Prevalence of polymorphisms in marker genes associated with antimalarial drug resistance in Plasmodium falciparum following 10 years of artemisinin-based combination therapy implementation in urban Kolkata

Abstract

Context:

Resistance to antimalarial drugs is one of the major challenges for malaria elimination. In India, artemisinin combination therapy (artesunate-sulfadoxin pyrimethamine) was introduced in place of chloroquine (CQ) for the treatment of uncomplicated falciparum malaria in 2010. Periodical monitoring of polymorphisms in antimalarial drug resistance marker genes will be useful for assessing drug pressure, mapping and monitoring of drug resistance status; and will be helpful for searching alternative treatments.

Objectives:

This study was conducted to study the polymorphisms in antimalarial drug resistance marker genes among clinical Plasmodium falciparum isolates collected from Kolkata after 10 years of artemisinin-based combination therapie (ACT) implementation.

Materials and Methods:

Blood samples were collected from P. falciparum mono-infected patients and polymorphisms in P. falciparum CQ resistance transporter (pfcrt), P. falciparum multidrug resistance (pfmdr-1), P. falciparum dihydrofolate reductase (pfdhfr), P. falciparum dihydropteroate synthetase (pfdhps), pfATPase6 and pfK-13 propeller genes were analysed by polymerase chain reaction and DNA sequencing.

Results:

In pfcrt gene, C72S, and K76T mutation was recorded in 100% isolates and no mutations was detected in any of the targeted codons of pfmdr-1 gene. A double mutant pfcrt haplotype SVMNT and wildtype haplotype NYD in pfmdr-1 were prevalent in 100% of study isolates. Triple mutant pfdhfr-pfdhps haplotype ANRNI-SGKAA was recorded. No polymorphism in pfK13 gene was documented in any of the isolates.

Conclusions:

Observed wild codon N86 along with Y184 and D1246 of pfmdr-1 gene might be an indication of the reappearance of CQ sensitivity. The absence of quadruple and quintuple haplotypes in pfdhfr-pfdhps gene along with the wild haplotype of pfK13 is evidence of ACT effectivity. Hence, similar studies with large sample size are highly suggested for monitoring the drug resistance status of P. falciparum.

INTRODUCTION

Malaria is one of the deadliest infectious diseases in the tropics and subtropics in terms of both morbidity and mortality. “Global Technical Strategy for Malaria 2016–2030” was formulated by the World Health Organization (WHO) with the vision of a world free from malaria by 2030.[1] To achieve the goal set by the WHO, the National Vector Borne Disease Control Programme (NVBDCP) of India introduced new interventions and undertaken several policy changes in malaria control program.[2] The emergence of new drug-resistant strains of Plasmodium falciparum against almost all available antimalarial agents makes the situation more complicated and challenging. Southeast Asia (SEA) is considered as the epicenter for the evolution and spread of resistance against all important classes of antimalarials.[3] Resistance to chloroquine (CQ) and sulfadoxine-pyrimethamine in P. falciparum emerged in the late 1950s and 1960s in the Thailand–Cambodian border and spread across Asia and then Africa, leading to millions of deaths due to malaria.[4,5]

The Artemisinin-based combination therapies (ACTs) were introduced in the mid-1990s, in SEA, where resistance to all available antimalarial drugs had developed. Then, the WHO recommended ACTs as first-line agent for the treatment of uncomplicated falciparum malaria in all malaria-endemic countries.[6] The NVBDCP of India introduced Artesunate + Sulfadoxine-Pyremethamine (AS + SP) as first-line treatment for all uncomplicated falciparum malaria in 2009.[7] Following the introduction of ACTs together with increased use of insecticide-treated bed nets and other activities, malaria-related morbidity and mortality were reduced significantly throughout the world[8] including India.[2] The situations are now threatened by the emergence of artemisinin resistance in P. falciparum. In 2009, artemisinin resistance was first reported from Western Cambodia[9] and thereafter it has spread to other Southeast Asian countries.[10,11] From India, ACT (AS + SP)-resistant P. falciparum has been reported from northeastern states of the country,[11] accordingly the drug policy has been changed from AS + SP to artemether plus lumefantrine in 2013.[12] Artemisinin resistance is characterized by slow clearance of parasite[9] which reflects the reduced susceptibility of asexual stages of parasites.[13,14] Recently, a group of workers from West Bengal reported AS + SP resistance among P. falciparum strains. However, they did not mention the actual study site or the origin of the patients. They have recruited patients during 2013–2014 but analyzed their results according to the WHO 2016 protocol.[15] Apart from this study, there does not exist any such report from the state.[16]

Antimalarial drug efficacy can be determined by four different methods such as-in vivo therapeutic efficacy studies, in vitro tests, molecular marker studies, and measurement of drug concentrations. In vivo therapeutic efficacy study is still considered the gold standard for this purpose. Studies on molecular markers are also important for determining any early sign of resistance to antimalarial agents. P. falciparum CQ resistance transporter (pfcrt) is a 3.1 kb gene with 13 exons and encoded protein belonging to drug metabolite transporter family.[17] Mutations of pfcrt encompassing codons 72–76 are the key marker for P. falciparum CQ resistance, while K76T is the hallmark for this.[17] P. falciparum multidrug resistance (pfmdr-1) gene encodes the P-glycoprotein homolog 1 and is one of the four ATP-binding cassette transporter (ABC) proteins found in P. falciparum.[18] The mutation at N86Y in this gene modulates a higher level of CQ resistance when present with mutant K76T in pfcrt gene.[19] P. falciparum dihydrofolate reductase (pfdhfr) and P. falciparum dihydropteroate synthetase (pfdhps) have been found to be linked with pyrimethamine and sulfadoxine resistance, respectively.[20,21,22] Polymorphisms at codon positions 436, 437, 540, 581, and 613 of pfdhps and at codons 16, 51, 59, 108, and 164 of pfdhfr gene have been identified as sulfadoxine and pyrimethamine resistance markers.[23] Artemisinin resistance has been linked with point mutations in the “propeller” region of a P. falciparum kelch protein (pfK13 gene).[14] Polymorphisms in pfK13 gene have been reported from different countries[14,24] but such report from India is scarce. Recently, it was reported that mutations in pfK13 gene are limited in the strains isolated from northeastern part of the country.[25] Periodical monitoring of the polymorphisms in molecular marker genes associated with antimalarial drug resistance will be useful for assessing the drug pressure, mapping and monitoring of resistance status of those drugs; and will be helpful for searching any alternative treatments. The present study was designed to detect the polymorphisms in antimalarial drug resistance marker genes in clinical P. falciparum isolates collected from Kolkata after 10 years of ACT implementation.

MATERIALS AND METHODS

Study site and design

The study was conducted at the Malaria Clinic attached to Protozoology Unit of the Department of Microbiology, Calcutta School of Tropical Medicine, Kolkata, from October 2019 to March 2020. Febrile patients attending the outpatient department with fever were examined clinically. Finger prick thick and thin blood smears were examined microscopically following Giemsa staining. Patients positive for malaria were treated with ACTs a combination of AS + SP and Plasmodium vivax with CQ plus primaquine according to age-specific regimen. Microscopically, positive P. falciparum patients were asked to participate in the study and the consented patients were enrolled. The demographic and clinical data were collected from them in a predesigned questionnaire format for further evaluation.

Collection of blood samples

Three–five milliliters ethylenediaminetetraacetic acid (EDTA) blood was collected from the enrolled patients after obtaining informed consent from them or their guardians in case of patients with ages below 14 years. Collected blood samples were used for molecular biological work.

DNA isolation

P. falciparum genomic DNA was isolated from whole blood samples collected in EDTA-coated vials using QIAamp DNA Blood Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. Extracted parasite genomic DNA of all the samples was preserved at −20°C and an aliquot was used as the DNA source for further study.

Polymerase chain reaction amplification and sequencing of different drug resistance marker genes

The primers used for polymerase chain reaction (PCR) amplification of the region of interest of different genes and the condition of PCR are given in Table 1.[14,26,27,28]

Table 1.

Primer sequence and polymerase chain reaction conditions for amplification of different drug resistance marker gene

Genes	Primer name	Primer sequence (5’–3’)	Mg + 2concentration (mM)	PCR conditions						Number of cycles
				Denaturation		Annealing		Extension
				Temperature (°C)	Time (s)	Temperature (°C)	Time (s)	Temperature (°C)	Time (s)
Pfcrt	PF_CRT_1F	GGCTCACGTTTAGGTGGA	2.5	94	60	58	30	60	60	45
	PF_CRT_1R	TGAATTTCCCTTTTTATTTCCAAA
Pfmdr-1	PF_MDR_1F	CATTTTATTTGATTTTGTGTTGAAA	3	94	40	57	60	72	60	45
	PF_MDR_1R	CGTACCAATTCCTGAACTCAC
	PF_MDR_2F	TGATATCAAGTTATTGTATGGATGTAA	3	94	40	57	60	72	60	45
	PF_MDR_2R	CCGAATGCATAAGAAACTAAAA
	PF_MDR_9F	TTGATGACTTTATGAAATCCTTATT	3	94	40	57	60	72	60	45
	PF_MDR_9R	CATGGGTTCTTGACTAACTATTGA
Pfdhfr	Pfdhfr_Pr_F	CCAACATTTTCAAGATTGATACATAA	3	94	30	60	90	72	90	40
	Pfdhfr_Pr_R	ACATCGCTAACAGAAATAATTTGA
	Pfdhfr_Ns_F	GCGACGTTTTCGATATTTATG	2.5	94	30	60	90	72	90	40
	Pfdhfr_Ns_R	GATACTCATTTTCATTTATTTCTGGA
Pfdhps	Pfdhps_Pr_F	TTGTTGAACCTAAACGTGCTG	2.5	94	30	54	30	72	90	40
	Pfdhps_Pr_R	TTGATCCTTGTCTTTCCTCATGT
	Pfdhps_Ns_F	TTTGAAATGATAAATGAAGGTGCT	2.5	94	30	60	90	72	90	40
	Pfdhps_Ns_R	TCCAATTGTGTGATTTGTCCA
K13	K13 PCR F	CGGAGTGACCAAATCTGGGA	3	94	30	60	90	72	90	40
	K13 PCR R	GGGAATCTGGTGGTAACAGC
	K13 N1 F	GCCAAGCTGCCATTCATTTG	2.5	94	30	60	90	72	90	40
	K13 N1 R	GCCTTGTTGAAAGAAGCAGA

PCR amplifications were performed on a Thermal Cycler (Perkin Elmer, Branchburg, NJ, USA). PCR amplifications were carried out in a final volume of 50 μL which include 3 μL of genomic DNA as template. The reaction mixture contained PCR buffer, 0.2 mM of dNTPs, MgCl2, 0.3 μM of each of the primer, and 1.5 U of AmpliTaq polymerase (Perkin Elmer, Branchburg, NJ, USA). The PCR conditions and primers are listed in Table 1.

The quality and concentration of PCR products were ascertained by 1.5% agarose gel electrophoresis following ethidium bromide staining. PCR product was gel purified using Qiagen gel extraction kit and sequenced using ABI sequencing platform.

Analysis of sequence

The sequences were analyzed using the software BioEdit Sequence Alignment Editor version 7.0.9.0, (Ibis Biosciences, Carlsbad, CA, USA). The sequences of pfcrt, pfmdr-1, pfdhfr, pfdhps and pfK13 genes were aligned with the reference sequence of the PlasmoDB accession no. PF3D7_0709000, PF3D7_0523000, PFD0830w, PF08_0095, and PF3D7 1343700, respectively, using the online multiple sequence alignment tool Pairwise Sequence Alignment (NUCLEOTIDE) (http://www.ebi.ac.uk/Tools/psa/emboss_needle/nucleotide.html).

Ethical approval

The Ethics Committee of the Calcutta School of Tropical Medicine, Kolkata, approved the study protocol. Informed consent of the patients or their legal guardians was obtained before the recruitment of the patients in the study.

RESULTS

Demography of study patients

A total of 6752 febrile patients were screened for malaria parasite by microscopy during the study and 138 patients were positive for P. falciparum. Out of 138 isolates, 40 were randomly selected for this study, at least six isolates each month to cover the entire study period. Among them, 35 (87.5%) were male and 5 (12.5%) were female. The mean age and body weight was 31.4 years and 46.85 kg, respectively. Thirty-seven (92.5%) of study participants were above 14 years of age and 15 (37.5%) had a history of malaria. The parasite count on day 0 was very much diversified with a range between 240 and 15,600 and the mean parasite count of study recruits was 5047.5/uL of blood. The fever was the most common clinical symptom and present in 100% (40/40) cases, followed by chill with rigor (77.5%), headache (77.5%), nausea (27.5%), and vomiting (20%) [Table 2].

Table 2.

Baseline characteristics of malaria positive patients (n=40)

Characteristics	n (%)
Sex
Male	35 (87.5)
Female	5 (12.5)
Age (years)
Mean±SD	31.4±14.25
Range	6–68
Median	30.0
95% CI	26.84–35.95
Age category (years)
≤14	3 (7.5)
>14	37 (92.5)
Body weight (kg)
Mean±SD	46.85±14.32
Range	17–70
Median	50.0
95% CI	42.27–51.43
Parasite count (day 0)
Mean±SD	5047.5±4013.8
Range	240–15,600
Median	4360.0
95% CI	3763.0–6331.4
Clinical presentation
Fever	40 (100.0)
Chill and rigor	31 (77.5)
Headache	31 (77.5)
Abdomen pain	5 (12.5)
Nausea	11 (27.5)
Vomiting	8 (20.0)
History of malaria
Present	15 (37.5)
Absent	25 (62.5)
Stages of parasite in PBS
Ring	27 (67.5)
Ring + gametocytes	13 (32.5)

SD: Standard deviation, CI: Confidence interval, PBS: Peripheral blood smear

Therapeutic outcomes

The present study was not a therapeutic efficacy study. However, all the patients were followed up both clinically and parasitologically on days 1, 2, 3, 7, 14, 21, 28, 35, and 42. It was observed that all patients became parasite free by day 3 and fever subsided within 2 days.

Polymorphisms in maker genes associated with anti-malarial drug resistance

In pfcrt gene, point mutation was recorded at codon 72 (100%, 95% confidence interval [CI]: 91.19–100) and 76 (100%, 95% CI: 91.19–100) but no mutation was observed at codon 73, 74 and 75. The wild-type haplotype CVMNK was not detected in any of the samples studied. A double mutant haplotype SVMNT was prevalent in 100% of study isolates [Table 3].

Table 3.

Polymorphism of Plasmodium falciparum chloroquine resistance transporter, Plasmodium falciparum multidrug resistance, Plasmodium falciparum dihydrofolate reductase, Plasmodium falciparum dihydropteroate synthetase and k13 genes in Plasmodium falciparum isolates from Kolkata (n=40)

Genes	Occurrence of mutation
	n (%)	95% CI
Pfcrt mutation
C72S	40 (100)	91.19–100.0
K76T	40 (100)	91.19–100.0
Haplotypes
S72V73M74N75T76	40 (100)	91.19–100.0
Pfmdr-1 mutation
N86Y	0	0–8.81
Y184F	0	0–8.81
D1246Y	0	0–8.81
Haplotypes
N86Y184D1246	40 (100)	91.19–100.0
Pfcrt-Pfmdr-1 combined haplotype
S72V73M74N75T76- N86Y184D1246	40 (100)	91.19–100.0
Pfdhfr mutations
A16V	0	0–8.81
N51I	0	0–8.81
C59R	40 (100)	91.19–100.0
S108N	40 (100)	91.19–100.0
I164L	0	0–8.81
Haplotypes
A16N51R59N108I164	40 (100)	91.19–100.0
Pfdhps mutations
S436A	0	0–8.81
A437G	40 (100)	91.19–100.0
K540E	0	0–8.81
A581G	0	0–8.81
A613S	0	0–8.81
Haplotype
S436G437K540A581A613	40 (100)	91.19–100.0
pfdhfr-pfdhps haplotype triple mutant
A16N51R59N108I164-S436G437K540A581A613	40 (100)	91.19–100.0
K13 (n=40)
M476I	0	0–8.81
Y493H	0	0–8.81
R539T	0	0–8.81
C580Y	0	0–8.81
Haplotypes
M476Y493R539C580	40 (100)	91.19–100.0

Pfcrt: Plasmodium falciparum chloroquine resistance transporter, Pfmdr: Plasmodium falciparum multidrug resistance, pfdhfr: Plasmodium falciparum dihydrofolate reductase, Pfdhps: Plasmodium falciparum dihydropteroate synthetase, CI: Confidence interval

Among the study isolates, no mutation was recorded in any of the targeted codons of pfmdr-1 gene, i.e. N86Y, Y184F, D1246Y. Hence, only the wild-type haplotypes i.e. NYD was detected among 100% of study isolates. Regarding pfcrt-pfmdr-1 combined haplotype, wildtype haplotypeCVMNK-NYD was not detected. The double mutant haplotype SVMNT-NFD was present in 100% of isolates [Table 3].

In pfdhfr gene, mutations were observed at codon 59 (C59R) and 108 (S108N) in 100% isolates (95% CI: 91.19–100) while no other mutations were observed at codon 16, 51, and 164. The wild-type haplotype of pfdhfr gene ANCSI was not detected in any of the isolates but double mutant ANRNI was observed in 40 (100%, 95% CI: 91.19–100) isolates [Table 3].

In pfdhps gene, point mutation was recorded only at codon 437 (A437G) in 40 isolates (100%, 95% CI: 91.19–100) and no mutation was observed at codon 436, 540, 581, and 613. So, only a single mutant genotype SGKAA was observed in all the study isolates (100%, 95% CI: 91.19–100). Regarding the pfdhfr-pfdhps combined haplotype, only a triple mutant haplotype ANRNI-SGKAA was recorded in 100% of isolates [Table 3].

All the studied isolates were wild-type having no polymorphism in the propeller region of pfK13 gene, i.e. none of the reported mutations (M476I, Y493H, R539T, and C580Y) were documented in the present study. Hence, wild-type haplotype, i.e. MYRC was observed in 100% isolates [Table 3].

DISCUSSION

The development of antimalarial drug resistance among malarial parasites is a dynamic process. Monitoring polymorphisms in marker genes associated with different antimalarial drug efficacy is very important to determine the effect of used drug pressure and any sign of early development of resistance against different antimalarials components. The method is easier to perform and does not need long-term follow-up of patients. In India, CQ has been replaced by ACT about 10 years ago. In the present study, polymorphisms in marker genes were assessed and compared with such previous reports. Before the introduction of ACTs, two different pfcrt haplotypes (Venezuelan haplotype SVMNT and Southeast Asian haplotype CVIET) were reported from different parts of India including West Bengal.[29] However, in the present study, only SVMNT haplotype was noticed in all isolates. A similar observation was also reported from the same study area after 5 years of ACT implementation.[30] It is interesting to note that point mutations in codon N86Y, Y184F, and D1246Y of pfmdr-1 gene associated with CQ resistance were recorded from urban Kolkata[31] and other parts of West Bengal[32] as well as from other parts of the country.[33,34] However, no such mutation was noticed in any of the isolates of the present study. It was evident that mutant N86Y of pfmdr-1 along with the K76T of pfcrt gene modulates the CQ resistance. The absence of N86Y mutation in pfmdr-1 gene might be an indication of regaining CQ sensitivity in future. A quadruple mutation in pfdhfr-phdhps gene containing a triple mutant pfdhfr along with single mutant pfdhps (AIRNI-SGKAA/AIRNI-SAEAA) or a quintuple mutant with triple pfdhfr and double pfdhps mutation (AIRNI-SGEAA/AIRNI-AKEAA) haplotypes are the hallmark for SP resistance.[35] Before ACT era both quadruple and quintuple haplotypes were reported with low frequency from West Bengal[32,36] and other parts of the country.[37,38] In the present study, no such quadruple or quintuple haplotypes were recorded in any of the isolates. The observed triple mutant haplotype-two in pfdhr and one in pfdhps (ANRNI-SGKAA) in 100% cases justifies the effectivity of SP component of used ACT. Chatterjee et al., reported 100% ACT efficacy along with no polymorphism in pfK13 gene from urban Kolkata.[16] Similar observation regarding ACT efficacy was also reported by Saha et al., from urban Kolkata.[39] In contrary, Das et al. reported G625R mutation in four isolates and R539T mutation in one isolates from West Bengal and correlated with in vivo artemisinin resistance.[15] In the present study, no mutation in pfK13 gene was recorded as it was also observed from the same area after 5 years of ACT implementation indicating the effectiveness of artesunate component of ACT even after 10 years of its implementation.[16]

CONCLUSIONS

Following 10 years of ACT implementation, some of the important point mutations in pfcrt, pfmdr-1, pfdhfr, and pfdhps that were found to be associated with antimalarial drug resistance disappeared from the prevailing P. falciparum population in the study area. Observed wild codon N86 along with Y184 and D1246 of pfmdr-1 gene in all study isolates might be an indication of reappearance of CQ sensitivity. It may be confirmed by in vivo therapeutic efficacy study. The absence of quadruple and quintuple haplotypes in pfdhfr-pfdhps gene along with wild haplotype of pf K13 is evidence of the observed effectivity of used ACT in the study area. The sample size of the present study was small. Hence, similar studies with large sample size from different parts of the country is highly suggested for monitoring the resistance status of P. falciparum against different antimalarial drugs.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.