Skip to main content
NCBI home page
Molecular Genetics & Genomic Medicine logoLink to Molecular Genetics & Genomic Medicine
. 2024 Mar 3;12(3):e2411. doi: 10.1002/mgg3.2411

Identification of potential molecular mechanism related to craniofacial dysmorphism caused by FOXI3 deficiency

Xiao‐Liang Xing 1,2, Ziqiang Zeng 1,2, Yana Wang 1, Bo Pan 3,✉, Xueshuang Huang 1,2,✉
PMCID: PMC10910234  PMID: 38433559

Abstract

Background

Hemifacial macrosomia (HFM, OMIM 164210) is a complex and highly heterogeneous disease. FORKHEAD BOX I3 (FOXI3) is a susceptibility gene for HFM, and mice with loss of function of Foxi3 did exhibit a phenotype similar to craniofacial dysmorphism. However, the specific pathogenesis of HFM caused by FOXI3 deficiency remains unclear till now.

Method

In this study, we first constructed a Foxi3 deficiency (Foxi3 −/−) mouse model to verify the craniofacial phenotype of Foxi3 −/− mice, and then used RNAseq data for gene differential expression analysis to screen candidate pathogenic genes, and conducted gene expression verification analysis using quantitative real‐time PCR.

Results

By observing the phenotype of Foxi3 −/− mice, we found that craniofacial dysmorphism was present. The results of comprehensive bioinformatics analysis suggested that the craniofacial dysmorphism caused by Foxi3 deficiency may be involved in the PI3K‐Akt signaling pathway. Quantitative real‐time PCR results showed that the expression of PI3K‐Akt signaling pathway‐related gene Akt2 was significantly increased in Foxi3 −/− mice.

Conclusion

The craniofacial dysmorphism caused by the deficiency of Foxi3 may be related to the expression of Akt2 and PI3K‐Akt signaling pathway. This study laid a foundation for understanding the function of FOXI3 and the pathogenesis and treatment of related craniofacial dysmorphism caused by FOXI3 dysfunction.

Keywords: craniofacial dysmorphism, FOXI3, PI3K‐Akt signaling pathway

1. INTRODUCTION

Hemifacial macrosomia (HFM, OMIM 164210), also known as Goldenhar syndrome or oculo‐auriculo‐vertebral spectrum (OAVS) (Klein, 1990; Young & Spinner, 2023), is a complex congenital genetic disease characterized by different degrees of malformation of the eye, ear, maxillofacial, and other tissues and organs, or accompanied by dysplasia of the heart, kidney, and other organs. HFM is the second most common congenital facial disability, with a prevalence of 1 in every 3000 to 5600 live births (Paul et al., 2020). HFM is an autosomal dominant disorder characterized by mandibular hypoplasia, microtia, facial and preauricular skin tags, epibulbar dermoids, and lateral oral clefts, in addition to skeletal and cardiac abnormalities (Timberlake et al., 2021). The high heterogeneity makes molecular diagnosis of HFM and understanding its pathogenesis very difficult. The specific pathological mechanism of HFM is mainly believed to be related to the structure of the first and second pharyngeal arch (Timberlake et al., 2021), which can occur unilaterally, including ear dysplasia, microtia, preauricular depression, facial asymmetry, and other malformations. As a complex disease with multiple factors, the specific molecular mechanism of HFM has not been clarified so far. Previous studies have shown that the occurrence of craniofacial dysmorphism is influenced by both environmental and genetic factors (Beleza‐Meireles et al., 2014; Bogusiak et al., 2017; Fischer et al., 2006). Several evidences indicated that hormonal therapy, tamoxifen exposure, celiac disease, thalidomide, and disrupted fetal blood flow all increase the incidence of craniofacial dysmorphism in offspring (Beleza‐Meireles et al., 2014). Additionally, several studies have also shown that many genes mutations are closely related to the occurrence of craniofacial dysmorphism, such as MYT1 (Berenguer et al., 2017; Guida, Calzari, et al., 2021; Lopez et al., 2016; Zamariolli et al., 2019, 2021), AMIGO2 (Guida, Calzari, et al., 2021; Rengasamy Venugopalan et al., 2019), and ZYG11B (Guida, Calzari, et al., 2021; Tingaud‐Sequeira et al., 2020).

The FORKHEAD (FOX) family of transcription factors is a diverse family of regulatory proteins that play important roles in many biological processes, such as embryonic development, differentiation, proliferation, survival, and aging (Golson & Kaestner, 2016; Lam et al., 2013; Myatt & Lam, 2007). The FOX gene encodes the helix‐trans‐helical protein, which is characterized by the presence of an evolutionarily conserved “forked head” or “wing‐helix” domain through which it binds to the target DNA sequence (Singh et al., 2018). The FOX family consists of three members, FORKHEAD BOX I1 (FOXI1), FORKHEAD BOX I2 (FOXI2), and FORKHEAD BOX I3 (FOXI3). The human FOXI3 gene (GRCh38 Gene ID: 344167) encodes a 420‐amino‐acid protein. FOXI3 is expressed in the ectoderm in the head region early in embryonic development (Ohyama & Groves, 2004), which could regulate several target genes during otic placode and ear development (Birol et al., 2016; Edlund et al., 2014). Several previous genetic studies have found FOXI3 gene mutations in patients with craniofacial malformations. For example, Qin et al. (2021) found that loss‐of‐function variants in FOXI3 were found in patients with microtia and mandibular hypoplasia. Mao et al., 2023 identified 18 likely pathogenic variants of FOXI3 in 21 patients (3.1%) with craniofacial dysmorphism. Several animal model studies have shown abnormalities in the inner ear, jaw, outer and middle ears, heart and artery development, and thymus in Foxi3 −/− animals (Mao et al., 2023; Singh et al., 2018; Youssoufian et al., 1986). These findings suggest that FOXI3 is closely related to craniofacial dysmorphism and may be a susceptibility gene for HFM. However, the pathogenesis of the craniofacial dysmorphism caused by FOXI3 deficiency remains unclear till now. Therefore, the present study tried to clarify the specific mechanism of FOXI3 deficiency causing craniofacial dysmorphism by using the data from previous relevant databases and the gene expression data of constructed FOXI3 deficiency mice.

2. MATERIAL AND METHOD

2.1. Ethical compliance

All animal experiments were approved by the Ethics Committee of Hunan University of Medicine. All methods are carried out in accordance with approved guidelines.

2.2. Animal husbandry and handling

Mice were group housed with 5 mice per cage, in a room on a 12 h light/12 h dark cycle, 22 ± 2°C. Foxi3 deficiency (Foxi3 −/−) mice and wild‐type (WT) mice were obtained from heterozygous crossing and were born with the expected Mendelian frequencies. The genotype was confirmed by PCR analysis. The primer was showed as following: Foxi3 forward primer: AAGTTGTAGAAATCTGTTAGCTGTTGTGC, Foxi3 reversed primer: TCCCACCCTTAACTCCAATGAC.

2.3. Data downloading and processing

The high‐ and low‐Foxi3 expression data were obtained from GSE69237. GSM1695840, GSM1695841, GSM1695842, and GSM1695843 were set as the high‐Foxi3 expression group. GSM1695832, GSM1695833, and GSM1695834 were set as the low‐Foxi3 expression group. GEOR was used to screen the differentially expressed genes with following criteria LogFoldChange ≥1 and p value < 0.05.

2.4. Protein–Protein interaction analysis

STRING version 11 was used to assess protein–protein interaction with the default parameter. Cytoscape_v3.7.2 software was used to visualize the interaction network.

2.5. Gene enrichment analysis

DAVID was used to determine the association among target genes (https://david.ncifcrf.gov/). The significantly enriched Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) were screened with p value less than 0.05. The top 10 terms of GO and KEGG in terms of the number of enriched genes were plotted with R (3.6.2).

2.6. Weighted gene co‐expression network analysis

“Weighted gene co‐expression network analysis (WGCNA)” package in R (3.6.2) software to perform WGCNA analyses. WGCNA could integrate the sequencing results into biologically significant co‐expressed gene modules and evaluate the correlation between these gene modules and clinical features. After differentially expressed analyses, we used WGCNA to explore modules related to cancer.

2.7. Quantitative real‐time PCR

Total RNA was extracted from six pairs of E12.5 fetal mouse craniofacial tissues using the classic TRIzol method. CDNA was synthesized from the extracted total RNA using the Thermo Scientific RevertAid™ Kit (Thermo Scientific, catalog number: K16225). Quantitative real‐time PCR (qRT‐PCR) was performed using a Light Cycler® 480 Instrument II (Roche). The qRT‐PCR amplification process was as follows: an initial preprocessing stage for 2 min at 50°C, preamplification for 2 min at 95°C, followed by 60 cycles of 15 s denaturation at 95°C, 30 s annealing at 60°C, 30 s extensions at 60°C, and a final elongation step of holding at 40°C. The 2−△△CT method was employed for data analysis and mapping. All experiments were performed in triplicate. The expression of β‐actin was utilized as an internal reference. The qPCR primer was shown as follows: Akt2 forward primer: CGTGGTGAATACATCAAGACC, Akt2 reversed primer: GCTACAGAGAAATTGTTCAGGGG; Actin forward primer: GGCTGTATTCCCCTCCATCG, Actin reversed primer: CCAGTTGGTAACAATGCCATGT.

2.8. Statistical analysis

A repeated measures ANOVA followed by unpaired two‐tailed Student's t‐test was used as indicated. All results are expressed as mean ± sem.

3. RESULTS

3.1. Bioinformatics analysis for gene set from GSE69237

FOXI3 is highly expressed during embryonic development. By screening the expression data, we found that the data from GSE69237 showed that the expression of Foxi3 in iPSCs was significantly higher than that in astrocytes (Figure 1a). Therefore, these data were used to mimic the differences in gene expression that might result from Foxi3 loss. Differentially expressed analysis was carried out for those data. A total of 5077 genes were significantly different between iPSCs and astrocytes, of which 2493 genes were significantly increased in iPSCs and 2584 genes were significantly decreased in iPSCs (Figure 1b). Pearson correlation analysis was carried out for those 5077 differentially expressed genes (DEGs) and Foix3. All of those 5077 DEGs were significantly correlated with Foxi3 expression. The top 10 upregulated DEGs and top 10 downregulated DEGs are shown in Figure 1c,d. The specific expression of those top 20 DEGs is shown in Figure 1e.

FIGURE 1.

FIGURE 1

Open in a new tab

Identification of Foxi3‐related DEGs from GSE69237. (a) Expression of Foxi3 between iPSCs and astrocyte. (b) Differential expression analysis between iPSCs and astrocyte. (c) Top 10 Foxi3‐positive and ‐negative correlated DEGs. (d) Expression heatmap of top 10 Foxi3‐positive and ‐negative correlated DEGs. ** p < 0.001.

We performed GO and KEGG enrichment analysis for all of those 5077 DEGs. Term of 750 biological processes (BP), 233 cell components (CC), and 188 molecular functions (MF) were significantly enriched. In the enriched GO terms, the top 10 terms with the count of genes are shown in Figure 2a–c. KEGG enrichment analysis indicated that 125 signaling pathways were significantly enriched. Metabolic pathways, pathways in cancer, PI3K‐Akt signaling pathway, MAPK signaling pathway, human papillomavirus infection, Coronavirus disease – COVID‐19, proteoglycans in cancer, MicroRNAs in cancer, Rap1 signaling pathway, and Axon guidance were the top 10 enriched signaling pathway (Figure 2d).

FIGURE 2.

FIGURE 2

Open in a new tab

Enrichment analysis for Foxi3‐related DEGs from GSE69237. (a–c) Top 10 significantly enriched BP (a), CC (b), and MF (c). (d) Top 30 significantly enriched KEGG.

3.2. Identification of hub genes for gene set from Foxi3 deficiency mice

To know the mechanism by which Foxi3 deficiency leads to craniofacial dysmorphism, we firstly constructed a Foxi3 knockout mice model (Foxi3 −/−). The Foxi3 deficiency mice actually showed craniofacial abnormalities (Figure 3a,b). Then, we performed RNAseq analysis for the craniofacial tissues. The expressions of 534 genes (348 DEGs were upregulated and 186 were downregulated) were significantly different between WT and Foxi3 −/−mice. Pearson correlation analysis was carried out for those 534 DEGs and Foxi3. Of the 534 DEGs, 176 DEGs were determined to be associated with Foxi3 as determined by a correlation coefficient greater than 0.5. Top 10 positive and negative DGEs are shown in Figure 3d,e, respectively. The expression status of those 20 DEGs are shown in Figure 3f. Enrichment analysis indicated that 35 BP, 27 CC, and 7 MF were significantly enriched. Five signaling pathways were significantly enriched. Top 10 significantly enriched GO and KEGG are shown in Figure 4.

FIGURE 3.

FIGURE 3

Open in a new tab

Identification of Foxi3‐related DEGs from Foxi3 −/− mice. (a) Phenotype of WT and Foxi3 −/− mice. (b) Genotype of WT, Foxi3 +/−, and Foxi3 −/− mice. (c) Top 10 Foxi3‐positive and ‐negative correlated DEGs. (d) Expression heatmap of top 10 Foxi3‐positive and ‐negative correlated DEGs.

FIGURE 4.

FIGURE 4

Open in a new tab

Enrichment analysis for Foxi3‐related DEGs from Foxi3 −/− mice. (a–c) Top 10 significantly enriched BP (a), CC (b), and MF (c). (d) Top 30 significantly enriched KEGG.

3.3. Enrichment analysis for hub genes set from WGCNA

WGCNA can integrate the results of sequencing into biologically significant co‐expressed gene modules and analyze the correlation between these gene modules and diseases (Li et al., 2022). Therefore, we used WGCNA to explore modules related to craniofacial dysmorphism. Sixteen co‐expressed gene modules were discovered by WGCNA analysis (Figure 5a). As shown in Figure 2c, MEcyan and MEpurple were the two modules with the most negative and positive correlation with craniofacial dysmorphism. As shown in Figure 5b,c, 1110 genes were enriched in MEcyan (Figure 5b) while 1974 genes were enriched in MEpurple (Figure 5c).

FIGURE 5.

FIGURE 5

Open in a new tab

WGCNA and enrichment analysis from Foxi3 −/− mice. (a) Cluster dendrogram of WGCNA from Foxi3 −/− mice. (b and c) The two modules were most negatively and positively correlated with craniofacial gigantism. (b) MEcyan, negatively. (c) MEpurple, positively. (d–f) Top 10 significantly enriched BP (d), CC (e), and MF (f). (g) Top 10 significantly enriched signaling pathways.

Similarly, GO and KEGG enrichment analyses were carried out for those 3084 genes. A total of 138 BP, 74 CC, and 54 MF were significantly enriched, and 34 signaling pathways were significantly enriched. Top 10 significantly enriched GO and KEGG are shown in Figure 5d–g.

3.4. Potential mechanism of craniofacial dysmorphism caused by Foxi3 deficiency mice

After overlapping analysis of the top 10 differential genes enrichment signaling pathways from GSE69237 and Foxi3_DEGs, we found that one signaling pathway – PI3K‐Akt signaling pathway – was the only overlapping signaling pathway (Figure 6a). After overlapping analysis of the top 10 differential genes enrichment signaling pathways from Foxi3_DEGs and Foxi3_WGCNA, we found that PI3K‐Akt signaling pathway, calcium signaling pathway, and motor proteins were the overlapping signaling pathways (Figure 6a). After overlapping analysis of the top 10 differential genes enrichment signaling pathways from GSE69237 and Foxi3_WGCNA, we found PI3K‐Akt signaling pathway was the only overlapping signaling pathway (Figure 6a). Only PI3K‐Akt signaling pathway appears in all three analyses (Figure 6a). The overlap involved genes of PI3K‐Akt signaling pathway enriched from GSE69237, Foxi3_DEGs, and Foxi3‐WGCNA are shown in Figure 6b. Overlap analysis also showed only Akt2 and Met genes were present in the PI3K‐Akt signaling pathway obtained by different analysis methods (Figure 6b). Our retrospective study found that the correlation between Met and Foxi3 presented contradictory results in both datasets, and the correlation between Akt2 and Foxi3 presented consistent results in both datasets (Figure 6c). Therefore, we selected Akt2 for gene expression verification and found the expression of Akt2 was actually significantly increased in Foxi3 −/− mice (Figure 6d).

FIGURE 6.

FIGURE 6

Open in a new tab

Overlapping signaling pathways and associated genes. (a) The three analytical methods obtained the top 10 overlapping signaling pathways. (b) Overlapping genes from the PI3K‐Akt signaling pathway obtained by different analysis methods. (c) Correlation of Foxi3 with Akt2 and Met in different datasets. (d) Expression of Akt2 in WT and Foxi3 −/− mice as measured by qPCR. *p < 0.05.

4. DISCUSSION

Goldenhar syndrome was first reported in 1952. Then, Gorlin et al. (1963) proposed the term OAVS, changing Goldenhar to OAVS (Cohen Jr. et al., 1989). HFM, also known as OAVS or Goldenhar syndrome, is a complex congenital genetic disease characterized by varying degrees of malformation of tissues and organs such as eyes, ears, and maxillofacial surfaces. This is a class of diseases with very high clinical phenotypic heterogeneity and very complex pathogenesis. The specific name of patients with such diseases is often named according to their specific clinical phenotype, but so far there is no exact classification standard to classify such diseases, so in the OMIM database, HFM is also known as OAVS or Goldenhar syndrome. Features of HFM include mandibular hypoplasia, microtia, facial and preauricular skin tags, epibulbar dermoids, and lateral oral clefts (Timberlake et al., 2021). Because of its complex clinical phenotype, HFM has high heterogeneity (Yang et al., 2020). Both genetic and environmental factors are thought to contribute to the development of craniofacial dysmorphism (Beleza‐Meireles et al., 2014; Bogusiak et al., 2017; Fischer et al., 2006). Several copy number variations and signal nucleotide variations of genes were reported to be associated with craniofacial dysmorphism (Guida, Sparascio, et al., 2021; Zamariolli et al., 2019). In addition, several animal model studies have shown craniofacial dysmorphism in Foxi3 −/− mice (Mao et al., 2023; Singh et al., 2018; Youssoufian et al., 1986). In the study, we also found craniofacial dysmorphism in Foxi3 −/− mice. These results reinforced the close relationship between FOXI3 and craniofacial development (Mao et al., 2023). At present, the generally recognized pathogenesis of HFM is the abnormal development of the first and second branchial arch derivatives during embryogenesis. FOXI3 plays an important role in embryonic development. FOXI3 is expressed on the edge of the neural plate at the end of the gastrulation, and is essential for the formation of the posterior placodes and is important for the formation of the ectodermal patterning (Thawani et al., 2023). This further explains why Foxi3 deficiency causes craniofacial dysmorphism in mice.

FOXI3 was a member of FOXI family which has been reported as a susceptibility gene to craniofacial dysmorphism (Quiat et al., 2022). However, the specific mechanism by which FOXI3 function loss leads to craniofacial dysmorphism has not been clarified until now. In our present study, comprehensive bioinformatics analysis was carried out using two different types of cells with high and low FOXI3 expression, in an attempt to find the mechanism of FOXI3 deficiency leading to craniofacial dysmorphism. Next, we constructed a knockout mice model of FOXI3 and verified the mechanism of craniofacial dysmorphism induced by FOXI3 deletion through RNAseq and comprehensive bioinformatics analyses. Through different strategies, we found that FOXI3 deficiency affects the PI3K‐Akt signaling pathway. The PI3K‐Akt signaling pathway was the most common and important node, which controls multiple biological processes such as cell growth, migration, proliferation, and metabolism (Tewari et al., 2022). Abnormalities in the PI3K‐Akt signaling pathway have been reported to be associated with almost all diseases, such as cancer (Noorolyai et al., 2019; Xue et al., 2021), cardiovascular diseases (Qin et al., 2021; Zhang et al., 2018), nervous system diseases (Gabbouj et al., 2019; Sharma & Mehan, 2021), and metabolic diseases (Huang et al., 2018). In addition, previous studies have also suggested that abnormal PI3K‐Akt signaling pathway is associated with many developmental diseases. For example, dysregulation of PI3K‐Akt signaling pathway has been regarded as a cause of several neurodevelopmental diseases (Waite & Eickholt, 2010), such as polymicrogyria (Taylor et al., 2021), autism (Zhang et al., 2016), and cortical dysplasia (Zhang et al., 2020). The abnormality of PI3K‐Akt signaling pathway was also closely related to immune system development (Xue et al., 2008) and embryo development (Riley et al., 2005). Retinoic acid plays an important role in regulating morphogenesis, cell proliferation and differentiation, and extracellular matrix generation during embryonic development (Lai et al., 2003; Ross et al., 2000; Wang & Kirsch, 2002). Hu et al. (2013) found that PI3K‐Akt signaling pathway is involved in the regulation of retinoic acid in cleft palate repair. The proliferation and differentiation of neural crest cells are closely related to the deformed craniofacial structure (Roth et al., 2021). Yang et al. (2018) found that decreased PI3K/Akt activity leads to decreased proliferation and differentiation of neural crest cells in vitro and in vivo. Zarate et al. (2019) reported a PDGFRB gene mutation in a patient with a craniofacial dysmorphism of Kosaki overgrowth syndrome, which leads to constitutive activation of the PI3K‐AKT signaling pathway. This result suggests that PI3K‐AKT signaling pathway may be involved in craniofacial development. In this study, we found that FOXI3 deficiency led to a significant increase in Akt2, a gene related to the PI3K‐AKT signaling pathway, which further suggested that the PI3K‐AKT signaling pathway might be involved in craniofacial development and that craniofacial dysmorphism caused by FOXI3 deficiency might be caused by a significant increase in Akt2 expression.

5. CONCLUSION

Craniofacial dysmorphism is a complex and highly heterogeneous disease that is influenced by both environmental and genetic factors. FOXI3 is a susceptibility gene for craniofacial dysmorphism, and the deficiency of FOXI3 leading to craniofacial dysmorphism may be realized through the Akt2 and PI3K‐Akt signaling pathway. Our present study laid a foundation for understanding the function of FOXI3 and for the pathogenesis and treatment of related malformations caused by the loss of FOXI3 function.

AUTHOR CONTRIBUTIONS

All authors have read and approved the manuscript. X.H. and B.P. conceived and designed the experiments; X.X. and Z.Z. performed the analyses; Y.W. helped to analyze the data; and X.X. wrote the paper. All authors have read and approved the manuscript.

FUNDING INFORMATION

This project is financially supported by the National Natural Science Foundation of China (No. 31970556) and the Hunan Natural Science Foundation (No. 2023JJ50442).

CONFLICT OF INTEREST STATEMENT

The authors declare no competing interests.

ETHICS STATEMENT

All procedures for the care and use of animals are in line with the institution's guidelines and approved by the Ethics Committee of Hunan University of Medicine.

ACKNOWLEDGMENTS

Not applicable.

Xing, X.‐L. , Zeng, Z. , Wang, Y. , Pan, B. , & Huang, X. (2024). Identification of potential molecular mechanism related to craniofacial dysmorphism caused by FOXI3 deficiency. Molecular Genetics & Genomic Medicine, 12, e2411. 10.1002/mgg3.2411

Xiao‐Liang Xing and Ziqiang Zeng contributed equally to this work.

Contributor Information

Bo Pan, Email: 13810855912@163.com.

Xueshuang Huang, Email: xueshuanghuang@126.com.

DATA AVAILABILITY STATEMENT

The data that support the findings will be available in [DAVID] at [https://david.ncifcrf.gov/] following an embargo from the date of publication to allow for commercialization of research findings.

REFERENCES

  1. Beleza‐Meireles, A. , Clayton‐Smith, J. , Saraiva, J. M. , & Tassabehji, M. (2014). Oculo‐auriculo‐vertebral spectrum: A review of the literature and genetic update. Journal of Medical Genetics, 51(10), 635–645. 10.1136/jmedgenet-2014-102476 [DOI] [PubMed] [Google Scholar]
  2. Berenguer, M. , Tingaud‐Sequeira, A. , Colovati, M. , Melaragno, M. I. , Bragagnolo, S. , Perez, A. B. A. , Arveiler, B. , Lacombe, D. , & Rooryck, C. (2017). A novel de novo mutation in MYT1, the unique OAVS gene identified so far. European Journal of Human Genetics, 25(9), 1083–1086. 10.1038/ejhg.2017.101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Birol, O. , Ohyama, T. , Edlund, R. K. , Drakou, K. , Georgiades, P. , & Groves, A. K. (2016). The mouse Foxi3 transcription factor is necessary for the development of posterior placodes. Developmental Biology, 409(1), 139–151. 10.1016/j.ydbio.2015.09.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bogusiak, K. , Puch, A. , & Arkuszewski, P. (2017). Goldenhar syndrome: Current perspectives. World Journal of Pediatrics, 13(5), 405–415. 10.1007/s12519-017-0048-z [DOI] [PubMed] [Google Scholar]
  5. Cohen, M. M., Jr. , Rollnick, B. R. , & Kaye, C. I. (1989). Oculoauriculovertebral spectrum: An updated critique. The Cleft Palate Journal, 26(4), 276–286. [PubMed] [Google Scholar]
  6. Edlund, R. K. , Ohyama, T. , Kantarci, H. , Riley, B. B. , & Groves, A. K. (2014). Foxi transcription factors promote pharyngeal arch development by regulating formation of FGF signaling centers. Developmental Biology, 390(1), 1–13. 10.1016/j.ydbio.2014.03.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Fischer, S. , Ludecke, H. J. , Wieczorek, D. , Bohringer, S. , Gillessen‐Kaesbach, G. , & Horsthemke, B. (2006). Histone acetylation dependent allelic expression imbalance of BAPX1 in patients with the oculo‐auriculo‐vertebral spectrum. Human Molecular Genetics, 15(4), 581–587. 10.1093/hmg/ddi474 [DOI] [PubMed] [Google Scholar]
  8. Gabbouj, S. , Ryhanen, S. , Marttinen, M. , Wittrahm, R. , Takalo, M. , Kemppainen, S. , Martiskainen, H. , Tanila, H. , Haapasalo, A. , Hiltunen, M. , & Natunen, T. (2019). Altered insulin signaling in Alzheimer's disease brain—Special emphasis on PI3K‐Akt pathway. Frontiers in Neuroscience, 13, 629. 10.3389/fnins.2019.00629 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Golson, M. L. , & Kaestner, K. H. (2016). Fox transcription factors: From development to disease. Development (Cambridge, England), 143(24), 4558–4570. 10.1242/dev.112672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gorlin, R. J. , Jue, K. L. , Jacobsen, U. , & Goldschmidt, E. (1963). Oculoauriculovertebral dysplasia. The Journal of Pediatrics, 63, 991–999. 10.1016/s0022-3476(63)80233-4 [DOI] [PubMed] [Google Scholar]
  11. Guida, V. , Calzari, L. , Fadda, M. T. , Piceci‐Sparascio, F. , Digilio, M. C. , Bernardini, L. , Brancati, F. , Mattina, T. , Melis, D. , Forzano, F. , Briuglia, S. , Mazza, T. , Bianca, S. , Valente, E. M. , Salehi, L. B. , Prontera, P. , Pagnoni, M. , Tenconi, R. , Dallapiccola, B. , … Gentilini, D. (2021). Genome‐wide DNA methylation analysis of a cohort of 41 patients affected by Oculo‐Auriculo‐vertebral Spectrum (OAVS). International Journal of Molecular Sciences, 22(3), 1190. 10.3390/ijms22031190 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Guida, V. , Sparascio, F. P. , Bernardini, L. , Pancheri, F. , Melis, D. , Cocciadiferro, D. , Pagnoni, M. , Puzzo, M. , Goldoni, M. , Barone, C. , Hozhabri, H. , Putotto, C. , Giuffrida, M. G. , Briuglia, S. , Palumbo, O. , Bianca, S. , Stanzial, F. , Benedicenti, F. , Kariminejad, A. , … De Luca, A. (2021). Copy number variation analysis implicates novel pathways in patients with oculo‐auriculo‐vertebral‐spectrum and congenital heart defects. Clinical Genetics, 100(3), 268–279. 10.1111/cge.13994 [DOI] [PubMed] [Google Scholar]
  13. Hu, X. , Gao, J. , Liao, Y. , Tang, S. , & Lu, F. (2013). Retinoic acid alters the proliferation and survival of the epithelium and mesenchyme and suppresses Wnt/beta‐catenin signaling in developing cleft palate. Cell Death & Disease, 4(10), e898. 10.1038/cddis.2013.424 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Huang, X. , Liu, G. , Guo, J. , & Su, Z. (2018). The PI3K/AKT pathway in obesity and type 2 diabetes. International Journal of Biological Sciences, 14(11), 1483–1496. 10.7150/ijbs.27173 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Klein, D. (1990). Living history—autobiography: Genetics and environment from a personal perspective. American Journal of Medical Genetics, 37(3), 325–335. 10.1002/ajmg.1320370307 [DOI] [PubMed] [Google Scholar]
  16. Lai, L. , Bohnsack, B. L. , Niederreither, K. , & Hirschi, K. K. (2003). Retinoic acid regulates endothelial cell proliferation during vasculogenesis. Development (Cambridge, England), 130(26), 6465–6474. 10.1242/dev.00887 [DOI] [PubMed] [Google Scholar]
  17. Lam, E. W. , Brosens, J. J. , Gomes, A. R. , & Koo, C. Y. (2013). Forkhead box proteins: Tuning forks for transcriptional harmony. Nature Reviews. Cancer, 13(7), 482–495. 10.1038/nrc3539 [DOI] [PubMed] [Google Scholar]
  18. Li, X. , Guo, L. , Zhang, W. , He, J. , Ai, L. , Yu, C. , Wang, H. , & Liang, W. (2022). Identification of potential molecular mechanism related to infertile endometriosis. Frontiers in Veterinary Science, 9, 845709. 10.3389/fvets.2022.845709 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lopez, E. , Berenguer, M. , Tingaud‐Sequeira, A. , Marlin, S. , Toutain, A. , Denoyelle, F. , Picard, A. , Charron, S. , Mathieu, G. , de Belvalet, H. , Arveiler, B. , Babin, P. J. , Lacombe, D. , & Rooryck, C. (2016). Mutations in MYT1, encoding the myelin transcription factor 1, are a rare cause of OAVS. Journal of Medical Genetics, 53(11), 752–760. 10.1136/jmedgenet-2016-103774 [DOI] [PubMed] [Google Scholar]
  20. Mao, K. , Borel, C. , Ansar, M. , Jolly, A. , Makrythanasis, P. , Froehlich, C. , Iwaszkiewicz, J. , Wang, B. , Xu, X. , Li, Q. , Blanc, X. , Zhu, H. , Chen, Q. , Jin, F. , Ankamreddy, H. , Singh, S. , Zhang, H. , Wang, X. , Chen, P. , … Antonarakis, S. E. (2023). FOXI3 pathogenic variants cause one form of craniofacial microsomia. Nature Communications, 14(1), 2026. 10.1038/s41467-023-37703-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Myatt, S. S. , & Lam, E. W. (2007). The emerging roles of forkhead box (fox) proteins in cancer. Nature Reviews. Cancer, 7(11), 847–859. 10.1038/nrc2223 [DOI] [PubMed] [Google Scholar]
  22. Noorolyai, S. , Shajari, N. , Baghbani, E. , Sadreddini, S. , & Baradaran, B. (2019). The relation between PI3K/AKT signalling pathway and cancer. Gene, 698, 120–128. 10.1016/j.gene.2019.02.076 [DOI] [PubMed] [Google Scholar]
  23. Ohyama, T. , & Groves, A. K. (2004). Expression of mouse Foxi class genes in early craniofacial development. Developmental Dynamics, 231(3), 640–646. 10.1002/dvdy.20160 [DOI] [PubMed] [Google Scholar]
  24. Paul, M. A. , Opyrchal, J. , Knakiewicz, M. , Jaremkow, P. , Bajtek, J. , & Chrapusta, A. (2020). Hemifacial Microsomia review: Recent advancements in understanding the disease. The Journal of Craniofacial Surgery, 31(8), 2123–2127. 10.1097/SCS.0000000000006616 [DOI] [PubMed] [Google Scholar]
  25. Qin, W. , Cao, L. , & Massey, I. Y. (2021). Role of PI3K/Akt signaling pathway in cardiac fibrosis. Molecular and Cellular Biochemistry, 476(11), 4045–4059. 10.1007/s11010-021-04219-w [DOI] [PubMed] [Google Scholar]
  26. Quiat, D. , Timberlake, A. T. , Curran, J. J. , Cunningham, M. L. , McDonough, B. , Artunduaga, M. A. , DePalma, S. R. , Duenas‐Roque, M. M. , Gorham, J. M. , Gustafson, J. A. , Hamdan, U. , Hing, A. V. , Hurtado‐Villa, P. , Nicolau, Y. , Osorno, G. , Pachajoa, H. , Porras‐Hurtado, G. L. , Quintanilla‐Dieck, L. , Serrano, L. , … Seidman, C. E. (2022). Damaging variants in FOXI3 cause microtia and craniofacial microsomia. Genetics in Medicine, 25, 143–150. 10.1016/j.gim.2022.09.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Rengasamy Venugopalan, S. , Farrow, E. , Sanchez‐Lara, P. A. , Yen, S. , Lypka, M. , Jiang, S. , & Allareddy, V. (2019). A novel nonsense substitution identified in the AMIGO2 gene in an Occulo‐Auriculo‐vertebral spectrum patient. Orthodontics & Craniofacial Research, 22(Suppl 1), 163–167. 10.1111/ocr.12259 [DOI] [PubMed] [Google Scholar]
  28. Riley, J. K. , Carayannopoulos, M. O. , Wyman, A. H. , Chi, M. , Ratajczak, C. K. , & Moley, K. H. (2005). The PI3K/Akt pathway is present and functional in the preimplantation mouse embryo. Developmental Biology, 284(2), 377–386. 10.1016/j.ydbio.2005.05.033 [DOI] [PubMed] [Google Scholar]
  29. Ross, S. A. , McCaffery, P. J. , Drager, U. C. , & De Luca, L. M. (2000). Retinoids in embryonal development. Physiological Reviews, 80(3), 1021–1054. 10.1152/physrev.2000.80.3.1021 [DOI] [PubMed] [Google Scholar]
  30. Roth, D. M. , Bayona, F. , Baddam, P. , & Graf, D. (2021). Craniofacial development: Neural crest in molecular embryology. Head and Neck Pathology, 15(1), 1–15. 10.1007/s12105-021-01301-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Sharma, A. , & Mehan, S. (2021). Targeting PI3K‐AKT/mTOR signaling in the prevention of autism. Neurochemistry International, 147, 105067. 10.1016/j.neuint.2021.105067 [DOI] [PubMed] [Google Scholar]
  32. Singh, S. , Jangid, R. K. , Crowder, A. , & Groves, A. K. (2018). Foxi3 transcription factor activity is mediated by a C‐terminal transactivation domain and regulated by the protein phosphatase 2A (PP2A) complex. Scientific Reports, 8(1), 17249. 10.1038/s41598-018-35390-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Taylor, D. L. , Wildin, R. S. , & Morley, K. W. (2021). Novel neonatal presentation of megalencephaly‐polymicrogyria‐pigmentary mosaicism syndrome (MPPM) related to MTOR mutation: Report of a case. Pediatric Dermatology, 38(2), 536–537. 10.1111/pde.14480 [DOI] [PubMed] [Google Scholar]
  34. Tewari, D. , Patni, P. , Bishayee, A. , Sah, A. N. , & Bishayee, A. (2022). Natural products targeting the PI3K‐Akt‐mTOR signaling pathway in cancer: A novel therapeutic strategy. Seminars in Cancer Biology, 80, 1–17. 10.1016/j.semcancer.2019.12.008 [DOI] [PubMed] [Google Scholar]
  35. Thawani, A. , Maunsell, H. R. , Zhang, H. , Ankamreddy, H. , & Groves, A. K. (2023). The Foxi3 transcription factor is necessary for the fate restriction of placodal lineages at the neural plate border. Development, 150(19), dev202047. 10.1242/dev.202047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Timberlake, A. T. , Griffin, C. , Heike, C. L. , Hing, A. V. , Cunningham, M. L. , Chitayat, D. , Davis, M. R. , Doust, S. J. , Drake, A. F. , Duenas‐Roque, M. M. , Goldblatt, J. , Gustafson, J. A. , Hurtado‐Villa, P. , Johns, A. , Karp, N. , Laing, N. G. , Magee, L. , University of Washington Center for Mendelian Genomics , Mullegama, S. V. , … Luquetti, D. V. (2021). Haploinsufficiency of SF3B2 causes craniofacial microsomia. Nature Communications, 12(1), 4680. 10.1038/s41467-021-24852-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Tingaud‐Sequeira, A. , Trimouille, A. , Marlin, S. , Lopez, E. , Berenguer, M. , Gherbi, S. , Arveiler, B. , Lacombe, D. , & Rooryck, C. (2020). Functional and genetic analyses of ZYG11B provide evidences for its involvement in OAVS. Molecular Genetics & Genomic Medicine, 8(10), e1375. 10.1002/mgg3.1375 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Waite, K. , & Eickholt, B. J. (2010). The neurodevelopmental implications of PI3K signaling. Current Topics in Microbiology and Immunology, 346, 245–265. 10.1007/82_2010_82 [DOI] [PubMed] [Google Scholar]
  39. Wang, W. , & Kirsch, T. (2002). Retinoic acid stimulates annexin‐mediated growth plate chondrocyte mineralization. The Journal of Cell Biology, 157(6), 1061–1069. 10.1083/jcb.200203014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Xue, C. , Li, G. , Lu, J. , & Li, L. (2021). Crosstalk between circRNAs and the PI3K/AKT signaling pathway in cancer progression. Signal Transduction and Targeted Therapy, 6(1), 400. 10.1038/s41392-021-00788-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Xue, L. , Chiang, L. , Kang, C. , & Winoto, A. (2008). The role of the PI3K‐AKT kinase pathway in T‐cell development beyond the beta checkpoint. European Journal of Immunology, 38(11), 3200–3207. 10.1002/eji.200838614 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Yang, I. H. , Chung, J. H. , Yim, S. , Cho, I. S. , Lim, S. W. , Kim, K. , Kim, S. , Choi, J. Y. , Lee, J. H. , Kim, M. J. , & Baek, S. H. (2020). Distribution and phenotypes of hemifacial microsomia and its association with other anomalies. Korean Journal of Orthodontics, 50(1), 33–41. 10.4041/kjod.2020.50.1.33 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Yang, T. , Moore, M. , & He, F. (2018). Pten regulates neural crest proliferation and differentiation during mouse craniofacial development. Developmental Dynamics, 247(2), 304–314. 10.1002/dvdy.24605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Young, A. , & Spinner, A. (2023). Hemifacial microsomia. In StatPearls. StatPearls Publishing. [PubMed] [Google Scholar]
  45. Youssoufian, H. , Kazazian, H. H., Jr. , Phillips, D. G. , Aronis, S. , Tsiftis, G. , Brown, V. A. , & Antonarakis, S. E. (1986). Recurrent mutations in haemophilia a give evidence for CpG mutation hotspots. Nature, 324(6095), 380–382. 10.1038/324380a0 [DOI] [PubMed] [Google Scholar]
  46. Zamariolli, M. , Burssed, B. , Moyses‐Oliveira, M. , Colovati, M. , Bellucco, F. , Dos Santos, L. C. , Alvarez Perez, A. B. , Bragagnolo, S. , & Melaragno, M. I. (2021). Novel MYT1 variants expose the complexity of oculo‐auriculo‐vertebral spectrum genetic mechanisms. American Journal of Medical Genetics. Part A, 185(7), 2056–2064. 10.1002/ajmg.a.62217 [DOI] [PubMed] [Google Scholar]
  47. Zamariolli, M. , Colovati, M. , Moyses‐Oliveira, M. , Nunes, N. , Caires Dos Santos, L. , Alvarez Perez, A. B. , Bragagnolo, S. , & Melaragno, M. I. (2019). Rare single‐nucleotide variants in oculo‐auriculo‐vertebral spectrum (OAVS). Molecular Genetics & Genomic Medicine, 7(10), e00959. 10.1002/mgg3.959 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zarate, Y. A. , Boccuto, L. , Srikanth, S. , Pauly, R. , Ocal, E. , Balmakund, T. , Hinkle, K. , Stefans, V. , Schaefer, G. B. , & Collins, R. T. (2019). Constitutive activation of the PI3K‐AKT pathway and cardiovascular abnormalities in an individual with Kosaki overgrowth syndrome. American Journal of Medical Genetics. Part A, 179(6), 1047–1052. 10.1002/ajmg.a.61145 [DOI] [PubMed] [Google Scholar]
  49. Zhang, J. , Zhang, J. X. , & Zhang, Q. L. (2016). PI3K/AKT/mTOR‐mediated autophagy in the development of autism spectrum disorder. Brain Research Bulletin, 125, 152–158. 10.1016/j.brainresbull.2016.06.007 [DOI] [PubMed] [Google Scholar]
  50. Zhang, W. , Ma, L. , Yang, M. , Shao, Q. , Xu, J. , Lu, Z. , Zhao, Z. , Chen, R. , Chai, Y. , & Chen, J. F. (2020). Cerebral organoid and mouse models reveal a RAB39b‐PI3K‐mTOR pathway‐dependent dysregulation of cortical development leading to macrocephaly/autism phenotypes. Genes & Development, 34(7–8), 580–597. 10.1101/gad.332494.119 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhang, Z. , Yao, L. , Yang, J. , Wang, Z. , & Du, G. (2018). PI3K/Akt and HIF‐1 signaling pathway in hypoxia‐ischemia (review). Molecular Medicine Reports, 18(4), 3547–3554. 10.3892/mmr.2018.9375 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings will be available in [DAVID] at [https://david.ncifcrf.gov/] following an embargo from the date of publication to allow for commercialization of research findings.

Articles from Molecular Genetics & Genomic Medicine are provided here courtesy of Blackwell Publishing

RESOURCES