Early Growth Response Gene-1 Deficiency Interrupts TGFβ1 Signaling Activation and Aggravates Neurodegeneration in Experimental Autoimmune Encephalomyelitis Mice

Yunyi Lan; Xinyan Han; Fei Huang; Hailian Shi; Hui Wu; Liu Yang; Zhibi Hu; Xiaojun Wu

doi:10.1007/s12264-023-01111-z

. 2023 Sep 19;40(3):283–292. doi: 10.1007/s12264-023-01111-z

Early Growth Response Gene-1 Deficiency Interrupts TGFβ1 Signaling Activation and Aggravates Neurodegeneration in Experimental Autoimmune Encephalomyelitis Mice

Yunyi Lan ^1,^#, Xinyan Han ^1,^#, Fei Huang ¹, Hailian Shi ¹, Hui Wu ¹, Liu Yang ^2,^✉, Zhibi Hu ^1,^✉, Xiaojun Wu ^1,^✉

PMCID: PMC10912064 PMID: 37725245

Abstract

Early growth response protein 1 (Egr-1) triggers the transcription of many genes involved in cell growth, differentiation, synaptic plasticity, and neurogenesis. However, its mechanism in neuronal survival and degeneration is still poorly understood. This study demonstrated that Egr-1 was down-regulated at mRNA and protein levels in the central nervous system (CNS) of experimental autoimmune encephalomyelitis (EAE) mice. Egr-1 knockout exacerbated EAE progression in mice, as shown by increased disease severity and incidence; it also aggravated neuronal apoptosis, which was associated with weakened activation of the BDNF/TGFβ 1/MAPK/Akt signaling pathways in the CNS of EAE mice. Consistently, Egr-1 siRNA promoted apoptosis but mitigated the activation of BDNF/TGFβ 1/MAPK/Akt signaling in SH-SY5Y cells. Our results revealed that Egr-1 is a crucial regulator of neuronal survival in EAE by regulating TGFβ 1-mediated signaling activation, implicating the important role of Egr-1 in the pathogenesis of multiple sclerosis as a potential novel therapy target.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12264-023-01111-z.

Keywords: Early growth response protein 1, Transforming growth factor-beta 1, Multiple sclerosis, Experimental autoimmune encephalomyelitis, Neurodegeneration

Introduction

Early growth response protein 1 (Egr-1), a transcription factor, belongs to a family of immediate-early genes, which can be induced by stimuli such as growth factors, ionizing radiation, and cytokines [1, 2]. When binding to its cognate DNA response element (Egr1 response element, ERE) through zinc finger domains [3], it triggers the transcription of a variety of downstream genes involved in cell growth, differentiation, synaptic plasticity, learning and memory, and neurogenesis [4–7]. Many previous reports have suggested that Egr-1 modulates neuronal activity in neurodegenerative diseases, such as Alzheimer's disease (AD) and Parkinson’s disease (PD) [8, 9]. However, the functional role and molecular mechanism underlying this modulation have not been elaborated in detail.

Multiple sclerosis (MS) is an autoimmune-caused neurodegenerative disease characterized by neuroinflammation and demyelination in the central nervous system (CNS) [10]. Many endogenous growth factors actively participate in the pathogenesis of MS and may attenuate its progression. For instance, brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family of growth factors, alleviates the severity of experimental autoimmune encephalomyelitis (EAE), an animal model for MS, by enhancing neuronal and axonal protection [11, 12]. When binding to its receptor tyrosine receptor kinase B (TrkB), BDNF initiates the autophosphorylation of TrkB, leading to the activation of signaling proteins such as phosphatidylinositol 3-kinase (PI3K), mitogen-activated protein kinase (MAPK), phospholipase C-γ, and guanosine triphosphate hydrolases [13, 14], and therefore modulates developmental processes, synaptogenesis, neuroprotection, memory, and cognition. Transforming growth factor-beta 1 (TGFβ 1), another growth factor involved in the cell cycle control, development, differentiation, and survival of neuronal cells, has also been revealed to reduce CNS lesions in EAE mice [15–17]. The alleviative effect of TGFβ 1 on EAE is relevant to the induction of the nitric oxide pathway in dendritic cells [18]. TGFβ 1 also exerts its neuroprotective effect by regulating Ca²⁺ homeostasis and inhibiting apoptosis, which is closely relevant to the activation of nuclear factor-kappa B through the PI3K/Akt and MAPK signaling pathways in addition to the activation of the classical Smad signaling pathway [19, 20]. Nevertheless, so far, there is no report disclosing the functional role of Egr-1 in neuronal cells in the progression of MS.

In the present study, we found that Egr-1 expression was decreased in the CNS of EAE mice while Egr-1 knockout (KO) exacerbated EAE severity. Further study implied that Egr-1 activation is essential for the survival of neurons in EAE mice, the effect of which is probably mediated by its anti-apoptotic effect through regulation of the TGFβ 1 signaling pathway. The functional role of Egr-1 was further confirmed in Egr-1-silenced neuronal SH-SY5Y cells. These findings suggest a beneficial role of Egr-1 in MS progression and may provide a novel drug target for therapy of the disease.

Materials and Methods

Induction of EAE

C57BL/6 Egr-1^+/- (heterozygous) mice were provided by the Jackson Laboratory in the Division of Basic Sciences (Bethesda, MD, USA) and were bred in-house under specific pathogen-free conditions (Experimental Animal Center of Shanghai University of Traditional Chinese Medicine, Shanghai, China). The Egr-1^-/- (homozygous) mice were obtained by hybridizing the heterozygous mice, and their wild-type littermates were used as the control group. The genotypes of mice were determined by PCR. The forward primer used for wild-type Egr-1 was 5’-AACCGGCCCAGCAAGACACC-3’; the forward primer used for mutant-type Egr-1 was 5’-CTCGTGCTTTACGGTATCGC-3’; and the common reverse primer was 5’-GGGCACAGGGGATGGGAATG-3’. Female mice, 6 weeks old, were induced with EAE according to the method described previously [21, 22]. The neurobehavioral score of EAE mice was assessed and recorded every day as described previously [23]. All animal experimental procedures were approved by the Animal Care and Ethics Committee of Shanghai University of Traditional Chinese Medicine (Shanghai, China).

Immunohistochemistry (IHC) and Luxol Fast Blue (LFB) Staining

After anesthesia with an overdose of 2% pelltobarbitalum natricum, the animals were perfused intracardially with PBS followed by 4% paraformaldehyde. The dissected brains and spinal cords were dehydrated sequentially in 15% and 30% sucrose in PBS and soaked in 4% paraformaldehyde. For IHC staining, the brains or spinal cords were embedded in OCT compound (Sakura Finetek, CA, USA), cut into 20 μm sections on a cryostat, and incubated with primary antibody against Egr-1 at 4°C overnight. After thorough washing in PBS, the sections were further incubated with Alexa 594 conjugated secondary antibodies. Fluorescent images were obtained under an inverted fluorescence microscope (Olympus IX 81). For LFB staining, the spinal cords were embedded in paraffin and cut into 3 μm sections. After de-paraffinization, the sections were sequentially dehydrated in 95% ethyl alcohol, stained by LFB, and differentiated in lithium carbonate. The staining was observed using the Olympus VS120 virtual microscopy slide scanning system.

TUNEL Assay

The apoptotic cells in the spinal cord were examined by TUNEL assay in accordance with the procedure of the TUNEL kit (Roche, Basel, Switzerland). In brief, the sections were de-paraffinized, rehydrated, and incubated with protease K (20 μg/mL) for 20 min at 37°C. They were then incubated with the TdT labelling reaction mixture for 2 h at 37°C in a humidified chamber in the dark. After incubation with 3% hydrogen peroxide for 15 min, the sections were rinsed three times with PBS and mounted on slides with a mounting medium containing DAPI for further examination. The Olympus VS120 was used for staining observation, and the number of TUNEL-positive cells in each visual field was counted using Image J.

Cell Culture

The human neuronal cell line SH-SY5Y obtained from the Cell Bank of the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) was routinely maintained in DMEM/F-12 (1:1 v/v) medium supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin at 37°C with 5% CO₂.

siRNA Cell Transfection

SH-SY5Y cells were seeded at a density of 1×10⁶ cells/mL in 6-well plates and left overnight. Egr-1 siRNA was transiently transfected into the cells using a siRNA transfection reagent (Santa Cruz Biotechnology, CA, USA). Twenty-four hours later, the medium in each well was replaced with fresh medium supplemented with 10% FBS and cultured for 24 h. The cells were then harvested and lysed for further analysis. For cell viability analysis, the cells were seeded at 2×10⁴ cells/mL in 96-well plates and cultured overnight. After transfection with Egr-1 siRNA and culture for 2 days, the cell viability was measured with the CCK-8 kit (Dojindo, Kumamoto, Japan). The optical density was monitored at 450 nm with Thermo Scientific Varioskan Flash.

Hoechst Staining

After transfection with Egr-1 siRNA for 48 h, the cells were fixed in 4% paraformaldehyde for 10 min. Subsequently, they were washed thoroughly with PBS and stained with Hoechst 33258 (10 mg/mL) for 10 min. The staining was observed under an inverted fluorescence microscope (Olympus CKX41).

Western Blot Analysis

Protein samples were prepared and quantified as described previously [21]. Afterward, the proteins were separated on 10% SDS-PAGE gel and transferred onto PVDF membranes. The membranes were blocked with 5% skim milk in PBST for 1 h and then incubated with the respective primary antibodies at 4°C overnight. Antibodies against GAPDH (1:5000, #5174), Egr-1 (1:1000, #4153), Bax (1:1000, #2772), Bcl-2 (1:1000, #2870), cleaved caspase 3 (1:1000, #9664), phospho-Erk1/2 (Thr202/Tyr204, 1:1000, #4370), Erk1/2 (1:1000, #4695), phospho-p38 MAPK (Thr180/Tyr182, 1:1000, #4511), p38 MAPK (1:1000, #9212), phospho-JNK (Thr183/Tyr185, 1:1000, #4668), JNK (1:1000, #9252), and phospho-Akt (Ser473, 1:1000, #9271) were from Cell Signaling Technology (Danvers, MA, USA). Antibodies against Akt (1:1000, #ab32505), BDNF (1:1000, #ab108319), p-TrkB (1:1000,# ab52191), TrkB (1:1000, #ab18987), phospho-CREB (S133, 1:1000, #ab32096), CREB (1:1000, #ab32515), TGFβ 1 (1:1000, #ab92486), phospho-Smad3 (S423+S425, 1:1000, #ab52903), and Smad3 (1:1000, #ab40854) were provided by Abcam (Cambridge, MA, USA). After thorough washing in PBST, the membranes were further incubated with horseradish peroxidase-conjugated secondary antibodies and visualized with the ECL-prime kit (Millipore, Billerica, USA). The relative expression levels of respective proteins were quantified using ImageJ software.

Quantitative Real-Time PCR

Total RNA was extracted using the Eastep^TM total RNA extraction kit according to the manufacturer’s instructions (Promega, Madison, WI, USA). Reverse transcription was conducted with the Revert Aid First Strand cDNA Synthesis kit (Roche, Basel, Switzerland). The synthesized cDNA was used as a template for quantitative PCR using SYBR Green PCR Master Mix (Roche, Basel, Switzerland). The mRNA expression levels were quantified using the delta-delta Ct method and were normalized to that of GAPDH within each sample. The primers used are listed in Table 1.

Table 1.

Primer sequences for quantitative PCR and Chip.

Gene name	Forward Primer	Reverse Primer
mouse GAPDH	ATGTGTCCGTCGTGGATCTGA	ATGCCTGCTTCACCACCTTCT
mouse Egr-1	TCCCAGCTCATCAAACCCA	GGCAAACTTCCTCCCACAAA
Human GAPDH	AGATGCTACTGGCCGCTGAA	TGAAGGTCGGAGTCAACGGATTTGGT
Human Egr-1	GGAGACCAGTTACCCCAGCCAAA	TGGAGATGGTGCTGAGGACGAGGAG
Human BDNF	TCATACTTTGGTTGCATGAAGGCTGC	GTCAAGCCTCTTGAACCTGCCTTG
Human CREB	CCACATTAGCCCAGGTATCTATGCCA	GAATAACTGATGGCTGGGCCGC
Human Bcl-2	GCACGCTGGGAGAACAGGGTACGAT	TCCTCCACCACCGTGGCAAA
Human TGFβ 1	TGCTGCTACCGCTGCTGTGGCTACT	AGCCGCAGCTTGGACAGGATCT
Egr-1 ChIP	AGGCTGCTTAGCCACATG	GTGGGAGGAGGGGGCAA

Open in a new tab

Statistical Analysis

Statistical analyses were carried out using GraphPad Prism 6. All data are presented as the mean ± SEM. The difference was evaluated by the unpaired t-test. A value of P <0.05 was regarded as statistically significant.

Results

Egr-1 is Down-Regulated in the CNS of EAE Mice

In normal C57BL/6 mice, the onset of EAE disease was initiated from day 7 post-immunization and attained its peak in three weeks (Fig. 1A). Meanwhile, the body weight of EAE mice dropped along with the progression of EAE (Fig. 1B). On day 21 post-immunization, Egr-1 mRNA expression in both the hippocampus and spinal cord was reduced significantly (Fig. 1C, P <0.05). Consistent with this, the protein expression level of Egr-1 in both the hippocampus and spinal cord of EAE mice was decreased significantly (Fig. 1D–E, P <0.001). In the hippocampus of EAE mice, the immunoreactivity of Egr-1 in the CA1 pyramidal cell layer was also reduced (Fig. 1F). These results demonstrated that Egr-1 was down-regulated at both the mRNA and protein levels in the CNS of EAE mice.

Egr-1 KO Exacerbates EAE Progression in Mice

To elucidate the role of Egr-1 in EAE progression, Egr-1 KO (Egr-1 null) mice were induced with EAE. As shown in Fig. 2A, the clinical score of Egr-1 null mice after EAE induction was much higher than that of their wild-type littermates. Meanwhile, the EAE incidence of Egr-1 null mice showed an increased tendency (Fig. 2B). Egr-1 expression was verified in Egr-1 null mice, and the results showed that Egr-1 had been successfully knocked out at the protein level (Fig. 2C). Accordingly, many more demyelinated lesions were found in the posterior funiculus of the spinal cord in Egr-1 null mice induced with EAE (Fig. 2D). In the spinal cord, many more TUNEL-positive cells were found in Egr-1 null EAE mice (Fig. 2E, P < 0.05). In the hippocampus, the Bcl-2/Bax ratio was decreased significantly (Fig. 2F, P <0.05) while the expression of cleaved caspase 3 was increased remarkably (P < 0.05) in Egr-1 null EAE mice. All of these results implied that Egr-1 might exert a neuroprotective function and is essential for neuronal survival in the CNS of EAE mice.

Egr-1 KO Disturbs the BDNF/TGFβ 1/MAPK/Akt Signaling Pathways in EAE Mice

To identify the underlying molecular mechanism, several signaling pathways involved in neuronal growth, survival, or recovery from injury were investigated in the hippocampus of Egr-1 null EAE mice. The expression of BDNF as well as its receptor, TrkB, were reduced significantly (Fig. 3A, P < 0.01 or P < 0.05) in Egr-1 null EAE mice simultaneously accompanied by decreased phosphorylation of CREB (P <0.05), compared to that in the wild-type EAE mice. Meanwhile, the expression of TGFβ 1 and the phosphorylation of Smad3 were weakened (P <0.01). The phosphorylation of MAPK signaling molecules, such as Erk, p38, and JNK, as well as Akt, were also found to be reduced in Egr-1 null mice (Fig. 3B, P <0.05 or P <0.01). These results suggested that Egr-1 null disturbs the signaling transduction for neuronal survival in EAE mice.

Fig. 3 — Egr-1 KO disturbs the BDNF/TGFβ 1/MAPK/Akt signaling pathways in the hippocampus of EAE mice. A The expression of BDNF and TrkB is significantly reduced in *Egr-1* null EAE mice and accompanied by decreased phosphorylation of CREB, compared to wild-type EAE mice. The expression of TGFβ 1 and the phosphorylation of Smad3 are also weakened (*n =* 3–4 per group). B The phosphorylation of Erk, p38, JNK, and Akt is reduced in *Egr-1* null EAE mice (*n =* 3-4 per group). Data are expressed as the mean ± SEM, **P <*0.05; ***P <*0.01.

Egr-1 Knock-Down Promotes Apoptosis of SH-SY5Y Cells

In order to probe the role of Egr-1 deletion in neuronal cells, SH-SY5Y cells were transfected with Egr-1 siRNA. As shown in Fig. 4A, the protein expression of Egr-1 was knocked down significantly by siRNA. However, the viability of SH-SY5Y cells decreased prominently (Fig. 4B, P < 0.001) when Egr-1 was knocked down. Hoechst 33258 staining displayed that Egr-1 knock-down induced many more apoptotic cells showing chromatin condensation and nuclear fragmentation (Fig. 4C). Furthermore, the Bcl-2/Bax ratio was decreased while the expression of cleaved caspase 3 was elevated in Egr-1-silenced cells (Fig. 4D, E, P < 0.05). To determine whether Egr-1 was changed in the in vitro model of EAE, SH-SY5Y cells were induced with 0.25 μmol/L H₂O₂ for 24 h, and cell viability was assessed by CCK-8 assay. The results showed that the viability of SH-SY5Y cells was significantly reduced after H₂O₂ induction (Fig. S2A). The expression of Egr-1 was decreased after the induction of H₂O₂. The Bcl-2/Bax ratio was decreased while the expression of cleaved caspase 3 was increased (Fig. S2B, C). These results revealed that Egr-1 deficiency promotes the apoptosis of neuronal cells.

Egr-1 Knock-Down Mitigates BDNF/TGFβ 1/MAPK/Akt Signaling in SH-SY5Y Cells

In SH-SY5Y cells, when Egr-1 was knocked down, the protein expression of BDNF, TrkB, p-CREB, and TGFβ 1 was reduced significantly (Fig. 5A, P < 0.05). The phosphorylation of Smad3 was decreased markedly after RNA interference (P <0.001). The activation of MAPK molecules, including Erk, p38, and JNK, as well as Akt, were all weakened significantly (Fig. 5B, P < 0.05, P < 0.01). This trend was also found in H₂O₂-induced SH-SY5Y cells (Fig. S2C). These results suggested that Egr-1 deficiency disturbs the activation of the BDNF/TGFβ 1/MAPK/Akt pathways in neuronal cells.

Discussion

As a zinc finger transcription factor protein, Egr-1 participates in a variety of biological processes, such as neuronal cell proliferation, death, and inflammation [24, 25]. So far, few reports have elucidated its functional role in neurodegenerative diseases although abnormally regulated Egr-1 expression has been found in many neurodegenerative processes. For instance, in MPTP-induced PD model mice, increased Egr-1 expression was found in the striatum [9]. Similarly, in mice with trimethyltin-induced hippocampal neurodegeneration, Egr-1 expression is extensively increased in the CA1, CA3, and DG regions [26]. On the contrary, in aging rats, Egr-1 density is decreased in the CA1 subfield [27]. Therefore, Egr-1 seems to play different roles in neurons in various neurodegenerative diseases.

Several other studies have partly implicated the function of Egr-1 in certain neurodegenerative diseases. In AD transgenic mice, after treatment with glatiramer acetate for one week, a significant increase of hippocampal Egr-1 was found, which was negatively correlated with the amyloid-β plaque burden [28]. In rats induced with dizocilpine (MK801), remarkable neurodegeneration has been reported in the retrosplenial cortex, and this was accompanied by suppressed Egr-1 expression [29]. In agreement with the reports, in the present study, Egr-1 was also found to be decreased at both the mRNA and protein levels in the CNS of normal C57BL/6 mice with induced EAE. Therefore, Egr-1 up-regulation seems to benefit neurodegenerative diseases such as AD and MS; however, this still has not been corroborated by direct evidence. For the first time, our study provided direct evidence for the beneficial role of Egr-1 in EAE mice, a well-known animal model for MS study. Our results showed that Egr-1 KO exacerbated EAE progression and increased neuronal degeneration, suggesting that Egr-1 expression facilitates the recovery from EAE in mice.

Many studies have disclosed that activation of both the BDNF and TGFβ 1 signaling pathways protects neurons from further injury in EAE rodents [30–33]. Egr-1 is well known to induce TGFβ 1 expression by direct promoter binding [34, 35]. Our data also corroborated that Egr-1 can directly bind to the promoter of TGFβ 1 in SH-SY5Y cells (Fig. S1). When Egr-1 was silenced, the expression of TGFβ 1 was decreased at both the mRNA and protein levels. In terms of BDNF, Egr-1 has been shown to bind to its promoter while negatively modulating its expression [36]. However, our studies conducted both in vivo and in vitro demonstrated that BDNF expression is weakened when Egr-1 is lacking. As the TGFβ 1 pathway has been shown to modulate BDNF expression, the contradictory outcomes between our study and other reports reflect the fine-tuning of the growth factors in neuronal cells in the pathogenesis of different diseases.

TGFβ 1 regulates a wide range of cellular activities via Smad and non-Smad signaling pathways [37, 38]. The non-Smad pathways include the MAPKs and PI3K/Akt pathways, both of which are vital for the survival of neurons [39]. Akt actively participates in the regulation of cell survival, growth, proliferation, transcription, metabolism, and migration [40]. The transcription factor CREB is one of the downstream substrates of Akt, which is critical for synaptic plasticity and neuronal development, as well as learning and memory. Phosphorylation of CREB by Akt on Ser133 results in its transcriptional activation, which can up-regulate the expression of anti-apoptotic genes such as Bcl-2 [41], thus preventing the release of cytochrome C to the cytosol and the subsequent activation of caspases. In addition, intracellular Ca²⁺ depletion and influx are essential for apoptosis, and members of the Bcl-2 protein family play an important role in regulating intracellular Ca²⁺ transport. Bcl-2 has been reported to target and inhibit inositol 1,4,5-trisphosphate receptors, thereby suppressing proapoptotic Ca²⁺ signaling [42, 43]. In addition to Bcl-2, CREB activation also triggers the expression of BDNF and TrkB in neurons [44]. It is well-known that BDNF supports the survival, growth, and differentiation of neurons and is an important modulator of synaptogenesis and synaptic plasticity [45]. In agreement with the reports, in our experiments, Egr-1 deficiency resulted in decreased TGFβ 1 and inhibited both Smad and non-Smad signaling pathways in neuronal cells in vitro and in vivo, suggesting a critical role of Egr-1 in neurons mediated through TGFβ 1 signaling pathways (Fig. 6).

Fig. 6 — Schematic illustration of the molecular mechanism of action of Egr-1 on neuronal survival in EAE by regulating TGFβ 1 and three of its downstream signaling pathways: TGFβ 1/Smad3, TGFβ 1/Erk/p38/JNK, and TGFβ 1/PI3K/Akt/CREB. The three signaling pathways are triggered by stimulation with TGFβ 1 and BDNF through their surface receptors. Egr-1 knock-down causes a decrease in ERE-dependent transactivation and the expression of survival factors and TGFβ 1. This effect of Egr-1 on TGFβ 1 causes inhibition of the Smad and non-Smad signaling pathways, resulting in a decrease of CRE-dependent transactivation and the expression of survival factors, TrkB, BDNF, and Bcl-2. Overall, Egr-1 deficiency weakens neuron survival and strengthens neuron apoptosis.

Conclusions

In summary, our results demonstrate that Egr-1 is a crucial regulator for neuronal survival in EAE by regulating TGFβ 1 and its downstream signaling pathways. The findings suggest a potential novel molecular target for MS therapy.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary file1 (PDF 380 kb)^{(380.7KB, pdf)}

Acknowledgements

This work was supported by the National Natural Science Foundation of China (82074043, 82104425, 82374065, and 81673626) and the China Postdoctoral Science Foundation (2021M702217).

Data Availability

The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Conflict of interest

All authors claim that there are no conflicts of interest.

Footnotes

Yunyi Lan and Xinyan Han contributed equally to this work.

Contributor Information

Liu Yang, Email: yangliu996633@126.com.

Zhibi Hu, Email: huzhibi@hotmail.com.

Xiaojun Wu, Email: xiaojunwu320@126.com.

References

1.Shin SY, Kim HW, Jang HH, Hwang YJ, Choe JS, Kim JB, et al. γ-Oryzanol suppresses COX-2 expression by inhibiting reactive oxygen species-mediated Erk1/2 and Egr-1 signaling in LPS-stimulated RAW264.7 macrophages. Biochem Biophys Res Commun. 2017;491:486–492. doi: 10.1016/j.bbrc.2017.07.016. [DOI] [PubMed] [Google Scholar]
2.Li L, Ameri AH, Wang S, Jansson KH, Casey OM, Yang Q, et al. EGR1 regulates angiogenic and osteoclastogenic factors in prostate cancer and promotes metastasis. Oncogene. 2019;38:6241–6255. doi: 10.1038/s41388-019-0873-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Veyrac A, Besnard A, Caboche J, Davis S, Laroche S. The transcription factor Zif268/Egr1, brain plasticity, and memory. Prog Mol Biol Transl Sci. 2014;122:89–129. doi: 10.1016/B978-0-12-420170-5.00004-0. [DOI] [PubMed] [Google Scholar]
4.Cheval H, Chagneau C, Levasseur G, Veyrac A, Faucon-Biguet N, Laroche S, et al. Distinctive features of Egr transcription factor regulation and DNA binding activity in CA1 of the hippocampus in synaptic plasticity and consolidation and reconsolidation of fear memory. Hippocampus. 2012;22:631–642. doi: 10.1002/hipo.20926. [DOI] [PubMed] [Google Scholar]
5.Su B, Wang XT, Sun YH, Long MY, Zheng J, Wu WH, et al. Ischemia/hypoxia inhibits cardiomyocyte autophagy and promotes apoptosis via the Egr-1/Bim/Beclin-1 pathway. J Geriatr Cardiol. 2020;17:284–293. doi: 10.11909/j.issn.1671-5411.2020.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Shi W, Ling D, Zhang F, Fu X, Lai D, Zhang Y. Curcumin promotes osteogenic differentiation of human periodontal ligament stem cells by inducting EGR1 expression. Arch Oral Biol. 2021;121:104958. doi: 10.1016/j.archoralbio.2020.104958. [DOI] [PubMed] [Google Scholar]
7.Hollands C, Tobin MK, Hsu M, Musaraca K, Yu TS, Mishra R, et al. Depletion of adult neurogenesis exacerbates cognitive deficits in Alzheimer’s disease by compromising hippocampal inhibition. Mol Neurodegener. 2017;12:64. doi: 10.1186/s13024-017-0207-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Bartolotti N, Lazarov O. CREB signals as PBMC-based biomarkers of cognitive dysfunction: A novel perspective of the brain-immune axis. Brain Behav Immun. 2019;78:9–20. doi: 10.1016/j.bbi.2019.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Yu Q, Huang Q, Du X, Xu S, Li M, Ma S. Early activation of Egr-1 promotes neuroinflammation and dopaminergic neurodegeneration in an experimental model of Parkinson’s disease. Exp Neurol. 2018;302:145–154. doi: 10.1016/j.expneurol.2018.01.009. [DOI] [PubMed] [Google Scholar]
10.Shi J, Xiao Y, Zhang N, Jiao M, Tang X, Dai C, et al. HMGB1 from astrocytes promotes EAE by influencing the immune cell infiltration-associated functions of BMECs in mice. Neurosci Bull. 2022;38:1303–1314. doi: 10.1007/s12264-022-00890-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Linker RA, Lee DH, Demir S, Wiese S, Kruse N, Siglienti I, et al. Functional role of brain-derived neurotrophic factor in neuroprotective autoimmunity: Therapeutic implications in a model of multiple sclerosis. Brain. 2010;133:2248–2263. doi: 10.1093/brain/awq179. [DOI] [PubMed] [Google Scholar]
12.Yuan M, Wang Y, Wang S, Huang Z, Jin F, Zou Q, et al. Bioenergetic impairment in the neuro-Glia-vascular unit: An emerging physiopathology during aging. Aging Dis. 2021;12:2080–2095. doi: 10.14336/AD.2021.04017. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Kowiański P, Lietzau G, Czuba E, Waśkow M, Steliga A, Moryś J. BDNF: A key factor with multipotent impact on brain signaling and synaptic plasticity. Cell Mol Neurobiol. 2018;38:579–593. doi: 10.1007/s10571-017-0510-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Li Y, Chung M, Aimaier R, Wei C, Wang W, Ge L, et al. Knockdown of NCOR2 inhibits cell proliferation via BDNF/TrkB/ERK in NF1-derived MPNSTs. Cancers (Basel) 2022;14:5798. doi: 10.3390/cancers14235798. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Li Y, Hu F, Xue M, Jia YJ, Zheng ZJ, Wang L, et al. Klotho down-regulates Egr-1 by inhibiting TGF-β1/Smad3 signaling in high glucose treated human mesangial cells. Biochem Biophys Res Commun. 2017;487:216–222. doi: 10.1016/j.bbrc.2017.04.036. [DOI] [PubMed] [Google Scholar]
16.Wang Y, He G, Tang H, Shi Y, Kang X, Lyu J, et al. Aspirin inhibits inflammation and scar formation in the injury tendon healing through regulating JNK/STAT-3 signalling pathway. Cell Prolif. 2019;52:e12650. doi: 10.1111/cpr.12650. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Wu Q, Miao X, Zhang J, Xiang L, Li X, Bao X, et al. Astrocytic YAP protects the optic nerve and retina in an experimental autoimmune encephalomyelitis model through TGF-β signaling. Theranostics. 2021;11:8480–8499. doi: 10.7150/thno.60031. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Zhou L, Yao L, Zhang Q, Xie W, Wang X, Zhang H, et al. REGγ controls Th17 cell differentiation and autoimmune inflammation by regulating dendritic cells. Cell Mol Immunol. 2020;17:1136–1147. doi: 10.1038/s41423-019-0287-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Zhu Y, Culmsee C, Klumpp S, Krieglstein J. Neuroprotection by transforming growth factor-beta1 involves activation of nuclear factor-kappaB through phosphatidylinositol-3-OH kinase/Akt and mitogen-activated protein kinase-extracellular-signal regulated kinase1, 2 signaling pathways. Neuroscience. 2004;123:897–906. doi: 10.1016/j.neuroscience.2003.10.037. [DOI] [PubMed] [Google Scholar]
20.Song Y, Wang Z, Jiang J, Piao Y, Li L, Xu C, et al. DEK-targeting aptamer DTA-64 attenuates bronchial EMT-mediated airway remodelling by suppressing TGF-β1/Smad, MAPK and PI3K signalling pathway in asthma. J Cell Mol Med. 2020;24:13739–13750. doi: 10.1111/jcmm.15942. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Yang L, Xing F, Han X, Li Q, Wu H, Shi H, et al. Astragaloside IV regulates differentiation and induces apoptosis of activated CD4+ T cells in the pathogenesis of experimental autoimmune encephalomyelitis. Toxicol Appl Pharmacol. 2019;362:105–115. doi: 10.1016/j.taap.2018.10.024. [DOI] [PubMed] [Google Scholar]
22.Yang L, Han X, Xing F, Wu H, Shi H, Huang F, et al. Total flavonoids of astragalus attenuates experimental autoimmune encephalomyelitis by suppressing the activation and inflammatory responses of microglia via JNK/AKT/NFκB signaling pathway. Phytomedicine. 2021;80:153385. doi: 10.1016/j.phymed.2020.153385. [DOI] [PubMed] [Google Scholar]
23.Yang L, Han X, Yuan J, Xing F, Hu Z, Huang F, et al. Early astragaloside IV administration attenuates experimental autoimmune encephalomyelitis in mice by suppressing the maturation and function of dendritic cells. Life Sci. 2020;249:117448. doi: 10.1016/j.lfs.2020.117448. [DOI] [PubMed] [Google Scholar]
24.Thiel G, Rössler OG. Resveratrol regulates gene transcription via activation of stimulus-responsive transcription factors. Pharmacol Res. 2017;117:166–176. doi: 10.1016/j.phrs.2016.12.029. [DOI] [PubMed] [Google Scholar]
25.Yeo H, Ahn SS, Lee JY, Jung E, Jeong M, Kang GS, et al. Disrupting the DNA binding of EGR-1 with a small-molecule inhibitor ameliorates 2, 4-dinitrochlorobenzene-induced skin inflammation. J Invest Dermatol. 2021;141:1851–1855. doi: 10.1016/j.jid.2020.12.029. [DOI] [PubMed] [Google Scholar]
26.Lee S, Kang S, Kim J, Yoon S, Kim SH, Moon C. Enhanced expression of immediate-early genes in mouse hippocampus after trimethyltin treatment. Acta Histochem. 2016;118:679–684. doi: 10.1016/j.acthis.2016.09.001. [DOI] [PubMed] [Google Scholar]
27.Jablonski SA, Robinson-Drummer PA, Schreiber WB, Asok A, Rosen JB, Stanton ME. Impairment of the context preexposure facilitation effect in juvenile rats by neonatal alcohol exposure is associated with decreased Egr-1 mRNA expression in the prefrontal cortex. Behav Neurosci. 2018;132:497–511. doi: 10.1037/bne0000272. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Bakalash S, Pham M, Koronyo Y, Salumbides BC, Kramerov A, Seidenberg H, et al. Egr1 expression is induced following glatiramer acetate immunotherapy in rodent models of glaucoma and Alzheimer’s disease. Invest Ophthalmol Vis Sci. 2011;52:9033–9046. doi: 10.1167/iovs.11-7498. [DOI] [PubMed] [Google Scholar]
29.de Olmos S, Bender C, de Olmos JS, Lorenzo A. Neurodegeneration and prolonged immediate early gene expression throughout cortical areas of the rat brain following acute administration of dizocilpine. Neuroscience. 2009;164:1347–1359. doi: 10.1016/j.neuroscience.2009.09.022. [DOI] [PubMed] [Google Scholar]
30.Stevanovic I, Mancic B, Ilic T, Milosavljevic P, Lavrnja I, Stojanovic I, et al. Theta burst stimulation influence the expression of BDNF in the spinal cord on the experimental autoimmune encephalomyelitis. Folia Neuropathol. 2019;57:129–145. doi: 10.5114/fn.2019.86294. [DOI] [PubMed] [Google Scholar]
31.KhorshidAhmad T, Acosta C, Cortes C, Lakowski TM, Gangadaran S, Namaka M. Transcriptional regulation of brain-derived neurotrophic factor (BDNF) by methyl CpG binding protein 2 (MeCP2): A novel mechanism for re-myelination and/or myelin repair involved in the treatment of multiple sclerosis (MS) Mol Neurobiol. 2016;53:1092–1107. doi: 10.1007/s12035-014-9074-1. [DOI] [PubMed] [Google Scholar]
32.Alrashdi B, Dawod B, Tacke S, Kuerten S, Côté PD, Marshall JS. Mice heterozygous for the sodium channel Scn8a (Nav1.6) have reduced inflammatory responses during EAE and following LPS challenge. Front Immunol. 2021;12:533423. doi: 10.3389/fimmu.2021.533423. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Grubić Kezele T, Blagojević Zagorac G, Jakovac H, Domitrović R, Radošević-Stašić B. Hippocampal expressions of metallothionein I/II and glycoprotein 96 in EAE-prone and EAE-resistant strains of rats. Histol Histopathol. 2017;32:137–151. doi: 10.14670/HH-11-780. [DOI] [PubMed] [Google Scholar]
34.Baron V, Adamson ED, Calogero A, Ragona G, Mercola D. The transcription factor Egr1 is a direct regulator of multiple tumor suppressors including TGFbeta1, PTEN, p53, and fibronectin. Cancer Gene Ther. 2006;13:115–124. doi: 10.1038/sj.cgt.7700896. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Jian-gang Bi. MicroRNA-181a-5p suppresses cell proliferation by targeting Egr1 and inhibiting Egr1/TGF-β/Smad pathway in hepatocellular carcinoma. Int J Biochem Cell Biol. 2019;106:107–116. doi: 10.1016/j.biocel.2018.11.011. [DOI] [PubMed] [Google Scholar]
36.Yang L, Jiang Y, Wen Z, Xu X, Xu X, Zhu J, et al. Over-expressed EGR1 may exaggerate ischemic injury after experimental stroke by decreasing BDNF expression. Neuroscience. 2015;290:509–517. doi: 10.1016/j.neuroscience.2015.01.020. [DOI] [PubMed] [Google Scholar]
37.Zhang YE. Non-smad signaling pathways of the TGF-β family. Cold Spring Harb Perspect Biol. 2017;9:a022129. doi: 10.1101/cshperspect.a022129. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Tzavlaki K, Moustakas A. TGF-β signaling. Biomolecules. 2020;10:487. doi: 10.3390/biom10030487. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Stipursky J, Francis D, Gomes FC. Activation of MAPK/PI3K/SMAD pathways by TGF-β(1) controls differentiation of radial glia into astrocytes in vitro. Dev Neurosci. 2012;34:68–81. doi: 10.1159/000338108. [DOI] [PubMed] [Google Scholar]
40.Asati V, Mahapatra DK, Bharti SK. PI3K/Akt/mTOR and Ras/Raf/MEK/ERK signaling pathways inhibitors as anticancer agents: Structural and pharmacological perspectives. Eur J Med Chem. 2016;109:314–341. doi: 10.1016/j.ejmech.2016.01.012. [DOI] [PubMed] [Google Scholar]
41.Unoki T, Abiko Y, Toyama T, Uehara T, Tsuboi K, Nishida M, et al. Methylmercury, an environmental electrophile capable of activation and disruption of the Akt/CREB/Bcl-2 signal transduction pathway in SH-SY5Y cells. Sci Rep. 2016;6:28944. doi: 10.1038/srep28944. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Pinton P, Rizzuto R. Bcl-2 and Ca2+ homeostasis in the endoplasmic reticulum. Cell Death Differ. 2006;13:1409–1418. doi: 10.1038/sj.cdd.4401960. [DOI] [PubMed] [Google Scholar]
43.Rosa N, Speelman-Rooms F, Parys JB, Bultynck G. Modulation of Ca2+ signaling by antiapoptotic Bcl-2 versus Bcl-xL: From molecular mechanisms to relevance for cancer cell survival. Biochim Biophys Acta Rev Cancer. 2022;1877:188791. doi: 10.1016/j.bbcan.2022.188791. [DOI] [PubMed] [Google Scholar]
44.Du Q, Zhu X, Si J. Angelica polysaccharide ameliorates memory impairment in Alzheimer’s disease rat through activating BDNF/TrkB/CREB pathway. Exp Biol Med (Maywood) 2020;245:1–10. doi: 10.1177/1535370219894558. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Zuo D, Sun F, Cui J, Liu Y, Liu Z, Zhou X, et al. Alcohol amplifies ketamine-induced apoptosis in primary cultured cortical neurons and PC12 cells through down-regulating CREB-related signaling pathways. Sci Rep. 2017;7:10523. doi: 10.1038/s41598-017-10868-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (PDF 380 kb)^{(380.7KB, pdf)}

Data Availability Statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.

[CR1] 1.Shin SY, Kim HW, Jang HH, Hwang YJ, Choe JS, Kim JB, et al. γ-Oryzanol suppresses COX-2 expression by inhibiting reactive oxygen species-mediated Erk1/2 and Egr-1 signaling in LPS-stimulated RAW264.7 macrophages. Biochem Biophys Res Commun. 2017;491:486–492. doi: 10.1016/j.bbrc.2017.07.016. [DOI] [PubMed] [Google Scholar]

[CR2] 2.Li L, Ameri AH, Wang S, Jansson KH, Casey OM, Yang Q, et al. EGR1 regulates angiogenic and osteoclastogenic factors in prostate cancer and promotes metastasis. Oncogene. 2019;38:6241–6255. doi: 10.1038/s41388-019-0873-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR3] 3.Veyrac A, Besnard A, Caboche J, Davis S, Laroche S. The transcription factor Zif268/Egr1, brain plasticity, and memory. Prog Mol Biol Transl Sci. 2014;122:89–129. doi: 10.1016/B978-0-12-420170-5.00004-0. [DOI] [PubMed] [Google Scholar]

[CR4] 4.Cheval H, Chagneau C, Levasseur G, Veyrac A, Faucon-Biguet N, Laroche S, et al. Distinctive features of Egr transcription factor regulation and DNA binding activity in CA1 of the hippocampus in synaptic plasticity and consolidation and reconsolidation of fear memory. Hippocampus. 2012;22:631–642. doi: 10.1002/hipo.20926. [DOI] [PubMed] [Google Scholar]

[CR5] 5.Su B, Wang XT, Sun YH, Long MY, Zheng J, Wu WH, et al. Ischemia/hypoxia inhibits cardiomyocyte autophagy and promotes apoptosis via the Egr-1/Bim/Beclin-1 pathway. J Geriatr Cardiol. 2020;17:284–293. doi: 10.11909/j.issn.1671-5411.2020.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR6] 6.Shi W, Ling D, Zhang F, Fu X, Lai D, Zhang Y. Curcumin promotes osteogenic differentiation of human periodontal ligament stem cells by inducting EGR1 expression. Arch Oral Biol. 2021;121:104958. doi: 10.1016/j.archoralbio.2020.104958. [DOI] [PubMed] [Google Scholar]

[CR7] 7.Hollands C, Tobin MK, Hsu M, Musaraca K, Yu TS, Mishra R, et al. Depletion of adult neurogenesis exacerbates cognitive deficits in Alzheimer’s disease by compromising hippocampal inhibition. Mol Neurodegener. 2017;12:64. doi: 10.1186/s13024-017-0207-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR8] 8.Bartolotti N, Lazarov O. CREB signals as PBMC-based biomarkers of cognitive dysfunction: A novel perspective of the brain-immune axis. Brain Behav Immun. 2019;78:9–20. doi: 10.1016/j.bbi.2019.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR9] 9.Yu Q, Huang Q, Du X, Xu S, Li M, Ma S. Early activation of Egr-1 promotes neuroinflammation and dopaminergic neurodegeneration in an experimental model of Parkinson’s disease. Exp Neurol. 2018;302:145–154. doi: 10.1016/j.expneurol.2018.01.009. [DOI] [PubMed] [Google Scholar]

[CR10] 10.Shi J, Xiao Y, Zhang N, Jiao M, Tang X, Dai C, et al. HMGB1 from astrocytes promotes EAE by influencing the immune cell infiltration-associated functions of BMECs in mice. Neurosci Bull. 2022;38:1303–1314. doi: 10.1007/s12264-022-00890-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR11] 11.Linker RA, Lee DH, Demir S, Wiese S, Kruse N, Siglienti I, et al. Functional role of brain-derived neurotrophic factor in neuroprotective autoimmunity: Therapeutic implications in a model of multiple sclerosis. Brain. 2010;133:2248–2263. doi: 10.1093/brain/awq179. [DOI] [PubMed] [Google Scholar]

[CR12] 12.Yuan M, Wang Y, Wang S, Huang Z, Jin F, Zou Q, et al. Bioenergetic impairment in the neuro-Glia-vascular unit: An emerging physiopathology during aging. Aging Dis. 2021;12:2080–2095. doi: 10.14336/AD.2021.04017. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR13] 13.Kowiański P, Lietzau G, Czuba E, Waśkow M, Steliga A, Moryś J. BDNF: A key factor with multipotent impact on brain signaling and synaptic plasticity. Cell Mol Neurobiol. 2018;38:579–593. doi: 10.1007/s10571-017-0510-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR14] 14.Li Y, Chung M, Aimaier R, Wei C, Wang W, Ge L, et al. Knockdown of NCOR2 inhibits cell proliferation via BDNF/TrkB/ERK in NF1-derived MPNSTs. Cancers (Basel) 2022;14:5798. doi: 10.3390/cancers14235798. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR15] 15.Li Y, Hu F, Xue M, Jia YJ, Zheng ZJ, Wang L, et al. Klotho down-regulates Egr-1 by inhibiting TGF-β1/Smad3 signaling in high glucose treated human mesangial cells. Biochem Biophys Res Commun. 2017;487:216–222. doi: 10.1016/j.bbrc.2017.04.036. [DOI] [PubMed] [Google Scholar]

[CR16] 16.Wang Y, He G, Tang H, Shi Y, Kang X, Lyu J, et al. Aspirin inhibits inflammation and scar formation in the injury tendon healing through regulating JNK/STAT-3 signalling pathway. Cell Prolif. 2019;52:e12650. doi: 10.1111/cpr.12650. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR17] 17.Wu Q, Miao X, Zhang J, Xiang L, Li X, Bao X, et al. Astrocytic YAP protects the optic nerve and retina in an experimental autoimmune encephalomyelitis model through TGF-β signaling. Theranostics. 2021;11:8480–8499. doi: 10.7150/thno.60031. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR18] 18.Zhou L, Yao L, Zhang Q, Xie W, Wang X, Zhang H, et al. REGγ controls Th17 cell differentiation and autoimmune inflammation by regulating dendritic cells. Cell Mol Immunol. 2020;17:1136–1147. doi: 10.1038/s41423-019-0287-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR19] 19.Zhu Y, Culmsee C, Klumpp S, Krieglstein J. Neuroprotection by transforming growth factor-beta1 involves activation of nuclear factor-kappaB through phosphatidylinositol-3-OH kinase/Akt and mitogen-activated protein kinase-extracellular-signal regulated kinase1, 2 signaling pathways. Neuroscience. 2004;123:897–906. doi: 10.1016/j.neuroscience.2003.10.037. [DOI] [PubMed] [Google Scholar]

[CR20] 20.Song Y, Wang Z, Jiang J, Piao Y, Li L, Xu C, et al. DEK-targeting aptamer DTA-64 attenuates bronchial EMT-mediated airway remodelling by suppressing TGF-β1/Smad, MAPK and PI3K signalling pathway in asthma. J Cell Mol Med. 2020;24:13739–13750. doi: 10.1111/jcmm.15942. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR21] 21.Yang L, Xing F, Han X, Li Q, Wu H, Shi H, et al. Astragaloside IV regulates differentiation and induces apoptosis of activated CD4+ T cells in the pathogenesis of experimental autoimmune encephalomyelitis. Toxicol Appl Pharmacol. 2019;362:105–115. doi: 10.1016/j.taap.2018.10.024. [DOI] [PubMed] [Google Scholar]

[CR22] 22.Yang L, Han X, Xing F, Wu H, Shi H, Huang F, et al. Total flavonoids of astragalus attenuates experimental autoimmune encephalomyelitis by suppressing the activation and inflammatory responses of microglia via JNK/AKT/NFκB signaling pathway. Phytomedicine. 2021;80:153385. doi: 10.1016/j.phymed.2020.153385. [DOI] [PubMed] [Google Scholar]

[CR23] 23.Yang L, Han X, Yuan J, Xing F, Hu Z, Huang F, et al. Early astragaloside IV administration attenuates experimental autoimmune encephalomyelitis in mice by suppressing the maturation and function of dendritic cells. Life Sci. 2020;249:117448. doi: 10.1016/j.lfs.2020.117448. [DOI] [PubMed] [Google Scholar]

[CR24] 24.Thiel G, Rössler OG. Resveratrol regulates gene transcription via activation of stimulus-responsive transcription factors. Pharmacol Res. 2017;117:166–176. doi: 10.1016/j.phrs.2016.12.029. [DOI] [PubMed] [Google Scholar]

[CR25] 25.Yeo H, Ahn SS, Lee JY, Jung E, Jeong M, Kang GS, et al. Disrupting the DNA binding of EGR-1 with a small-molecule inhibitor ameliorates 2, 4-dinitrochlorobenzene-induced skin inflammation. J Invest Dermatol. 2021;141:1851–1855. doi: 10.1016/j.jid.2020.12.029. [DOI] [PubMed] [Google Scholar]

[CR26] 26.Lee S, Kang S, Kim J, Yoon S, Kim SH, Moon C. Enhanced expression of immediate-early genes in mouse hippocampus after trimethyltin treatment. Acta Histochem. 2016;118:679–684. doi: 10.1016/j.acthis.2016.09.001. [DOI] [PubMed] [Google Scholar]

[CR27] 27.Jablonski SA, Robinson-Drummer PA, Schreiber WB, Asok A, Rosen JB, Stanton ME. Impairment of the context preexposure facilitation effect in juvenile rats by neonatal alcohol exposure is associated with decreased Egr-1 mRNA expression in the prefrontal cortex. Behav Neurosci. 2018;132:497–511. doi: 10.1037/bne0000272. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR28] 28.Bakalash S, Pham M, Koronyo Y, Salumbides BC, Kramerov A, Seidenberg H, et al. Egr1 expression is induced following glatiramer acetate immunotherapy in rodent models of glaucoma and Alzheimer’s disease. Invest Ophthalmol Vis Sci. 2011;52:9033–9046. doi: 10.1167/iovs.11-7498. [DOI] [PubMed] [Google Scholar]

[CR29] 29.de Olmos S, Bender C, de Olmos JS, Lorenzo A. Neurodegeneration and prolonged immediate early gene expression throughout cortical areas of the rat brain following acute administration of dizocilpine. Neuroscience. 2009;164:1347–1359. doi: 10.1016/j.neuroscience.2009.09.022. [DOI] [PubMed] [Google Scholar]

[CR30] 30.Stevanovic I, Mancic B, Ilic T, Milosavljevic P, Lavrnja I, Stojanovic I, et al. Theta burst stimulation influence the expression of BDNF in the spinal cord on the experimental autoimmune encephalomyelitis. Folia Neuropathol. 2019;57:129–145. doi: 10.5114/fn.2019.86294. [DOI] [PubMed] [Google Scholar]

[CR31] 31.KhorshidAhmad T, Acosta C, Cortes C, Lakowski TM, Gangadaran S, Namaka M. Transcriptional regulation of brain-derived neurotrophic factor (BDNF) by methyl CpG binding protein 2 (MeCP2): A novel mechanism for re-myelination and/or myelin repair involved in the treatment of multiple sclerosis (MS) Mol Neurobiol. 2016;53:1092–1107. doi: 10.1007/s12035-014-9074-1. [DOI] [PubMed] [Google Scholar]

[CR32] 32.Alrashdi B, Dawod B, Tacke S, Kuerten S, Côté PD, Marshall JS. Mice heterozygous for the sodium channel Scn8a (Nav1.6) have reduced inflammatory responses during EAE and following LPS challenge. Front Immunol. 2021;12:533423. doi: 10.3389/fimmu.2021.533423. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR33] 33.Grubić Kezele T, Blagojević Zagorac G, Jakovac H, Domitrović R, Radošević-Stašić B. Hippocampal expressions of metallothionein I/II and glycoprotein 96 in EAE-prone and EAE-resistant strains of rats. Histol Histopathol. 2017;32:137–151. doi: 10.14670/HH-11-780. [DOI] [PubMed] [Google Scholar]

[CR34] 34.Baron V, Adamson ED, Calogero A, Ragona G, Mercola D. The transcription factor Egr1 is a direct regulator of multiple tumor suppressors including TGFbeta1, PTEN, p53, and fibronectin. Cancer Gene Ther. 2006;13:115–124. doi: 10.1038/sj.cgt.7700896. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR35] 35.Jian-gang Bi. MicroRNA-181a-5p suppresses cell proliferation by targeting Egr1 and inhibiting Egr1/TGF-β/Smad pathway in hepatocellular carcinoma. Int J Biochem Cell Biol. 2019;106:107–116. doi: 10.1016/j.biocel.2018.11.011. [DOI] [PubMed] [Google Scholar]

[CR36] 36.Yang L, Jiang Y, Wen Z, Xu X, Xu X, Zhu J, et al. Over-expressed EGR1 may exaggerate ischemic injury after experimental stroke by decreasing BDNF expression. Neuroscience. 2015;290:509–517. doi: 10.1016/j.neuroscience.2015.01.020. [DOI] [PubMed] [Google Scholar]

[CR37] 37.Zhang YE. Non-smad signaling pathways of the TGF-β family. Cold Spring Harb Perspect Biol. 2017;9:a022129. doi: 10.1101/cshperspect.a022129. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR38] 38.Tzavlaki K, Moustakas A. TGF-β signaling. Biomolecules. 2020;10:487. doi: 10.3390/biom10030487. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR39] 39.Stipursky J, Francis D, Gomes FC. Activation of MAPK/PI3K/SMAD pathways by TGF-β(1) controls differentiation of radial glia into astrocytes in vitro. Dev Neurosci. 2012;34:68–81. doi: 10.1159/000338108. [DOI] [PubMed] [Google Scholar]

[CR40] 40.Asati V, Mahapatra DK, Bharti SK. PI3K/Akt/mTOR and Ras/Raf/MEK/ERK signaling pathways inhibitors as anticancer agents: Structural and pharmacological perspectives. Eur J Med Chem. 2016;109:314–341. doi: 10.1016/j.ejmech.2016.01.012. [DOI] [PubMed] [Google Scholar]

[CR41] 41.Unoki T, Abiko Y, Toyama T, Uehara T, Tsuboi K, Nishida M, et al. Methylmercury, an environmental electrophile capable of activation and disruption of the Akt/CREB/Bcl-2 signal transduction pathway in SH-SY5Y cells. Sci Rep. 2016;6:28944. doi: 10.1038/srep28944. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR42] 42.Pinton P, Rizzuto R. Bcl-2 and Ca2+ homeostasis in the endoplasmic reticulum. Cell Death Differ. 2006;13:1409–1418. doi: 10.1038/sj.cdd.4401960. [DOI] [PubMed] [Google Scholar]

[CR43] 43.Rosa N, Speelman-Rooms F, Parys JB, Bultynck G. Modulation of Ca2+ signaling by antiapoptotic Bcl-2 versus Bcl-xL: From molecular mechanisms to relevance for cancer cell survival. Biochim Biophys Acta Rev Cancer. 2022;1877:188791. doi: 10.1016/j.bbcan.2022.188791. [DOI] [PubMed] [Google Scholar]

[CR44] 44.Du Q, Zhu X, Si J. Angelica polysaccharide ameliorates memory impairment in Alzheimer’s disease rat through activating BDNF/TrkB/CREB pathway. Exp Biol Med (Maywood) 2020;245:1–10. doi: 10.1177/1535370219894558. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR45] 45.Zuo D, Sun F, Cui J, Liu Y, Liu Z, Zhou X, et al. Alcohol amplifies ketamine-induced apoptosis in primary cultured cortical neurons and PC12 cells through down-regulating CREB-related signaling pathways. Sci Rep. 2017;7:10523. doi: 10.1038/s41598-017-10868-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Early Growth Response Gene-1 Deficiency Interrupts TGFβ1 Signaling Activation and Aggravates Neurodegeneration in Experimental Autoimmune Encephalomyelitis Mice

Yunyi Lan

Xinyan Han

Fei Huang

Hailian Shi

Hui Wu

Liu Yang

Zhibi Hu

Xiaojun Wu

Abstract

Supplementary Information

Introduction

Materials and Methods

Induction of EAE

Immunohistochemistry (IHC) and Luxol Fast Blue (LFB) Staining

TUNEL Assay

Cell Culture

siRNA Cell Transfection

Hoechst Staining

Western Blot Analysis

Quantitative Real-Time PCR

Table 1.

Statistical Analysis

Results

Egr-1 is Down-Regulated in the CNS of EAE Mice

Fig. 1.

Egr-1 KO Exacerbates EAE Progression in Mice

Fig. 2.

Egr-1 KO Disturbs the BDNF/TGFβ 1/MAPK/Akt Signaling Pathways in EAE Mice

Fig. 3.

Egr-1 Knock-Down Promotes Apoptosis of SH-SY5Y Cells

Fig. 4.

Egr-1 Knock-Down Mitigates BDNF/TGFβ 1/MAPK/Akt Signaling in SH-SY5Y Cells

Fig. 5.

Discussion

Fig. 6.

Conclusions

Supplementary Information

Acknowledgements

Data Availability

Conflict of interest

Footnotes

Contributor Information

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases