Skip to main content
NCBI home page
Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology logoLink to Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology
. 2024 Jan 30;48(1):74–80. doi: 10.1007/s12639-024-01647-5

Molecular identification of Sarcocystis neurona in tissues of wild boars (Sus scrofa) in the border region between Brazil and Uruguay

Gilneia da Rosa 1, Isac Junior Roman 1, Letícia Trevisan Gressler 2, Juliana Felipetto Cargnelutti 3, Fernanda Silveira Flôres Vogel 1,✉
PMCID: PMC10908719  PMID: 38440759

Abstract

Sarcocystis neurona, owing to its clinical importance in domestic animals, is currently one of the most studied agents, presenting a wide range of intermediate hosts that have not yet been described, mainly in wild fauna. Thus, the aim of this study was to describe the detection and molecular detection of S. neurona by amplification of the 18S rRNA region in the tissues of wild boars killed by boar control program in border Brazil Uruguay. A total of 79 samples of DNA from wild boar tissues from the LADOPAR/UFSM sampling bank were used, with Nested-PCR reactions being performed for amplification of the 18S rRNA region and the expected final product of 290 bp. Subsequently, the positive samples were subjected to restriction fragment length polymorphism (RFLP) technique with the restriction enzymes DdeI and HPAII. A second semi-Nested reaction was performed to obtain a larger sequence of nucleotides with amplification of the 18S region and the expected final product of 500 bp for S. neurona and Nested amplification ITS1 with product final of 367 pb. In 32 samples, it was possible to detect S. neurona both by nested Nested-PCR reaction and RFLP, and the presence of the agent was confirmed by sequencing, corresponding to 40.51% of the total tissues evaluated. This is the first report of the occurrence of this species of Sarcocystis in wild boars, and further studies evaluating the role of these animals as intermediate hosts, and in the epidemiology of this protozoan are necessary, as well as verifying the risk factors for infection.

Keywords: Intermediate hosts, Molecular detection, Sarcocystis neurona, Wild boars

Introduction

Considered as the main causative agent of Equine Protozoal Myeloencephalitis (EPM) and responsible for significant mortality in marine animals (Burgess et al. 2020), S. neurona is currently one of the most studied protozoal agents. Transmitted by opossums, Didelphis virginiana in North America (Fenger et al. 1995) and D. albiventris in South America (Dubey et al. 2001a), has as intermediate hosts domestic cats (Hammerschmitt et al. 2020) sea otters, armadillos, raccoons and horses (Dubey et al. 2001a; Burgess et al. 2020).

However, its occurrence in several other animal species acting as intermediate or aberrant hosts remains to be investigated (Dubey et al. 2015a). In general, Sarcocystis spp. are relatively specific hosts in their life cycle, however, this specificity has been questioned in recent years with improvements in molecular diagnostic techniques, done by polymerase chain reaction (PCR) and Fragment Length Polymorphism technique of Restriction (PCR–RFLP) (Tanhauser et al. 1999) with subsequent DNA sequencing (Silva et al. 2009; Origlia et al. 2022).

Little is known about the occurrence and specificity of this protozoan in wild boars, and until recently, there has been no description in the literature of S. neurona infecting these animals or its participation in the cycle as an intermediate host. Species of Sarcocystis that already affect these omnivores are zoonotic S. suihominis and S. miescheriana, both considered pathogenic to domestic swine (Gazzonis et al. 2019).

In this context, the aim of this study was to describe the detection and molecular characterization of S. neurona by amplification of the 18S rRNA region in the tissues of wild boars killed by wild boar (Sus scrofa) monitoring and control plan on the Brazil-Uruguay border.

Materials and methods

Collected samples

A total of 79 samples of Sus scrofa tissues slaughtered in the region of the Brazil-Uruguay border, according to the guidelines of the Official Program of Population Control of Wild Boars in Brazil—Normative Instruction 03 of January 31, 2013 (IBAMA 2013), were forwarded to the Laboratory of Parasitic Diseases at the Federal University of Santa Maria (LADOPAR/UFSM) for molecular analysis. The samples were received already aliquoted, under refrigeration, and subjected to DNA extraction according to the protocol described by Bräunig et al. (2016) with adaptations in the lysis stage, using a kit (Wizard® Genomic DNA Purification Kit—Promega®), according to instructions from the manufacturer. As the tissues received were already aliquoted, it was not possible to carry out histopathological analyzes to look for Sarcocystis cysts.

Amplification of 18S rRNA by nested-PCR reaction

Nested-PCR directed to the 18S region was performed using the external primers Tg18s48F (5′CCATGCATGTCTAAGTATAAGC3′) and Tg18s359R (5′GTTACCCGTCACTGCCAC3′), and the internal primers Tg18s58F (5′CTAAGTATAAGCTTTTATACGGC3′) and Tg18s348R (5′TGCCACGGTAGTCCAATAC3′). Amplification was performed in two rounds under the same cycling conditions, with an initial denaturation 94 °C for 5 min, followed by 34 cycles of 94 °C for 45 s, 55 °C for 45 s, 72 °C for 45 s, and a final extension at 72 °C for 5 min in a T100™ Thermocycler (Bio-Rad®, USA) with an expected final product of 290 base pairs for S. neurona (Silva et al. 2009).

The first amplification reaction with the external primers was performed in a final volume of 25 μL, by adding 2 μL of extracted DNA, 2.5 μL of 10 × PCR Buffer (50 mM KCL; 10 mM Tris HCl; pH 9.0), 1 0.25 μL of MgCL2 (50 mM), 0.7 μL of dNTPs (10 mM), 1 μL of each primer (10 μM), 0.2 μL of Taq DNA Polymerase (5 U/μL), and 16 0.35 µL of Milli-Q Water.

For the second reaction with the internal primers, 2 μL of the product from the first reaction were added to 2.5 μL of 10 × PCR Buffer (50 mM KCL; 10 mM Tris HCl; pH 9.0), 1.25 μL of MgCL2 (50 mM), 0.7 μL of dNTPs (1.25 mM), 1 μL of each primer (10 μM), 0.2 μL of Taq DNA Polymerase (5 U/μI), and 16.35 μL of Milli-Q Water in a volume of 25 μL. Milli-Q water was used as a negative control, and a previously sequenced sample of S. neurona from the cell culture was used as a positive control.

The amplification products were visualized in an ultraviolet transilluminator after electrophoresis on a 1.5% agarose gel stained with GelRed Nucleic Acid Gel Stain. Samples with a final product of 290 bp were considered positive.

Restriction fragment length polymorphism (RFLP)

The positive samples in the Nested-PCR reaction were submitted for the RFLP technique with the restriction enzymes DdeI and HpaII, both in a final reaction volume of 20 µL, in the following proportions of reagents and separately: Mili-Q Water 12.6 µL, Buffer 2 µL, acetylated BSA 0 0.2 µL, 0.2 µL enzyme, and 5 µL DNA, and incubated at 37 °C for 60 min in T100™ Thermocycler (Bio-Rad®, USA).

After digestion, the enzyme DdeI generated two fragments for S. neurona of 184 and 114 bp, whereas HpaII generated only one restriction site of 290 bp. The resulting fragments were visualized on a 2% agarose gel stained with GelRed Nucleic Acid Stain (Invitrogen®) in an ultraviolet transilluminator.

It is important to highlight that there are two other species of Sarcocystis already consolidated in the literature that infect wild boar, S. miescheriana and S. suihominis (Gazzonis et al. 2019), however the use of HPAII and DDEI enzymes does not perform cuts for these agents, thus allowing us to differentiate the occurrence of both and the presence of S. neurona as observed.

Nested PCR—18S rRNA amplification for sequencing

After identification by RFLP of samples positive for S. neurona, a second Nested PCR reaction was performed to amplify a larger fragment for nucleotide sequencing. Amplification was also focused on the 18S rRNA region using a mixture of primers suggested in the literature, namely: external primers Sarco F (5′CGCAAATTACCCAATCCTGA3′) (Moré et al. 2011) and 3H (5′GGCAAATGCTTTCGCAGTAG3′) (Yang 2001), and in the second round of amplification, the internal primers 2L (5′GGATAAACCGTGGTAATTCTATG3′) (Yang 2001) and Sarco R (5′ATTTCTCATAAGGTGCAGGAG3′) (Moré et al. 2011). Both the reactions were performed under the following conditions: initial denaturation at 94 °C for 5 min, followed by 35 cycles of 94 °C for 45 s, 56 °C for 30 s, 72 °C for 50 s, and final extension at 72 °C for 10 min in a T100™ Thermal Cycler (Bio-Rad®, USA). The amplified products were visualized on a 2% agarose gel on an ultraviolet transilluminator, stained with GelRed Nucleic Acid Stain, and the expected final product of 500 bp was obtained for S. neurona. As a positive control, a positive sample of S. neurona previously sequenced was used, and Milli-Q water was used as a negative control.

DNA sequencing and analysis

Amplicons of the expected size from an M12B (liver) sample were sent in duplicates for nucleotide sequencing and purified using a commercial QIAquick PCR Purification kit (Qiagen, USA) according to the manufacturer’s recommendations. Gene sequencing was carried out by a specialized company, ACTGene Sequencing Service, Brazil. The generated sequences were analyzed using the Staden Package software and the similarity with sequences deposited in GenBank were determined through the Basic Local Alignment Search Tool (BLAST) of the NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Nested-PCR S. neurona amplification of ITS1

All samples positive for S. neurona were subjected to hemi-nested PCR using specific primers for S. neurona with amplification of the ITS1 region, following Valadas et al. (2016). In the first round of amplification, the primers used were: ITS-234F19 (5′-TCAACCATTGAATCCCCAA-3′) and ITS-720R19 (5′TCATTTTGAACATGTACCA3′). In the second reaction, the primers used were: ITS-234F19 (5’TCAACCATTGAATCCCCAA3′) and ITS-578R23 (5′AGCACGCCTTCATATTATAAACC3′). Both reactions were performed in a final volume of 25 µL under the following conditions: 94 °C for 3 min, followed by 35 cycles of 94 °C for 45 s, 58 °C for 30 s, and 72 °C for 90 s, with a final extension step at 72 °C for 10 min, followed by cooling to 4 °C, and the expected final product of 367 bp. A previously sequenced S. neurona sample was used as a positive control, and ultrapure water was used as a negative control. The amplified products were visualized on a 2% agarose gel. From this reaction, a triplicate sample F2E (heart) was sent for nucleotide sequencing according to the protocol described in the DNA sequencing and analysis section.

Results

Out of the total number of samples analyzed by the Nested-PCR reaction, 32 showed a 290 bp pattern for the presence of S. neurona DNA (Fig. 1). In all cases, it was possible to perform the RFLP technique and identify the presence of S. neurona (Fig. 2), corresponding to 40.51% of the total evaluated tissues. The percentages of detection per tissue analyzed are listed in Table 1.

Fig. 1.

Fig. 1

Open in a new tab

Partial amplification of the standard 18S rRNA region for S. neurona isolated from wild boar tissue samples through the Nested-PCR reaction with an expected final product of 290 bp. Lane M: Molecular weight marker (100 bp); lane C + : positive control. Lanes: K3 sample Kidney, S2 sample Spleen, H3 sample Heart, LU2 sample Lung, LIV3 sample Liver, D2 sample Diaphragm, TES5 sample Testicle, TN3 sample tonsils. Lane C-: negative control

Fig. 2.

Fig. 2

Open in a new tab

Restriction sites presented by DdeI and HpaII enzymes in the RFLP technique for standard samples of S. neurona with partial amplification of the 18S region, isolated from wild boar tissues. Lane M: Molecular weight marker (50 bp); lane C.D: positive control S. neurona with DdeI (114 and 184 bp). Lane C.H: positive control S. neurona with HpaII (290 bp). Lanes sequence: KD and KH sample Kidney whit DdeI and HpaII, HD and HH sample Heart whit DdeI and HpaII, SD and SH sample Spleen whit DdeI and HpaII, LUD and LUH sample Lung whit DdeI and HpaII, TND and TNH sample Tonsils whit DdeI and HpaII

Table 1.

Total number of samples per tissue analyzed and their respective percentages of detection of S. neurona by the Nested-PCR and RFLP techniques from the amplification of the 18S rRNA region

Tissues Total remaining samples % detection of S. neurona DNA
Kidney 8 5.06
Tonsils 8 1.27
Spleen 11 2.53
Heart 16 10.13
Lung 8 2.53
Liver 21 15.19
Diaphragm 2 1.27
Testicle 5 2.53
Total 79 40.51
Open in a new tab

Sequencing

The sequence obtained of 420 bp, revealed 100% identity and 96% coverage for S. neurona in the BLAST tool, as well as for Sarcocystis spp., Sarcocystis falcatula, and S. speeri, as shown in the Table below 2. For the ITS1 region, the sequence obtained was 180 bp with Query Cover of 100% and identity of 93.99% for S. neurona (acess Genbank MN172273.1, KP871745.1, MN822080.1).

Table 2.

Identity and similarity obtained using the BLAST tool for S. neurona isolates from wild boar tissues when compared to the sequences 18S deposited in the GenBank

References GenBank® access Agent % Query cover/identity Isolated animal species Country
Hammerschmitt et al. (2020) MN169125.1 S. neurona 96–100 Domestic feline Rio Grande do Sul/Brazil
Ogedengbe et al. (2016) KT184371.1 S. neurona 96–100 Tissue coccidia Canada and USA
Larkin et al. (2011) HQ709144.1 S. neurona 96–100 Martes pennanti Pennsylvania
Modarelli et al. (2020) MN013160.1 Sarcocystis spp. 96–100 Didelphis virginiana Texas/USA
Dubey et al. (2001b) KX610769.1 Sarcocystis spp. 96–100

D. albiventris e

D. marsupialis

 São Paulo/Brazil
Gallo et al. (2018) KX577782.1 Sarcocystis spp. 96–100 Didelphis aurita Rio de Janeiro/Brazil
Verma et al. (2018) MH626537.1 Sarcocystis falcatula 96–100 Rainbow lorikeet Philadelphia/Pennsylvania
Open in a new tab

Discussion

So far, after extensive research carried out in the scientific literature, this is the first report of detection and molecular characterization of S. neurona in wild boar tissues. The high detection rate of 40.51% DNA indicated a high level of exposure to this protozoan in the studied region. Regarded as invasive exotic fauna in Brazil, wild boars become infected with Sarcocystis species after ingestion of sporulated oocysts or free sporocysts in the environment that were eliminated by definitive hosts (Dubey et al. 2015a; Pedrosa et al. 2015).

As in other countries, these boars cause significant damage annually, including the destruction of plantations, invasion of properties, confrontation with humans and domestic animals, and act as an important reservoir and transmitter of pathogenic agents (Brandão et al. 2019).

Increased probability of infection by Sarcocystis spp. is reported in adult animals (Damriyasa et al. 2004) and may be related to longer exposure to infectious forms of the parasite (Prakas et al. 2011). In addition, their immunity is not very effective against Sarcocystis spp., causing animals to be infected many times in their lives (Lopes 2004).

Another factor to be considered underlying the high detection rate in this study was the feeding and social behaviors of wild boars. Females live in herds and are highly sociable, and strong herding behavior increases intimate social contact and may favor exposure to common sources of parasitic infections (Fonseca and Correia 2008). On the other hand, males travel long distances in search of food and mates, and ingest water and pastures from different regions, which predisposes them to infection, since sporocysts eliminated from the environment are resistant to temperature fluctuations and remain viable for months (Figueiredo et al. 1991).

In addition, hunters and their dogs may play an important role in the spread of sarcocystosis in wildlife and in the S. neurona cycle. When handling wild boars and other game animals, the viscera and potentially infected carcasses can be left behind, promoting the dissemination of the protozoan to intermediate or final hosts that will be feeding on these leftovers. Likewise, dogs with accompanying hunters may have access to infected meat (Alberto et al. 2011). In North America, S. neurona infection and the induction of neurological disease in canines have been reported, all of which are game animals or have had access to wild animal viscera and are considered aberrant or accidental hosts (Gerhold et al. 2014; Cooley et al. 2007).

Studies carried out in Brazil by Dubey et al. (2001a) describe the isolation of S. neurona from opossums of the genus Didelphis, a definitive host in the Southeast region, while Hammerschmitt et al. (2020) and Henker et al. (2020) molecularly characterize its occurrence in intermediate hosts in southern Brazil, in domestic felines and in naturally infected horses, respectively, demonstrating the circulation of the protozoan and in the case of the feline as a previously unreported host.

Our results were confirmed by sequencing of the 18S rRNA gene; however, there are no data available on the occurrence of this agent in wild boars for comparison in the literature. In recent years, molecular research directed at S. neurona has revealed its ability to adapt and infect the most diverse species with a high concentration in marine animals due to the high mortality caused in the pacific northwest (Burgess et al. 2020), northwest US, and southwestern Canadá. as reported by the authors approximately 60% of carcasses of pinnipeds and cetaceans killed by stranding showed signs consistent with meningoencephalitis and infection with S. neurona, which were confirmed by PCR (Barbosa et al. 2015).

In general, molecular studies on S. neurona in wild fauna in the Americas are scarce, but serological tests have demonstrated the wide circulation of the agent. In Peru, antibodies against S. neurona have been detected in South American seals (Jankowski et al. 2015). In Brazil, there are healthy capybaras (Valadas et al. 2010), jaguars (Onuma et al. 2014), cats (Meneses et al. 2014), and domestic dogs (Oliveira et al. 2017).

Sarcocystis neurona is considered the main cause of EPM in horses. The frequency of horses with S. neurona antibodies varies from 53.6 to 83.9% in the United States (Saville et al. 1997; Dubey et al. 2015b), while in Argentina the percentage ranges from 26.1 to 35.5% (Moré et al. 2014), in Brazil 7.92 to 26.0% (Pellizzoni et al. 2021; Ribeiro et al. 2016), Costa Rica 42.4% (Dangoudoubiyam et al. 2011) and 48.5% in Mexico (Yeargan et al. 2013).

Despite the scarcity of molecular data regarding the occurrence of S. neurona and its pathogenicity, especially for wild species, the results obtained in this study include wild boars (Sus scrofa) as potential intermediate hosts for this species and highlight the need for further research on the pathogenesis, control, and prophylaxis of infections caused by S. neurona.

Despite the scarcity of molecular data regarding the occurrence of S. neurona and its pathogenicity, especially for wild species, the results obtained in the present study suggest wild boars as possible intermediate hosts of this protozoan. Additionally, due to the way the samples were obtained, it was not possible to detect tissue cysts. However, this suggests the need for further research and serves as a warning about its occurrence and possible dissemination in wildlife, as opossums feed on carcasses of dead wild boars or discarded tissues after hunting, being an important source of infection to be considered.

Conclusion

The high detection rate of S. neurona DNA obtained in this study indicates the circulation of the protozoan in the studied region, and a high level of exposure of wild boars that circulate in this habitat. This is the first report of the detection of this species of Sarcocystis in wild boars and further studies evaluating the risk factors for infection are needed to verify the role of these animals in the epidemiology of this protozoan. In addition, this study demonstrates the importance of molecular techniques as epidemiological and diagnostic tools for determining agents involved in the infection of wild animals.

Author Contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by GdR, IJR, JFC and LTG. The first draft of the manuscript was written by GdR and FSFV and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

Gilneia da Rosa, Isac Junior Roman and Fernanda S. F. Vogel hold fellowships from the by “Conselho Nacional de Desenvolvimento Científco e Tecnológico” (CNPq). This research was partially funded by the “Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—Brasil” (CAPES)—Financial Code 001.

Data availability

The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.

Declarations

Conflict of interest

Authors declare that there is no confict of interest.

Ethical approval

No approval of research ethics committees was required to accomplish the goals of this study because experimental work was conducted with samples received for diagnosis.

Consent to participate

Not applicable.

Consent of publication

All authors consent to publication of this manuscript.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Alberto JR, Serejo JP, Vieira-Pinto M. Dog bites in hunted large game: a hygienic and economical problem for game meat production. In: Paulsen P, Bauer A, Vodnansky M, Winkelmayer R, Smulders FJM, editors. Game meat hygiene in focus. Wageningen: Wageningen Academic Publishers; 2011. [Google Scholar]
  2. Barbosa L, Johnson CK, Lambourn DM, Gibson AK, Haman KH, Huggins JL, Grigg ME. A novel S. neurona genotype XIII is associated with severe encephalitis in an unexpectedly broad range of marine mammals from the northeastern Pacific Ocean. Int J Parasitol. 2015;45:595–603. doi: 10.1016/j.ijpara.2015.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brandão LNS, Rosa JMA, Kramer B, Sousa ATHID, Trevisol IM, Silva VS, Dutra V. Detection of T. gondii infection in feral wild boars (Sus scrofa) through indirect hemagglutination and PCR. Ciênc Rural. 2019;49:3. doi: 10.1590/0103-8478cr20180640. [DOI] [Google Scholar]
  4. Bräunig P, Portella LP, Cezar AS, Libardoni F, Sangioni LA, Vogel FSF, Gonçalves PBD. DNA extraction methods and multiple sampling to improve molecular diagnosis of Sarcocystis spp. in cattle hearts. Parasitol Res. 2016;115:3913–3921. doi: 10.1007/s00436-016-5158-3. [DOI] [PubMed] [Google Scholar]
  5. Burgess TL, Tinker MT, Miller MA, Smith WA, Bodkin JL, Murray MJ, Johnson CK. Spatial epidemiological patterns suggest mechanisms of land-sea transmission for S. neurona in a coastal marine mammal. Sci Rep. 2020;10:1–9. doi: 10.1038/s41598-020-60254-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cooley AJ, Barr B, Rejmanek D. Sarcocystis neurona encephalitis in a dog. Vet Pathol. 2007;44:956–961. doi: 10.1354/vp.44-6-956. [DOI] [PubMed] [Google Scholar]
  7. Damriyasa IM, Bauer C, Edelhofer R, Failing K, Lind P, Petersen E, Zahner H. Cross-sectional survey in pig breeding farms in Hesse, Germany: seroprevalence and risk factors of infections with T. gondii, Sarcocystis spp. and Neospora caninum in sows. Vet Parasitol. 2004;126:271–286. doi: 10.1016/j.vetpar.2004.07.016. [DOI] [PubMed] [Google Scholar]
  8. Dangoudoubiyam S, Oliveira JB, Víquez C, Gómez-García A, González O, Romero JJ, Howe DK. Detection of antibodies against S. neurona, Neospora spp., and T. gondii in horses from Costa Rica. J Parasitol. 2011;97:522–524. doi: 10.1645/GE-2722.1. [DOI] [PubMed] [Google Scholar]
  9. Dubey JP, Lindsay DS, Kerber CE, Kasai N, Pena HFJ, Gennari SM, Rosenthal BM. First isolation of S. neurona from the South American opossum, D. albiventris, from Brazil. Vet Parasitol. 2001;95:295–304. doi: 10.1016/S0304-4017(00)00395-2. [DOI] [PubMed] [Google Scholar]
  10. Dubey JP, Lindsay DS, Rosenthal BM, Kerber CE, Kasai N, Pena HFJ, Gennari SM. Isolates of Sarcocystis falcatula–like organisms from South American opossums D. marsupialis and D. albiventris from Sao Paulo, Brazil. J Parasitol. 2001;87:1449–1453. doi: 10.1645/0022-3395(2001)087[1449:IOSFLO]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
  11. Dubey JP, Calero-Bernal R, Rosenthal BM, Speer CA, Fayer R. Sarcocystosis of animals and humans. Boca Raton, Flórida: CRC Press; 2015. [Google Scholar]
  12. Dubey JP, Howe DK, Furr M, Saville WJ, Marsh AE, Reed SM, Grigg ME. An update on S. neurona infections in animals and equine protozoal myeloencephalitis (EPM) Vet Parasitol. 2015;209:1–42. doi: 10.1016/j.vetpar.2015.01.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fenger CK, Granstrom DE, Langemeier JL, Stamper S, Donahue JM, Patterson JS, Dubey JP. Identification of opossums (Didelphis virginiana) as the putative definitive host of S. neurona. J Parasitol. 1995;81:916–919. doi: 10.2307/3284040. [DOI] [PubMed] [Google Scholar]
  14. Figueiredo PS. Espécies do gênero Sarcocystis Lankester, 1882 (Apicomplexa: Sarcocystidae) parasitas de ruminantes domésticos que tem o cão como hospedeiro definitivo. Arq UFRRJ. 1991;14:1–12. [Google Scholar]
  15. Fonseca C, Correia F (2008) O Javali: património natural transmontano. Mirandela: João Azevedo Editor.
  16. Gallo SSM, Lindsay DS, Ederli NB, Matteoli FP, Venancio TM, de Oliveira FCR. Identification of opossums Didelphis aurita (Wied-Neuweid, 1826) as a definitive host of Sarcocystis falcatula-like sporocysts. Parasitol Res. 2018;117:213–223. doi: 10.1007/s00436-017-5695-4. [DOI] [PubMed] [Google Scholar]
  17. Gazzonis AL, Gjerde B, Villa L, Minazzi S, Zanzani SA, Riccaboni P, Manfredi MT. Prevalence and molecular characterisation of S. miescheriana and S. suihominis in wild boars (Sus scrofa) in Italy. Parasitol Res. 2019;118:1271–1287. doi: 10.1007/s00436-019-06249-2. [DOI] [PubMed] [Google Scholar]
  18. Gerhold R, Newman SJ, Grunenwald CM, Crews A, Hodshon A, Su C. Acute onset of encephalomyelitis with atypical lesions associated with dual infection of S. neurona and T. gondii in a dog. Vet Parasitol. 2014;205:697–701. doi: 10.1016/j.vetpar.2014.09.008. [DOI] [PubMed] [Google Scholar]
  19. Hammerschmitt ME, Henker LC, Lichtler J, da Costa FVA, Soares RM, Llano HAB, Pavarini SP. First molecular characterization of S. neurona causing meningoencephalitis in a domestic cat in Brazil. Parasitol Res. 2020;119:675–682. doi: 10.1007/s00436-019-06570-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Henker LC, Bandinelli MB, de Andrade CP, Bianchi MV, Sonne L, Driemeier D, Pavarini SP. Pathological, immunohistochemical, and molecular findings of equine protozoal myeloencephalitis due to S. neurona infection in Brazilian horses. Trop Anim Health Prod. 2020;52:3809–3817. doi: 10.1007/s11250-020-02419-y. [DOI] [PubMed] [Google Scholar]
  21. Instituto Brasileiro do Meio Ambiente (2013) Instrução Normativa 3, de 31 de janeiro de 2013. https://www.ibama.gov.br/component/legislacao/?view=legislacao&legislacao=129393#:~:text=mar%C3%A7o%20de%202019),Art.,poder%C3%A3o%20ser%20distribu%C3%ADdos%20ou%20comercializados. Accessed 8 abril 2023.
  22. Jankowski G, Adkesson MJ, Saliki JT, Cárdenas-Alayza S, Majluf P. Survey for infectious disease in the South American Fur seal (Arctocephalus australis) population at Punta San Juan, Peru. J Zoo Wildl Med. 2015;46:246–254. doi: 10.1638/2014-0120.1. [DOI] [PubMed] [Google Scholar]
  23. Larkin JL, Gabriel M, Gerhold RW, Yabsley MJ, Wester JC, Humphreys JG, Dubey JP. Prevalence to Toxoplasma gondii and Sarcocystis spp. in a reintroduced fisher (Martes pennanti) population in Pennsylvania. J Parasitol. 2011;97:425–429. doi: 10.1645/GE-2623.1. [DOI] [PubMed] [Google Scholar]
  24. Lopes CWG. O gênero Sarcocystis (Lankester, 1882) (Apicomplexa: Sarcocystidae), uma questão a ser reavaliada no Brasil. Rev Bras Parasitol Vet. 2004;13:14–16. [Google Scholar]
  25. Meneses IDS, Andrade MR, Uzêda RS, Bittencourt MV, Lindsay DS, Gondim LF. Frequency of antibodies against S. neurona and Neospora caninum in domestic cats in the state of Bahia, Brazil. Rev Bras Parasitol Vet. 2014;23:526–529. doi: 10.1590/s1984-29612014080. [DOI] [PubMed] [Google Scholar]
  26. Modarelli JJ, Westrich BJ, Milholland M, Tietjen M, Castro-Arellano I, Medina RF, Esteve-Gasent MD. Prevalence of protozoan parasites in small and medium mammals in Texas, USA. Int J Parasitol Parasites Wildl. 2020;11:229–234. doi: 10.1016/j.ijppaw.2020.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Moré G, Abrahamovich P, Jurado S, Bacigalupe D, Marin JC, Rambeaud M, Venturini MC. Prevalence of Sarcocystis spp. in Argentinean cattle. Vet Parasitol. 2011;177:162–165. doi: 10.1016/j.vetpar.2010.11.036. [DOI] [PubMed] [Google Scholar]
  28. Moré G, Vissani A, Pardini L, Monina M, Muriel M, Howe D, Venturini MC. Seroprevalence of S. neurona and its association with neurologic disorders in Argentinean horses. J Equine Vet Sci. 2014;34:1051–1054. doi: 10.1016/j.jevs.2014.06.002. [DOI] [Google Scholar]
  29. Ogedengbe ME, Ogedengbe JD, Whale JC, Elliot K, Juárez-Estrada MA, Barta JR. Molecular phylogenetic analyses of tissue coccidia (Sarcocystidae; Apicomplexa) based on nuclear 18s RDNA and mitochondrial COI sequences confirms the paraphyly of the genus Hammondia. Parasitol Open. 2016;2:e2. doi: 10.1017/pao.2015.7. [DOI] [Google Scholar]
  30. Oliveira S, Silva NQB, Silveira I, Labruna MB, Gennari SM, Pena HFJ. Occurrences of antibodies against Toxoplasma gondii, Neospora spp., and Sarcocystis neurona in horses and dogs in the municipality of Pauliceia, São Paulo, Brazil. Braz J Vet Res Anim Sci. 2017;54:277–282. doi: 10.11606/issn.1678-4456.bjvras.2017.123956. [DOI] [Google Scholar]
  31. Onuma SSM, Melo ALT, Kantek DLZ, Crawshaw-Junior PG, Morato RG, May-Júnior JA, Aguiar DMD. Exposure of free-living jaguars to T. gondii, Neospora caninum and S. neurona in the Brazilian Pantanal. Braz J Vet Parasitol. 2014;23:547–553. doi: 10.1590/s1984-29612014077. [DOI] [PubMed] [Google Scholar]
  32. Origlia J, Unzaga F, Piscopo M, Moré G. Fatal sarcocystosis in psittacine birds from Argentina. Parasitol Res. 2022;121:491–497. doi: 10.1007/s00436-021-07375-6. [DOI] [PubMed] [Google Scholar]
  33. Pedrosa F, Salerno R, Padilha FVB, Galetti M. Current distribution of invasive feral pigs in Brazil: economic impacts and ecological uncertainty. Nat Conserv. 2015;13:84–87. doi: 10.1016/j.ncon.2015.04.005. [DOI] [Google Scholar]
  34. Pellizzoni SG, Costa SCL, Mery RBG, Barbieri JM, Munhoz AD, Silva AND, Albuquerque GR. Sarcocystis neurona, seroprevalence of antibodies in equines and research of oocystis in opossum in Ilhéus-Itabuna microregion, Bahia. Brazil Braz J Vet Parasitol. 2021;30:2. doi: 10.1590/S1984-29612021054. [DOI] [PubMed] [Google Scholar]
  35. Prakas P, Kutkienè L, Sruoga A, Butkauskas D. Sarcocystis sp. from the herring gull (Larus argentatus) identity to Sarcocystis wobeseri based on cyst morphology and DNA results. Parasitol Res. 2011;109:1603–1608. doi: 10.1007/s00436-011-2421-5. [DOI] [PubMed] [Google Scholar]
  36. Ribeiro MJM, Rosa MHF, Bruhn FRP, Garcia AM, Rocha CMBM, Guimarães AM. Seroepidemiology of S. neurona, T. gondii and Neospora spp. among horses in the south of the state of Minas Gerais. Brazil Braz J Vet Parasitol. 2016;25:142–150. doi: 10.1590/S1984-29612016029. [DOI] [PubMed] [Google Scholar]
  37. Saville WJ, Reed SM, Granstrom DE, Hinchcliff KW, Kohn CW, Wittum TE, Stamper S. Seroprevalence of antibodies to S. neurona in horses residing in Ohio. J Am Vet Med Assoc. 1997;210:519–524. doi: 10.2460/javma.1997.210.04.519. [DOI] [PubMed] [Google Scholar]
  38. Silva RC, Su C, Langoni H. First identification of S. tenella (Railliet, 1886) Moule, 1886 (Protozoa: Apicomplexa) by PCR in naturally infected sheep from Brazil. Vet Parasitol. 2009;165:332–336. doi: 10.1016/j.vetpar.2009.07.016. [DOI] [PubMed] [Google Scholar]
  39. Tanhauser SM, Yowell CA, Cutler TJ, Greiner EC, MacKay RJ, Dame JB. Multiple DNA markers differentiate S. neurona and Sarcocystis falcatula. J Parasitol. 1999;85:221–228. doi: 10.2307/3285623. [DOI] [PubMed] [Google Scholar]
  40. Valadas S, Gennari SM, Yai LE, Rosypal AC, Lindsay DS. Prevalence of antibodies to Trypanosoma cruzi, Leishmania infantum, Encephalitozoon cuniculi, S. neurona, and Neospora caninum in Capybara, Hydrochoerus hydrochaeris, from São Paulo State, Brazil. J Parasitol. 2010;96:521–524. doi: 10.1645/GE-2368.1. [DOI] [PubMed] [Google Scholar]
  41. Valadas SY, da Silva JI, Lopes EG, Keid LB, Zwarg T, de Oliveira AS, Soares RM. Diversity of Sarcocystis spp shed by opossums in Brazil inferred with phylogenetic analysis of DNA coding ITS1, cytochrome B, and surface antigens. Exp Parasitol. 2016;164:71–78. doi: 10.1016/j.exppara.2016.02.008. [DOI] [PubMed] [Google Scholar]
  42. Verma SK, Trupkiewicz JG, Georoff T, Dubey JP. Molecularly confirmed acute, fatal Sarcocystis falcatula infection in the rainbow lorikeets (Trichoglossus moluccanus) at the Philadelphia Zoo. J Parasitol. 2018;104:710–712. doi: 10.1645/18-78. [DOI] [PubMed] [Google Scholar]
  43. Yang ZQ. Analysis of the 18S rRNA genes of Sarcocystis species suggests that the morphologically similar organ from cattle and water buffalo should be considered the same species. Mol Biochem Parasitol. 2001;115:283–288. doi: 10.1016/s0166-6851(01)00283-3. [DOI] [PubMed] [Google Scholar]
  44. Yeargan MR, Alvarado-Esquivel C, Dubey JP, Howe DK. Prevalence of antibodies to S. neurona and Neospora hughesi in horses from Mexico. Parasit. 2013;20:29. doi: 10.1051/parasite/2013029. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.

Articles from Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology are provided here courtesy of Springer

RESOURCES