmonary haemorrhage and pulmonary arteritis (Measures 2018). The connection between metastrongyle infections and cetacean strandings has been reported (Tomo et al. 2010; Fauquier et al. 2009), however, the impact of Stenurus sp is debatable. Marine mammals are home to three groups of metastrongyloids that span seven genera and have a wide variety of species within each genus (Fischbach and Seguel 2023). The Pseudaliidae are a family of metastrongyloid lungworms that infect the lungs or cranial sinuses of cetaceans worldwide (Measures 2001; Anderson et al. 2009), except for Stenuroides herpestis, which is found in the lungs of the Egyptian mongoose, Herpestis ichneumon (Gerichter, 1951; Blanco et al. 1993).

Delphinids and porpoises in both hemispheres frequently have pseudaliid nematodes in their pterygoid sinuses and respiratory tracts (Lehnert et al. 2005a, b, c). Data regarding the specificity of these nematodes are very rare, partly because host sampling is very difficult and experimental work is almost impossible (Pool et al. 2021). With regard to the ecology of these two families, information is scanty but there is evidence of direct transmission in both Pseudaliidae and Filaroididae (Dailey 1978; Anderson 2000, 2009; Reckendorf et al. 2018; Pool et al. 2020a, 2021). Similarly, some species of Halocercus, and Ps. inflexus (within the Pseudaliidae), and Pa. decorus (within the Filaroididae), are known to use fish as intermediate hosts (Houde et al. 2003; Anderson et al. 2009), whereas terrestrial filaroidids rely mainly on gastropods (Anderson 2000, 2009).Opportunistic finding and molecular identification of a lung worm Halocercus lagenorhynchi, in a stranded marine striped dolphin, Stenella coeruleoalba is reported here. To the best of our knowledge, this is the first report of the infection of Halocercus lagenorhynchi, and the molecular analysis of the same. Strandings offer important information on the existence and relative abundance of cetacean species as well as on their physiology, behaviour, and health state (Soares-Castro et al. 2019, García de los Ríos et al. 2021). However, only a very few studies have dealt on parasitic diversity and prevalence in marine mammals stranded in Indian waters.

Materials and methods

Necropsy was conducted on a striped dolphin entangled in ghost fishing net and dead while rescuing (Pathissery and Sancia 2021). Tissue samples were collected from the dead striped dolphin for analysis and to confirm the identification by the sequencing of two mitochondrial genes, cox 1 and cyt b. The samples in absolute ethanol were processed by the extraction of Genomic DNA using NucleoSpin® Tissue Kit (Macherey–Nagel) following manufacturer’s instructions. The abdominal and thoracic cavities were opened and lungs and other organs were inspected. Parasites samples were collected from the severely infested lungs during the on-site necropsy, cleaned in 0.9% saline, fixed and preserved in 70% ethanol for morphological and molecular analysis. Following Delyamure 1955a, b, specimens were inspected using a light microscope and identified through their morphological similarities with the Halocercus sp. Photos were taken with a stereo microscope (Leica EZ4 HD). As noted by Pool et al 2021, it was challenging to remove complete worms, because some lungworm species have a propensity to bury their anterior ends in the parenchyma. In the case of this stranded dolphin, only presence/absence data for lungworm species could be recorded. So we confirmed the species through molecular identification.

Molecular identification of species

Genomic DNA was isolated from the tissues using NucleoSpin® Tissue Kit (Macherey-Nagel) following manufacturer’s instructions. Tissues were placed in a 1.5 ml microcentrifuge tube. 180 µl of T1 buffer and 25 µl of proteinase K was added and incubated at 56 °C in a water bath until the tissue was completely lysed. After lysis, 5 µl of RNase A (100 mg/ml) was added and incubated at room temperature for 5 minutes. 200 µl of B3 buffer was added and incubated at 70 °C for 10 minutes. 210 µl of 100% ethanol was added and mixed thoroughly by vortexing. The mixture was pipetted into NucleoSpin® Tissue column placed in a 2 ml collection tube and centrifuged at 11000 ×  g for 1 minute. The NucleoSpin® Tissue column was transferred to a new 2 ml tube and washed with 500 µl of BW buffer. Wash step was repeated using 600 µl of B5 buffer. After washing the NucleoSpin® Tissue column was placed in a clean 1.5 ml tube and DNA was eluted out using 50 µl of BE buffer.

Agarose gel electrophoresis for DNA quality check

The quality of the DNA isolated was checked using agarose gel electrophoresis. 1 µl of 6X gel-loading buffer (0.25% bromophenol blue, 30% sucrose in TE buffer pH-8.0) was added to 5 µl of DNA. The samples were loaded to 0.8% agarose gel prepared in 0.5X TBE (Tris-Borate-EDTA) buffer containing 0.5 µg/ml ethidium bromide. Electrophoresis was performed with 0.5X TBE as electrophoresis buffer at 75 V until bromophenol dye front has migrated to the bottom of the gel. The gels were visualized in a UV transilluminator (Genei) and the image was captured under UV light using Gel documentation system (Bio-Rad). The mitochondrial cytochrome oxidase I (COI) gene was amplified using the Universal primer set LCO (GGTCAACAAATCATAAAGATATTGG) and HCO (TAAACTTCAGGGTGACCAAAAAATCA) (Folmer et al. 1994). The PCR amplification was carried out in a PCR thermal cycler (GeneAmp PCR System 9700, Applied Biosystems) using the standard procedures, and Gene sequencing was done at Rajiv Gandhi Centre for Biotechnology (RGCB), Trivandrum, India and the sequence quality was checked using Sequence Scanner Software v1 (Applied Biosystems) and the final sequences and the obtained sequences from GenBank database and sequence alignment and required editing of the obtained sequences were carried out using Geneious Pro v5.1.

The 575 bp partial sequence of cox1 gene of Halocercus lagenorhynchi was searched for homology against nr database using NCBI BLASTN algorithm. We have retrieved the sequences of closest organisms in FASTA format from blast hits. The sequence alignment of retrieved sequences was performed with MUSCLE algorithm. A phylogenetic tree was constructed from alignment using maximum likelihood tree method. Both algorithms were part of Molecular Evolutionary Genetics Analysis across Computing Platforms (MEGA-X) tool.

Scanning electron microscopy (SEM)

Specimen preparation was done at Sophisticated Test and Instrumentation Centre at Cochin University of Science &Technology Campus, Cochin, India, as per the specific protocol. Adult worms were kept overnight in 2.5 % glutaraldehyde immediately after collection. Specimens were washed thrice with 0.2 M rinsing buffer at 4 °C for 15 min each. Rinsing buffer was drained off and specimens were kept in osmium tetroxide for 2–4 h at 4 °C. Then specimens were again washed thrice with 0.2 M rinsing buffer at 4 °C for 15 min each and drained off with rinsing buffer. Specimens were kept in different concentrations of ethanol viz; 30, 50, 70 and 90 % for 15–20 min each at 4 °C followed by three changes in absolute alcohol for 20 min. Finally, after complete decanting of the sampling container, specimens were placed in desiccators for overnight. Stubbing was done for SEM analysis. High quality SEM pictures of adult parasites were obtained depicting different morphological features.

Result and discussion

The stomach was found to be empty at autopsy, indicating that the entangled net over the head, had caused long-term hunger (Pathissery and Sancia 2021). Results obtained in this study confirmed the presence of Halocercus lagenorhynchi in the lungs of stranded dolphin (Fig. 1, 2 and 3). The Genbank Accession number of COX 1 sequence data generated in the study is given in Table 1.

Fig. 1.

Fig. 1

Parasite Halocercus lagenorhynchi in Stenella coeruleoalba (Meyen, 1833) stranded in Kollam, Kerala

Fig. 2.

Fig. 2

Images of parasite Halocercus lagenorhynchi on Stereo microscope (Leica EZ4 HD)

Fig. 3.

Fig. 3

SEM Images of Lungworm parasite Halocercus lagenorhynchi at various magnifications

Table 1.

Genbank accession number of cox1 sequences Stenella coeruleoalba and Halocercus lagenorhynchi sequence data generated in the study

Species Genbank accession number
Stenella coeruleoalba MZ 292149
Halocercus lagenorhynchi OP185229

Phylogenetic analysis

Pseudalius sequence has only 84% identity with our sequence and other Halocercus sequences and calculated a similarity score of 579 by BLAST algorithm against the maximum score of 1062. In our study pseudaliids shows highest similarity with Parafilaroids (Fig. 4).

Fig. 4.

Fig. 4

Phylogenetic relationship of the parasite Halocercus lagenorhynchi based on maximum likelihood method

The knowledge of the parasite fauna in a specific geographical area may contribute not only to the acquisition of new information on pathogens of these animals but also to possible tools for parasite control in the area. To date, data about parasite infections of cetaceans stranded along the Indian coastline are still scarce.

Knowledge about the life cycles of pseudaliids is scanty (Pool et al 2021). It is unclear how metastrongyloids develop in marine animals (Reckendorf et al 2018). Those of pinnipeds and cetaceans are known to have prey intermediate hosts (Dailey 1970; Houde et al. 2003). However, other studies have suggested that direct infections of Halocercus species may occur in bottlenose dolphins (Tursiops truncatus) (Dailey et al., 1991; Fauquier et al. 2009) and Australian short-beaked common dolphins (Delphinus delphis) (Tomo et al. 2010).

While zoonotic diseases associated with marine mammals are relatively rare, some parasites found in these animals can potentially infect humans. Marine mammal Brucella strains capable of infecting humans and livestock (Perret et al. 2004; Sohn et al. 2003; Whatmore et al 2008), global re-emergence of Leptospirosis (Bharti et al. 2003) and the emergence of lobomycosis (Rotstein et al 2009) have all raised concerns. Since the recent COVID-19 pandemic and avian flu outbreaks, the public's awareness of the seriousness of zoonotic threats has grown. This has made it more important than ever to implement surveillance of known zoonosis and to focus research efforts on the identification of potential new pathogenic agents in order to stop epidemic consequences (Holmes 2022). In a One Health approach, it's crucial to take into account the crucial role of the "shared environment" between aquatic species and people in order to reduce any possible hazards to world health. Study of the parasites of marine mammals can inform wildlife managers, conservationists and stakeholders to devise effective conservation strategy for the protection of biodiversity and welfare of humans.

Conclusion

With the necropsy of a stranded dolphin in the Southwest coast of India, we report the first confirmed case of Halocercus lagenorhynchi in Stenella coeruleoalba (Meyen, 1833) dolphins in India. Even though the incidental find did not yield the best samples, this study still provided useful data on the prevalence of Halocercus lagenorhynchi infestation in dolphin populations that can be used as a baseline for future monitoring projects of both the population's and the environment's health. Parasites of marine mammals serve as useful markers of host habitat utilisation, diet, migration, and population dynamics (Balbuena and Raga 1994). This may prove particularly important for the conservation and management of Stenella coeruleoalba (Meyen, 1833), a protected species in India, prone to a number of threats, including anthropogenic impacts. Parasitic surveys on dead or stranded marine mammals or faeces would enlighten us on the parasite diversity, prevalence, epidemiology, zoonotic potential, implications to fisheries and or seafood safety.

Acknowledgements

We are grateful to the Kerala Forest and Wildlife Department, Kollam, Kerala, India; Coastal Police, Neendakara, Kerala, India; Fatima Mata National College (Autonomous), Kollam, Kerala, India, for their support. The authors acknowledge the Sophisticated Analytical Instrumentation Facility (SAIF-DST) Cochin, Kerala, India for instrumental support.

Author contributions

S and PJ contributed to the study conception and design. Material preparation, and analysis were performed by S and S. Data collection and literature review was done by SM, JAT, G and M. Photographs and measurements were done by SM. The first draft of the manuscript was written by S and PJ and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

The authors declare that no funds, grants, or other support were received during the study or preparation of this manuscript.

Declarations

Conflict of interest

The authors have no financial or non-financial interests to disclose, that are directly or indirectly related to the work submitted for publication.

Ethical approval

The manuscript describes an incidental finding of a parasite in a necropsied dolphin that does not require ethical approval.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Abbott I. Mammalian faunal collapse in Western Australia, 1875–1925: the hypothesised role of epizootic disease and a conceptual model of its origin, introduction, transmission and spread. Aust Zool. 2006;33:530–561. doi: 10.7882/AZ.2006.024. [DOI] [Google Scholar]
  2. Alvarado-Rybak M, Toro F, Escobar-Dodero J, et al. 50 years of cetacean stranding’s reveal a concerning rise in chilean patagonia. Sci Rep. 2020;10:9511. doi: 10.1038/s41598-020-66484-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anand Y, Highland H, George LB, Kamboji RD. Parasitic nematode in dead stranded dugong on Mithapur coast, Okha, Gujarat. India Curr Sci. 2018;115:7. [Google Scholar]
  4. Anderson RC. Nematode parasites of vertebrates: their development and transmission. 2. Wallingford: CABI Publishing; 2000. [Google Scholar]
  5. Anderson RC, Chabaud AG, Willmott S. Keys to the nematode parasites of vertebrates. Arch Vol Parasit Vectors. 2009;2:42. doi: 10.1186/1756-3305-2-42. [DOI] [Google Scholar]
  6. Anoop AK, Yousuf KSSM, Kumaran PL, Harish N, Anoop B, Afsal VV, Rajagopalan M, Vivekanandan E, Krishnakumar PK, Jayasankar P. Stomach contents of cetaceans incidentally caught along Mangalore and Chennai coasts of India. Est Coast Shelf Sci. 2008;76:909–913. doi: 10.1016/j.ecss.2007.08.004. [DOI] [Google Scholar]
  7. Arbelo M, Los Monteros AE, Herráez P, Andrada M, Sierra E, Rodríguez F, Jepson PD, Fernández A. Pathology and causes of death of stranded cetaceans in the Canary Islands (1999–2005) Dis Aquat Org. 2013;103(2):87–99. doi: 10.3354/dao02558. [DOI] [PubMed] [Google Scholar]
  8. Arnold PW, Gaskin DE. Lungworms (Metastrongyloidea: Pseudaliidae) of harbour porpoise Phocoena phocoena (L. 1758) Can J of Zool. 1974;53:713–735. doi: 10.1139/z75-087. [DOI] [PubMed] [Google Scholar]
  9. Aznar F, Raga J, Corcuera J, Monzón F. Helminths as biological tags for franciscana (Pontoporia blainvillei) (Cetacea, Pontoporiidae) in Argentinian and Uruguayan waters. Mammalia. 1995;59:427–436. doi: 10.1515/mamm.1995.59.3.427. [DOI] [Google Scholar]
  10. Aznar FJ, Balbuena JA, Fernández M, Raga JA (2001) Living Together: The Parasites of Marine Mammals. In: M Mammals (Eds). PGH Evans, JA Raga (Boston, MA: Springer), pp 385–423
  11. Baker JR, Martin AR. Causes of mortality and parasites and incidental lesions in harbour porpoises (Phocoena phocoena) from British waters. Vet Rec. 1992;130:554–558. doi: 10.1136/vr.130.25.554. [DOI] [PubMed] [Google Scholar]
  12. Balbuena JA, Raga JA. Intestinal helminths as indicators of segregation and social structure of pods of long-finned pilot whales (Globicephala melas) off the Faeroe Islands. Can J Zool. 1994;72:443–448. doi: 10.1139/z94-062. [DOI] [Google Scholar]
  13. Balseiro A, Herrero-García G, Royo LJ, Armenteros JÁ, Altonaga JR, Monasterio JM, Balsera R, Pool RV, García Marín JF, Pis-Millán JA. Hypertrophic osteopathy in a common dolphin (Delphinus delphis) with concurrent pulmonary Halocercus delphini infestation. Heliyon. 2023;9(6):e17011. doi: 10.1016/j.heliyon.2023.e17011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Bergeron E, Measures LN, Huot J. Lungworm (Otostrongylus circumlitus) infections in ringed seals (Phoca hispida) from eastern Arctic Canada. Can J Fish Aquat Sci. 1997;54:2443–2448. doi: 10.1139/f97-153. [DOI] [Google Scholar]
  15. Bharti AR, Nally JE, Ricaldi JN, Matthias MA, Diaz MM, Lovett MA, Levett PN, Gilman RH, Willig MR, Gotuzzo E, Vinetz JM. Leptospirosis: a zoonotic disease of global importance. Lancet Infect Dis. 2003;3(12):757–771. doi: 10.1016/S1473-3099(03)00830-2. [DOI] [PubMed] [Google Scholar]
  16. Bishop L. Parasite-related lesions in a bearded seal. J Wildl Dis. 1979;15:285–293. doi: 10.7589/0090-3558-15.2.285. [DOI] [PubMed] [Google Scholar]
  17. Blair D (1981) Helminth parasites of the dugong, their collection and preservation. In: The dugong: proceedings of a seminar/workshop Marsh, H. (eds). James Cook University, Queensland, Australia
  18. Bolt G, Monrad J, Koch J, Jensen A. Canine angiostrongylosis: a review. Vet Rec. 1994;135:447–452. doi: 10.1136/vr.135.19.447. [DOI] [PubMed] [Google Scholar]
  19. Bouchard C, Bracken C, Dabin W, Van Canneyt O, Ridoux V, Spitz J, Authier M. A risk-based forecast of extreme mortality events in small cetaceans: using stranding data to inform conservation practice. Conserv Lett. 2019;12(4):e12639. doi: 10.1111/conl.12639. [DOI] [Google Scholar]
  20. Brownlow A, Baily J, Dagleish M, Deaville R, Foster G, Jensen SK, Krupp E, Law R, Penrose R, Perkins M, Read F, Jepson P (2015) Investigation into the long-finned pilot whale mass stranding event, Kyle of Durness, 22nd July 2011. In Proceedings of the 22nd ASCOBANS Advisory Committee Meeting AC22/Inf.4.6.f, Hague, Netherlands, 29 September 1 October 2015. Bonn, Germany: ASCOBANS.Cambridge, pp 391–406
  21. Cameron SA, Lozier JD, Strange JP, Koch JB, Cordes N, Solter LF, Griswold TL. Patterns of widespread decline in North American bumble bees. Proc Natl Acad Sci USA. 2011;108:662–667. doi: 10.1073/pnas.1014743108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Cassoff RM, Moore KM, McLellan WA, Barco SG, Moore RDS. Lethal entanglement in baleen whales. Dis Aquat Organis. 2011;96(3):175–185. doi: 10.3354/dao02385. [DOI] [PubMed] [Google Scholar]
  23. Colón-Llavina MM, Mattiucci S, Nascetti G, Harvey JT, Williams EH, Mignucci-Giannoni AA. Some metazoan parasites from marine mammals stranded in California. Pacific Sci. 2019;73(4):461–473. doi: 10.2984/73.4.3. [DOI] [Google Scholar]
  24. Cunningham AA, Daszak P, Wood JLN. One health, emerging infectious diseases and wildlife: two decades of progress? Philos Trans R Soc Lond B Biol Sci. 2018;372(1725):20160167. doi: 10.1098/rstb.2016.0167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Cupertino MC, Resende MB, Mayer NA, Carvalho LM, Siqueira-Batista R. Emerging and re-emerging human infectious diseases: a systematic review of the role of wild animals with a focus on public health impact. Asian Paci J Trop Med. 2020;13(3):99–106. doi: 10.4103/1995-7645.277535. [DOI] [Google Scholar]
  26. Cuvertoret-Sanz M, López-Figueroa C, O'Byrne A, Canturri A, Martí-Garcia B, Pintado E, Pérez L, Ganges L, Cobos A, Abarca ML, Raga JA, Van Bressem MF, Domingo M. Causes of cetacean stranding and death on the Catalonian coast (western Mediterranean Sea), 2012–2019. Dis Aquat Org. 2020;142:239–253. doi: 10.3354/dao03550. [DOI] [PubMed] [Google Scholar]
  27. Dailey MD. Stroud R. parasites and associated pathology observed in cetaceans stranded along the oregon coast. J Wildl Dis. 1978;14:503–511. doi: 10.7589/0090-3558-14.4.503. [DOI] [PubMed] [Google Scholar]
  28. Dailey MD, Walker WA. Parasitism as a factor (?) in single stranding of southern California cetaceans. J Parasitol. 1978;64:593–596. doi: 10.2307/3279939. [DOI] [PubMed] [Google Scholar]
  29. Delyamure SL, Izdatel’stvo Akademii Nauk SSSR; Moscow: (1955) Helminthofauna of marine mammals (Ecology & Phylogeny) translated by Israel program for scientific translation. Jerusalem, 1968
  30. Delyamure SL (1955) Helminthofauna of marine mammals (ecology and phylogeny) Moscow: Izdatel’stvo Akademii Nauk SSSR; 1955
  31. Dickinson ER, Orsel K, Cuyler C, Kutz SJ. Life history matters: differential effects of abomasal parasites on caribou fitness. Intern J Parasit. 2023;53:221–231. doi: 10.1016/j.ijpara.2023.01.001. [DOI] [PubMed] [Google Scholar]
  32. Dougherty EC. The lungworms (Nematoda: Pseudaliidae) of the Odontoceti Part I. Parasitology. 1944;36(1–2):80–94. doi: 10.1017/S0031182000012014. [DOI] [Google Scholar]
  33. Ewen JG, Acevedo-Whitehouse K, Alley MR, Carraro C, Sainsbury AW, Swinnerton K, Woodroffe R (2012) Empirical consideration of parasites and health in reintroduction. In: Ewen JG, Armstrong DP, Parker KA, Seddon PJ (eds). Reintroduction Biology. Wiley-Blackwell; Hoboken, NJ, USA: pp 320–335
  34. Fauquier DA, Kinsel MJ, Dailey MD, Sutton GE, Stolen MK, Wells RS, Gulland FM. Prevalence and pathology of lungworm infection in bottlenose dolphins Tursiops truncatus from southwest Florida. Dis Aquat Organ. 2009;88(1):85–90. doi: 10.3354/dao02095. [DOI] [PubMed] [Google Scholar]
  35. Field CL, Gulland FMD, Johnson SP, Simeone CA, Whoriskey ST. Seal sea lion medicine. In: Gulland FMD, Dierauf LA, Whitman KL, editors. CRC handbook of marine mammal medicine. Boca Raton, Florida: Taylor and Francis; 2018. pp. 909–934. [Google Scholar]
  36. Fischbach JR, Seguel M (2023) A systematic review of the diversity and virulence correlates of metastrongyle lungworms in marine mammals. Parasitol 1–44. Advance online publication [DOI] [PMC free article] [PubMed]
  37. Gałęcki R, Sokół R, Koziatek S. Parasites of wild animals as a potential source of hazard to humans. Ann Parasit. 2015;61:105–108. [PubMed] [Google Scholar]
  38. García de los Ríos y Loshuertos A, Soler Laguía M, Arencibia Espinosa A, López Fernández A, Covelo Figueiredo P, Martínez Gomariz F, Ramírez Zarzosa G (2021) Comparative anatomy of the nasal cavity in the common dolphin Delphinus delphis L., striped dolphin Stenella coeruleoalba M. and pilot whale Globicephala melas T.: a developmental study. Animals 11(2): 441 [DOI] [PMC free article] [PubMed]
  39. Geraci JR, Aubin DJ. Effects of parasites on marine mammals. Inter J Parasitol. 1987;17:407–414. doi: 10.1016/0020-7519(87)90116-0. [DOI] [PubMed] [Google Scholar]
  40. Geraci JR, St DMD, Aubin DJ. Parasitic mastitis in the Atlantic white-sided dolphin, Lagenorhynchus acutus, as a probable factor in herd productivity. J Fish Res Board Can. 1978;35:1350–1355. doi: 10.1139/f78-210. [DOI] [Google Scholar]
  41. Geraci JR, Lounsbury VJ (2001) Marine mammal health: holding the balance in an ever‐changing sea. Mar Mammals Biol Conser 365–383
  42. Gonzales-Viera O, Chavera A, Yaipén-Llanos C, Perales-Camacho R. Histopathological aspects and etiology of pneumonias in stranded marine mammals from Lima. Peru Braz J Vet Pathol. 2011;4(1):23–29. [Google Scholar]
  43. Granger J, Walkowicz L, Fitak R, Johnsen S. Grey whales strand more often on days with increased levels of atmospheric radio-frequency noise. Curr Biol. 2020;30(4):155–156. doi: 10.1016/j.cub.2020.01.028. [DOI] [PubMed] [Google Scholar]
  44. Hamilton LJ. Large mass stranding’s of selected odontocete species: Statistics, locations, and relation to earth processes. J Cet Res Manag. 2018;19:57–78. [Google Scholar]
  45. Heard MJ, Smith KF, Ripp K, Berger M, Chen J, Dittmeier J, Goter M, McGarvey ST, Ryan E. The threat of disease increases as species move toward extinction. Conserv Biol J Soc Conser Biol. 2013;27(6):1378–1388. doi: 10.1111/cobi.12143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Holmes EC. COVID-19—lessons for zoonotic disease. Sci. 2022;375:1114–1115. doi: 10.1126/science.abn2222. [DOI] [PubMed] [Google Scholar]
  47. Houde M, Measures LN, Huot J. Experimental transmission of Pharurus pallasii (Nematoda: Metastrongyloidea), a lungworm of the cranial sinuses of the beluga whale (Delphinapterus leucas) to fish. Can J Zool. 2003;81:364–370. doi: 10.1139/z03-016. [DOI] [Google Scholar]
  48. Jauniaux T, Petitjean D, Brenez C, Borrens M, Borrens L, et al. Postmortem findings and causes of death of harbour porpoises (Phocoena phocoena) stranded from 1990 to 2000 along the coastlines of Belgium and northern France. J Comp Pathol. 2002;126:243–253. doi: 10.1053/jcpa.2001.0547. [DOI] [PubMed] [Google Scholar]
  49. Jauniaux T, Petitjean D, Brenez C, Borrens M, Brosens L, Haelters J, Tavernier T, Coignoul F. Post-mortem findings and causes of death of harbour porpoises (Phocoena phocoena) stranded from 1990 to 2000 along the coastlines of Belgium and Northern France. J Comp Pathol. 2002;126:243–253. doi: 10.1053/jcpa.2001.0547. [DOI] [PubMed] [Google Scholar]
  50. Jayasankar P, Anoop B, Vivekanandan RM, Yousuf KMM, Reynold P, Krishnakumar PK, Kumaran PL, Afsal VV, Krishnan AA. Molecular identification of delphinids and finless porpoise (Cetacea) from the Arabian Sea and Bay of Bengal. Zootaxa. 2008;1853:57–67. doi: 10.11646/zootaxa.1853.1.5. [DOI] [Google Scholar]
  51. Jepson PD, Kuiken T, Bennett PM, Baker JR, Simpson VR, Kennedy S. Pulmonary pathology of harbour porpoises (Phocoena phocoena) stranded in England and wales between 1990 and 1996. Vet Rec. 2000;146:721–728. doi: 10.1136/vr.146.25.721. [DOI] [PubMed] [Google Scholar]
  52. Jongejan F, Uilenberg G. The global importance of ticks. Parasitol. 2004 doi: 10.1017/S0031182004005967. [DOI] [PubMed] [Google Scholar]
  53. Kalema-Zikusoka G, Kock R, Macfie E. Impenetrable national park. Uganda: The Vet Rec; 2002. [DOI] [PubMed] [Google Scholar]
  54. Karere G, Munene E. Some gastro-intestinal tract parasites in wild De Brazza’s monkeys (Cercopithecus neglectus) in Kenya. Vet Parasitol. 2002;110(1):153–157. doi: 10.1016/S0304-4017(02)00348-5. [DOI] [PubMed] [Google Scholar]
  55. Keke UN, Mgbemena AS, Arimoro FO, Omalu IC. Biomonitoring of effects and accumulations of heavy metals insults using some helminth parasites of fish as bio-indicators in an Afrotropical stream. Front Environ Sci. 2020;8:576080. doi: 10.3389/fenvs.2020.576080. [DOI] [Google Scholar]
  56. Klein SL. Parasite manipulation of the proximate mechanisms that mediate social behavior in vertebrates. Phys Behav. 2003;79:441–449. doi: 10.1016/S0031-9384(03)00163-X. [DOI] [PubMed] [Google Scholar]
  57. Koltz AM, Civitello DJ, Becker DJ, Deem SL, Classen AT, Barton B, BrennWhite M, et al. Sublethal effects of parasitism on ruminants can have cascading consequences for ecosystems. Proc Natl Acad Sci. 2022;119(20):e2117381119. doi: 10.1073/pnas.2117381119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Kumaran PL. Marine mammal research in India: a review and critique of the methods. Curr Sci. 2002;83(10):1210–1220. [Google Scholar]
  59. Kumarran RP. Whither marine mammal conservation in India? Curr Sci. 2009;97(11):1521–1522. [Google Scholar]
  60. Kumarran RP. Cetaceans and cetacean research in India. J Cetacean Res Manage. 2012;12:159–172. doi: 10.47536/jcrm.v12i2.573. [DOI] [Google Scholar]
  61. Laferty KD, Allesina S, et al. Parasites in food webs: the ultimate missing links. Ecol Lett. 2008;11:533–546. doi: 10.1111/j.1461-0248.2008.01174.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Laist DW, Knowlton AR, Mead JG, Collet AS, Podesta M. Coliisions between ships and whales. Mar Mammal Sci. 2011;17:35–75. doi: 10.1111/j.1748-7692.2001.tb00980.x. [DOI] [Google Scholar]
  63. Lehnert K, Raga J, Siebert U. Macroparasites in stranded and by caught harbour porpoises from German and Norwegian waters. Dis Aquat Org. 2005;64:265–269. doi: 10.3354/dao064265. [DOI] [PubMed] [Google Scholar]
  64. Lehnert K, Raga J, Siebert U. Macroparasites in stranded and bycaught harbour porpoises from German and Norwegian waters. Dis Aquat Org. 2005;64:265–269. doi: 10.3354/dao064265. [DOI] [PubMed] [Google Scholar]
  65. Lehnert K, Raga JA, Siebert U. Macroparasites in stranded and by caught harbour porpoises from German and Norwegian waters. Dis of Aquat Org. 2005;64(3):265–269. doi: 10.3354/dao064265. [DOI] [PubMed] [Google Scholar]
  66. Lehnert LS, Geelhoed SCV, Gray I, Lehnert K, Plon S, Schmidt K, Verdaat JP, Gilles A, Herr H, Siebert Distance sampling surveys for cetaceans in Antarctic waters. Berichte Zur Polar- Und Meeresforschung. 2012;646:51–55. [Google Scholar]
  67. Lehnert K, Poulin R, Presswell B. Checklist of marine mammal parasites in new Zealand and Australian waters. J Helminthol. 2019;93:649–676. doi: 10.1017/S0022149X19000361. [DOI] [PubMed] [Google Scholar]
  68. MacPhee RDE, Greenwood AD (2013). Infectious disease, endangerment, and extinction. Int J Evol Biol 571939. [DOI] [PMC free article] [PubMed]
  69. Mann D, Hill-Cook M, Manire C, Greenhow D, Montie E, Powell J, Wells R, Bauer G, Cunningham-Smith P, Lingenfelser R, DiGiovanni R, Stone A, Brodsky M, Stevens R, Kieffer G, Hoetjes P. Hearing loss in stranded odontocete dolphins and whales. PLoS ONE. 2010;5(11):13824. doi: 10.1371/journal.pone.0013824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Marcogliese DJ. Parasites: small players with crucial roles in the ecological theater. EcoHealth. 2004;1:151–164. doi: 10.1007/s10393-004-0028-3. [DOI] [Google Scholar]
  71. Marcogliese DJ. Parasites of the superorganism: are they indicators of ecosystem health? Inter J Parasitol. 2005;35:705–716. doi: 10.1016/j.ijpara.2005.01.015. [DOI] [PubMed] [Google Scholar]
  72. Marcus AD, Higgins DP, Gray R. Ivermectin treatment of free-ranging endangered Australian sea lion (Neophoca cinerea) pups: effect on hookworm and lice infection status, haematological parameters, growth, and survival. Parasitol Res. 2015;114:2743–2755. doi: 10.1007/s00436-015-4481-4. [DOI] [PubMed] [Google Scholar]
  73. McGovern B, Culloch RM, O'Connell M, Berrow S. Temporal and spatial trends in stranding records of cetaceans on the Irish coast, 2002–2014. J of the Mar Biol Ass of the U K. 2018;98(5):977–989. doi: 10.1017/S0025315416001594. [DOI] [Google Scholar]
  74. McLaughlin JP, Dana NM, Kevin DL (2020) 'Parasites in marine food webs', in Donald C. Behringer, Brian R. Silliman, and Kevin D. Lafferty (eds) 2020, Marine Disease Ecology (Oxford, 2020; online edn, Oxford Academic, 2020), 10.1093/oso/9780198821632.003.0002
  75. Measures LN. Lungworms of marine mammals. In: Samuel WM, Pybus MJ, Kocan A, editors. Parasitic diseases of wild mammals. Iowa State University Press; 2001. pp. 279–300. [Google Scholar]
  76. Measures LN (2018) Helminths and parasitic arthropods. In: FMD Gulland, LA Dierauf, KL Whitman (eds). CRC Handbook of Marine Mammal Medicine. (3edn). CRC Press; Boca Raton: pp 471–497
  77. Møller AP. Parasitism and the evolution of host life history. In: Clayton DH, Moore J, editors. Host-parasite evolution. General principles and avian models: Oxford University Press, New York; 1997. pp. 105–127. [Google Scholar]
  78. Moore J. An overview of parasite-induced behavioral alterations—and some lessons from bats. J Exp Biol. 2013;216:11–17. doi: 10.1242/jeb.074088. [DOI] [PubMed] [Google Scholar]
  79. Moore J (2002) Parasites and the behavior of animals. Oxford: Oxford University Press.
  80. Morand S, Deter J. Parasitism and regulation of the host population. In: Thomas F, Guégan JF, Renaud F, editors. Ecology and evolution of parasitism. Oxford: Oxford University Press; 2009. pp. 83–104. [Google Scholar]
  81. Morens DM, Fauci AS. Emerging pandemic diseases: how we got to COVID-19. Cell. 2020;182:1077–1092. doi: 10.1016/j.cell.2020.08.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Morimitsu T, Kawano H, Torihara K, Kato E, Koono M. Histopathology of eighth cranial nerve of mass stranded dolphins at Goto Islands, Japan. J Wildl Dis. 1992;28:656–658. doi: 10.7589/0090-3558-28.4.656. [DOI] [PubMed] [Google Scholar]
  83. Morton JP, Huff SA, Wellman EH, Silliman BR (2023), Grazer host density mediates the ability of parasites to protect foundational plants from overgrazing. Oikos e09942
  84. Moudgil AD, Singla LD. Role of neglected wildlife disease ecology in emergence and resurgence of parasitic diseases. Trends Parasitol Res. 2013;2(2):18–23. [Google Scholar]
  85. Munang’andu HM, Siamudaala VM, Munyeme M, Nalubamba KS. Detection of parasites and parasitic infections of free-ranging wildlife on a Game Ranch in Zambia: a challenge for disease control. J Parasitol Res. 2012 doi: 10.1155/2012/296475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Muriuki SMK, Murugu RK, Munene E, Karere GM, Chai DC. Some gastro-intestinal parasites of zoonotic (public health) importance commonly observed in old world non-human primates in Kenya. Acta Trop. 1998 doi: 10.1016/s0001-706x(98)00040-0. [DOI] [PubMed] [Google Scholar]
  87. Mutani A, Rhynd K, Brown G. A preliminary investigation on the gastrointestinal helminths of the Barbados green monkey cercopithecus aethiops sabaeus. Revistado Instituto De Medicina Tropical De SãoPaulo. 2003;45(4):193–195. doi: 10.1590/S0036-46652003000400003. [DOI] [PubMed] [Google Scholar]
  88. Nair RV, Lal Mohan RS, Satyanayarana Rao K. Bull. Cent Mar Fish Res Inst. 1975;26:1–42. [Google Scholar]
  89. Nelms SE, Barnett J, Brownlow A, et al. Microplastics in marine mammals stranded around the British coast: ubiquitous but transitory? Sci Rep. 2019;9:1075. doi: 10.1038/s41598-018-37428-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Nizeyi JB, Innocent RB, Erume J, Kalema GR, Cranfield MR, Graczyk TK. Campylobacteriosis, salmonellosis, and Shigellosis in free-ranging human-habituated mountain gorillas of Uganda. J Wildl Dis. 2001;37(2):239–244. doi: 10.7589/0090-3558-37.2.239. [DOI] [PubMed] [Google Scholar]
  91. Oliveira JB, Morales JA, González-Barrientos RC, Hernández-Gamboa J, Hernández-Mora G. Parasites of cetaceans stranded on the Pacific coast of Costa Rica. Vet Parasitol. 2011;182:319–328. doi: 10.1016/j.vetpar.2011.05.014. [DOI] [PubMed] [Google Scholar]
  92. Oyeleke SB, Edungbola OJ. Prevalence of gastrointestinal helminths of wild animals in Kainji lake national park and federal college of wildlife management New-Bursa, Niger State. Nigeria Niger J Parasitol. 2001;22(2):129–136. [Google Scholar]
  93. Page-Karjian A, Lo CF, Ritchie B, Harms CA, Rotstein DS, Han S, Hassan SM, Lehner AF, Buchweitz JP, Thayer VG, Sullivan JM, Christiansen EF, Perrault JR. Anthropogenic contaminants and histopathological findings in stranded cetaceans in the southeastern United States, 2012–2018. Front Mar Sci. 2020;7:630. doi: 10.3389/fmars.2020.00630. [DOI] [Google Scholar]
  94. Pedersen AB, Greives TJ. The interaction of parasites and resources cause crashes in a wild mouse population. J Anim Ecol. 2008;77:370–377. doi: 10.1111/j.1365-2656.2007.01321.x. [DOI] [PubMed] [Google Scholar]
  95. Perrett LL, Brew SD, Stack JA, MacMillan AP, Bashiruddin JB. Experimental assessment of the pathogenicity of Brucella strains from marine mammals for pregnant sheep. Small Rumin Res. 2004;51:221–228. doi: 10.1016/S0921-4488(03)00233-5. [DOI] [Google Scholar]
  96. Pool R, Fernández M, Chandradeva N, Raga JA, Aznar FJ. The taxonomic status of Skrjabinalius guevarai gallego & selva, 1979 (nematoda: Pseudaliidae) and the synonymy of skrjabinalius delyamure, 1942 and Halocercus Baylis & Daubney 1925. Syst Parasitol. 2020;97(4):389–401. doi: 10.1007/s11230-020-09921-9. [DOI] [PubMed] [Google Scholar]
  97. Pool RN, Chandradeva G, Gkafas JA, Fernández RM, Aznar FJ. Transmission and predictors of burden of lungworms of the striped dolphin (Stenella coeruleoalba) in the Western Mediterranean. J Wildl Dis. 2020;56(1):186–191. doi: 10.7589/2018-10-242. [DOI] [PubMed] [Google Scholar]
  98. Pool R, Romero-Rubira C, Raga JA, Fernandez M, Aznar FJ. Determinants of lungworm specificity in five cetacean species in the western Mediterranean. Parasi Vect. 2021;14:196. doi: 10.1186/s13071-021-04629-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  99. Pool R, Shiozaki A, Raga JA, Fernández M, Aznar FJ. Molecular phylogeny of the Pseudaliidae (Nematoda) and the origin of associations between lungworms and marine mammals. International journal for parasitology. Parasites and Wildlife. 2023;20:192–202. doi: 10.1016/j.ijppaw.2023.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  100. Poulin R. Parasite manipulation of host behavior: an update and frequently asked questions. Adv Study Behav. 2010;41:151–186. doi: 10.1016/S0065-3454(10)41005-0. [DOI] [Google Scholar]
  101. Poulin R, Blasco-Costa I, Randhawa HS. Integrating parasitology and marine ecology: seven challenges towards greater synergy. J Sea Res. 2016;113:3–10. doi: 10.1016/j.seares.2014.10.019. [DOI] [Google Scholar]
  102. Preston D, Johnson P. Ecological consequences of parasitism. Nat Edu Know. 2010;3(10):47. [Google Scholar]
  103. Pretorius M, Avenant-Oldewage A. Parasites as biological indicators: the impact of environmental quality on the infections of Lamproglena clariae (Crustacea) on Clarias gariepinus along the vaal river. South Africa Biol Trace Element Res. 2022;200(6):2937–2947. doi: 10.1007/s12011-021-02899-5. [DOI] [PubMed] [Google Scholar]
  104. Price EW. The trematode parasites of marine mammals. Proc US Nat Mus. 1932;81(13):1–68. doi: 10.5479/si.00963801.81-2936.1. [DOI] [Google Scholar]
  105. Raga JA, Balbuena JA. Parasites of the long-finned pilot whale, Globicephala melas (Traill, 1809). European waters. Rep Int Whal Comm Spec. 1993;14:391–406. [Google Scholar]
  106. Reckendorf A, Ludes-Wehrmeister E, Wohlsein P, Tiedemann R, Siebert U, Lehnert K. First record of Halocercus sp. (Pseudaliidae) lungworm infections in two stranded neonatal orcas (Orcinus orca) Parasitol. 2018;145(12):1553–1557. doi: 10.1017/S0031182018000586. [DOI] [PubMed] [Google Scholar]
  107. Reckendorf A, Everaarts E, Bunskoek P, Haulena M, Springer A, Lehnert K, Lakemeyer J, Siebert U, Strube C. Lungworm infections in harbour porpoises (Phocoena phocoena) in the German Wadden Sea between 2006 and 2018, and serodiagnostic tests. International journal for parasitology. Parasites and Wildlife. 2021;14:53–61. doi: 10.1016/j.ijppaw.2021.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  108. Richardson EA, Taylor CE, Jabot B, Martin E, Keiser CN. The effects of habitat type and pathogen infection on tick host-seeking behaviour. Parasitol. 2022;149:59–64. doi: 10.1017/S0031182021001554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  109. Robinson RA, Lawson B, Toms MP, Peck KM, Kirkwood JK, Chantrey J, Clatworthy IR, Evans AD, Hughes LA, Hutchinson OC, John SK, Pennycott TW, Perkins MW, Rowley PS, Simpson VR, Tyler KM, Cunningham AA. Emerging infectious disease leads to rapid population declines of common British birds. PLoS ONE. 2010;5:e12215. doi: 10.1371/journal.pone.0012215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  110. Rohde K. Ecology of marine parasites. Helgolander Meeresunters. 1984;37:5–33. doi: 10.1007/BF01989293. [DOI] [Google Scholar]
  111. Rojano-Doñate L, McDonald BI, Wisniewska DM, Johnson M, Teilmann J, Wahlberg M, Højer-Kristensen J, Madsen PT. High field metabolic rates of wild harbour porpoises. J of Exper Biol. 2018;221(23):jeb185827. doi: 10.1242/jeb.185827. [DOI] [PubMed] [Google Scholar]
  112. Rosel PE, Watts H. Hurricane impacts on bottlenose dolphins in the Northern Gulf of Mexico. Gulf Mex Sci. 2008;25:88–94. [Google Scholar]
  113. Rotstein DS, Burdett LG, McLellan W, Schwacke L, Rowles T, Terio KA, Schultz S, Pabst A. Lobomycosis in offshore bottlenose dolphins (Tursiops truncatus) North Carolina Emerg Infect Dis. 2009;15(4):588–590. doi: 10.3201/eid1504.081358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  114. Sarlin PJ, Morris S. Report of a striped dolphin, Stenella coeruleoalba (Meyen, 1833) death caused by ghost fishing in South West coast of India. Uttar Pradesh J Zool. 2021;42(21):79–82. [Google Scholar]
  115. Scott ME. Helminth-host-environment interactions: Looking down from the tip of the iceberg. J Helminthol. 2023;97:e59. doi: 10.1017/S0022149X23000433. [DOI] [PubMed] [Google Scholar]
  116. Secchi ER, Zarzur S. Plastic debris ingested by a Blainville’s beaked whale, Mesoplodon densirostris, washed ashore in Brazil. Aquat Mamm. 1999;251:21–24. [Google Scholar]
  117. Seguel M, Gottdenker N. The diversity and impact of hookworm infections in wildlife. International journal for parasitology. Parasit Wildl. 2017;6(3):177–194. doi: 10.1016/j.ijppaw.2017.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  118. Seguel M, Montalva F, Perez-Venegas D, Gutierrez J, Paves HJ, Müller A, Gottdenker N. Immune-mediated hookworm clearance and survival of a marine mammal decrease with warmer ocean temperatures. Elife. 2018;7:e38432. doi: 10.7554/eLife.38432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  119. Seibel H, Beineke A, Siebert U. Mycotic otitis media in a harbour porpoise (Phocoena phocoena) J of Comp Path. 2010;143:294–296. doi: 10.1016/j.jcpa.2010.03.002. [DOI] [PubMed] [Google Scholar]
  120. Sepúlveda M, Quiñones RA, Esparza C, Carrasco P, Winckler P. Vulnerability of a top marine predator to coastal storms: a relationship between hydrodynamic drivers and stranding rates of newborn pinnipeds. Sci Rep. 2020;10:12807. doi: 10.1038/s41598-020-69124-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  121. Shanebeck KM, Besson AA, Lagrue C, Green SJ. The energetic costs of sub-lethal helminth parasites in mammals: a meta-analysis. Biol Rev. 2022;97(5):1886–1907. doi: 10.1111/brv.12867. [DOI] [PubMed] [Google Scholar]
  122. Siebert U, Wünschmann A, Weiss R, Frank H, Benke H, Frese K. Post-mortem findings in harbour porpoises (Phocoena phocoena) from the German North and baltic Seas. J Comp Pathol. 2001;124:102–114. doi: 10.1053/jcpa.2000.0436. [DOI] [PubMed] [Google Scholar]
  123. Siebert U, Wünschmann A, Weiss R, Frank H, Benke H, Frese K. Post-mortem findings in harbour porpoises (Phocoena phocoena) from the German North and Baltic Seas. J Comp Pathol. 2001;124(2–3):102–114. doi: 10.1053/jcpa.2000.0436. [DOI] [PubMed] [Google Scholar]
  124. Siebert U, Tolley K, Vikingsson GA, Ólafsdóttir D, Lehnert K, Weiss R, Baumgärtner W. Pathological findings in harbour porpoises (Phocoena phocoena) from Norwegian and Icelandic waters. J Comp Pathol. 2006;134:134–142. doi: 10.1016/j.jcpa.2005.09.002. [DOI] [PubMed] [Google Scholar]
  125. Siebert U, Pawliczka I, Benke H, von Vietinghoff V, Wolf P, Pilāts V, Kesselring T, et al. Health assessment of harbour porpoises (PHOCOENA PHOCOENA) from Baltic area of Denmark, Germany. Poland Latvia Environ Int. 2020;143:105904. doi: 10.1016/j.envint.2020.105904. [DOI] [PubMed] [Google Scholar]
  126. Soares-Castro P, Araújo-Rodrigues H, Godoy-Vitorino F, Ferreira M, Covelo P, Lopez A, Vingada J, Eira C, Santos PM. Microbiota fingerprints within the oral cavity of cetaceans as indicators for population biomonitoring. Sci Rep. 2019;9(1):13679. doi: 10.1038/s41598-019-50139-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  127. Sohn AH, Probert WS, Glaser CA, Gupta N, Bollen AW, Wong JD, Grace EM, McDonald WC. Human neurobrucellosis with intracerebral granuloma caused by a marine mammal Brucella spp. Emerg Infect Dis. 2003;9(4):485–488. doi: 10.3201/eid0904.020576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  128. Southall BL, Rowles T, Gulland F, Baird RW, Jepson PD (2013) Final report of the independent scientific review panel investigating potential contributing factors to a 2008 mass stranding of melon-headed whales (Peponocephala electra) in Antsohihy, Madagascar. Cambridge, United Kingdom: International Whaling Commission
  129. Stockdale PHG. Pulmonary pathology associated with metastrongyloid infections. Br Vet J. 1976;132:595–608. doi: 10.1016/S0007-1935(17)34536-0. [DOI] [PubMed] [Google Scholar]
  130. Sundaram B, Poje AC, Veit RR, Nganguia H. Acoustical dead zones and the spatial aggregation of whale strandings. J Theor Biol. 2006;238:764–770. doi: 10.1016/j.jtbi.2005.06.022. [DOI] [PubMed] [Google Scholar]
  131. Sures B, Reimann R. Analysis of trace metals in the antarctic host-parasite system Notothenia coriiceps and Aspersentis megarhynchus (Acanthocephala) Caught at King George Island, South Shetland Islands. Polar Biol. 2003;26:680–686. doi: 10.1007/s00300-003-0538-4. [DOI] [Google Scholar]
  132. Sures B, Nachev M, Selbach C, et al. Parasite responses to pollution: what we know and where we go in environmental parasitology. Parasit Vectors. 2017;10:65. doi: 10.1186/s13071-017-2001-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  133. Sures B, Nachev M, Schwelm J, Grabner D, Selbach C. Environmental parasitology: stressor effects on aquatic parasites. Trends in Parasitol. 2023;39(6):461–474. doi: 10.1016/j.pt.2023.03.005. [DOI] [PubMed] [Google Scholar]
  134. Testi F, Pilleri G. Verminous pulmonitis induced by Nematoda (Halocerus, Pseudaliidae) in the dolphin (Delphinus delphis L.) Invest. Cetacea. 1969;1:179–188. [Google Scholar]
  135. Thompson RA. Parasite zoonoses and wildlife: One health, spillover and human activity. Int J Parasitol. 2013;43:1079–1088. doi: 10.1016/j.ijpara.2013.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  136. Tomo I, Kemper CM, Lavery TJ. Eighteen-year study of south Australian dolphins shows variation in lung nematodes by season, year, age class, and location. J of Wildlife Dis. 2010;46:488–498. doi: 10.7589/0090-3558-46.2.488. [DOI] [PubMed] [Google Scholar]
  137. Van Bressem MF, Raga JA, Di Guardo G, et al. Emerging infectious diseases in cetaceans worldwide and the possible role of environmental stressors. Dis Aquat Organ. 2009;86:143–157. doi: 10.3354/dao02101. [DOI] [PubMed] [Google Scholar]
  138. van Elk CE, van de Bildt MWG, van Run PRWA, Bunskoek P, Meerbeek J, Foster G, Osterhaus ADME, Kuiken T. Clinical, pathological, and laboratory diagnoses of diseases of harbour porpoises (Phocoena phocoena), live stranded on the Dutch and adjacent coasts from 2003 to 2016. Vet Res. 2019;50:88. doi: 10.1186/s13567-019-0706-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  139. Vanselow KH. Where are solar storm-induced whale strandings more likely to occur? Internat J of Astrobiol. 2020;19(5):413–417. doi: 10.1017/S1473550420000051. [DOI] [Google Scholar]
  140. Vanselow KH, Ricklefs K, Colijn F. Solar driven geomagnetic anomalies and sperm whale (Physeter macrocephalus) strandings around the North Sea: an analysis of long term datasets. Open Mar Biol J. 2009;3(1):89–94. doi: 10.2174/1874450800903010089. [DOI] [Google Scholar]
  141. Vanselow KH, Jacobsen S, Hall C, Garthe S. Solar storms may trigger sperm whale strandings: Explanation approaches for multiple strandings in the North Sea in 2016. Internat J of Astrobiol. 2018;17(4):336–344. doi: 10.1017/S147355041700026X. [DOI] [Google Scholar]
  142. Vidal-Martínez VM, Pech D, Sures B, Purucker T, Poulin R. Can parasites really reveal environmental impact? Trends Parasitol. 2010;26:44–51. doi: 10.1016/j.pt.2009.11.001. [DOI] [PubMed] [Google Scholar]
  143. Vishnyakova K, Gol’din P. Cetacean stranding rate correlates with fish stock dynamics: research of harbour porpoises in the Sea of Azov. Mar Biol. 2015;162:359–366. doi: 10.1007/s00227-014-2600-x. [DOI] [Google Scholar]
  144. Walker RJ, Keith EO, Yankovsky AE, Odell DK. Environmental correlates of cetacean mass stranding sites in Florida. Mar Mammal Sci. 2005;21:327–335. doi: 10.1111/j.1748-7692.2005.tb01233.x. [DOI] [Google Scholar]
  145. Warlick AJ, Huggins JL, Lambourn DM, Duffield DA, D’Alessandro DN, Rice JM, Calambokidis J, Hanson MB, Gaydos JK, Jeffries SJ, et al. Cetacean strandings in the US Pacific northwest 2000–2019 reveal potential linkages to oceanographic variability. Front Mar Sci. 2022;9:758812. doi: 10.3389/fmars.2022.758812. [DOI] [Google Scholar]
  146. Whatmore AM, Dawson CE, Groussaud P, Koylass MS, King AC, Shankster SJ, Sohn AH, Probert WS, McDonald WL. Marine mammal Brucella genotype associated with zoonotic infection. Emerg Infect Dis. 2008;14(3):517–518. doi: 10.3201/eid1403.070829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  147. Wünschmann A, Siebert U, Frese K, Weiss R, Lockyer C, Heide-Jørgensen MP, Müller G, Baumgärtner W. Evidence of infectious diseases in harbour porpoises (Phocoena phocoena) hunted in the waters of Greenland and by-caught in the German North Sea and Baltic Sea. Vet Rec. 2001;148:715–720. doi: 10.1136/vr.148.23.715. [DOI] [PubMed] [Google Scholar]
  148. Wyatt KB, Campos PF, Gilbert MTP, Kolokotronis SO, Hynes WH, DeSalle R, Daszak P, MacPhee RDE, Greenwood AD. Historical mammal extinction on Christmas Island (Indian Ocean) correlates with introduced infectious disease. PLoS ONE. 2008;3:1–9. doi: 10.1371/journal.pone.0003602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  149. Yamaguti S. Systema Helminthum. The Nematodes of Vertebrates: Interscience; 1961. [Google Scholar]
  150. Yang S, Shengfa L, Yan J, Zunlei L. Changing trends in cetacean strandings in the East China Sea: identifying relevant variables and implications for conservation and management. Diversity. 2023;15(10):1082. doi: 10.3390/d15101082. [DOI] [Google Scholar]
  151. Yousuf KSSM, Anoop AK, Anoop B, Afsal VV, Vivekanandan E, Kumarran RP, Rajagopalan M, Krishnakumar PK, Jayasankar P. Observations on incidental catch of cetaceans in three landing centres along the Indian coast. J Mar Biol Ass UK. 2008;2:e64. [Google Scholar]
  152. Zylber MI, Failla G, Le Bas A. Stenurus globicephalae Baylis et Daubney, 1925 (Nematoda: pseudaliidae) from a False Killer Whale, Pseudorca crassidens (Cetacea: Delphinidae), stranded on the coast of uruguay. Mem Inst Oswaldo Cruz. 2002;97:221–225. doi: 10.1590/S0074-02762002000200015. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology are provided here courtesy of Springer

RESOURCES