Occurrence and molecular characteristics of antimicrobial resistance, virulence factors, and extended-spectrum β-lactamase (ESBL) producing Salmonella enterica and Escherichia coli isolated from the retail produce commodities in Bangkok, Thailand

Benjawan Saechue; Edward R Atwill; Saharuetai Jeamsripong

doi:10.1016/j.heliyon.2024.e26811

. 2024 Feb 23;10(5):e26811. doi: 10.1016/j.heliyon.2024.e26811

Occurrence and molecular characteristics of antimicrobial resistance, virulence factors, and extended-spectrum β-lactamase (ESBL) producing Salmonella enterica and Escherichia coli isolated from the retail produce commodities in Bangkok, Thailand

Benjawan Saechue ^a, Edward R Atwill ^b, Saharuetai Jeamsripong ^a,^c,^∗

PMCID: PMC10912461 PMID: 38444485

Abstract

The incidence of antimicrobial resistance (AMR) in the environment is often overlooked and leads to serious health threats under the One Health paradigm. Infection with extended-spectrum β-lactamase (ESBL) producing bacteria in humans and animals has been widely examined, with the mode of transmission routes such as food, water, and contact with a contaminated environment. The purpose of this study was to determine the occurrence and molecular characteristics of resistant Salmonella enterica (S. enterica) (n = 59) and Escherichia coli (E. coli) (n = 392) isolated from produce commodities collected from fresh markets and supermarkets in Bangkok, Thailand. In this study, the S. enterica isolates exhibited the highest prevalence of resistance to tetracycline (11.9%) and streptomycin (8.5%), while the E. coli isolates were predominantly resistant to tetracycline (22.5%), ampicillin (21.4%), and sulfamethoxazole (11.5%). Among isolates of S. enterica (6.8%) and E. coli (15.3%) were determined as multidrug resistant (MDR). The prevalence of ESBL-producing isolates was 5.1% and 1.0% in S. enterica and E. coli, respectively. A minority of S. enterica isolates, where a single isolate exclusively carried bla_CTX-M-55 (n = 1), and another isolate harbored both bla_CTX-M-55 and bla_TEM-1 (n = 1); similarly, a minority of E. coli isolates contained bla_CTX-M-55 (n = 2) and bla_CTX-M-15 (n = 1). QnrS (11.9%) and bla_TEM (20.2%) were the most common resistant genes found in S. enterica and E. coli, respectively. Nine isolates resistant to ciprofloxacin contained point mutations in gyrA and parC. In addition, the odds of resistance to tetracycline among isolates of S. enterica were positively associated with the co-occurrence of ampicillin resistance and the presence of tetB (P = 0.001), while the E. coli isolates were positively associated with ampicillin resistance, streptomycin resistance, and the presence of tetA (P < 0.0001) in this study. In summary, these findings demonstrate that fresh vegetables and fruits, such as cucumbers and tomatoes, can serve as an important source of foodborne AMR S. enterica and E. coli in the greater Bangkok area, especially given the popularity of these fresh commodities in Thai cuisine.

Keywords: Antimicrobial resistance, ESBL, Escherichia coli, Produce, Salmonella enterica

Highlights

•
First report on semi-quantitative data on antimicrobial resistance in S. enterica and E. coli isolated from vegetables and fruits in Thailand.
•
S. enterica And E. coli isolates were predominantly resistant to tetracycline (12% and 23%, respectively) with the multidrug resistance phenotype (7% and 15%, respectively).
•
ESBL-producing S. enterica (n = 2) and E. coli (n = 3) harbored CTX-M-55, which is commonly found in Thailand's livestock animals, aquaculture, humans, and the environment.
•
The QRDR mutation in gyrA and parC is trending toward being related to the level of ciprofloxacin resistance in this study.

1. Introduction

Salmonella enterica (S. enterica) and Escherichia coli (E. coli) have been implicated in numerous foodborne disease outbreaks associated with consumption of contaminated fresh produce such as leafy greens, basil, sprouts, cucumber, and lettuce [[1], [2], [3]]. These bacterial pathogens are important targets for monitoring and surveillance of phenotypic and genotypic AMR not only in food-producing animals, but also for commonly consumed food items and in the environment such as drinking and recreational water [4,5]. An estimated 111,295 human cases and 48,258 deaths occur each year due to AMR infections in Thailand [6]. Furthermore, there are an estimated 9,400,000 human infections and 155,000 deaths worldwide per year caused by Salmonella spp [7]. In the US, although the prevalence of S. enterica in fresh produce is low, the presence of AMR Salmonella among multiple serotypes has been widely reported in fresh vegetables [8]. With respect to Southeast Asia, previous studies in Malaysia and Vietnam have documented MDR S. enterica in fresh vegetables, which were mainly resistant to ampicillin, tetracycline, nalidixic acid, trimethoprim-sulfamethoxazole, and chloramphenicol [9,10]. Similar observations have been made for AMR E. coli and produce; for example, commensal E. coli isolated from fresh vegetables exhibited a high prevalence of AMR to streptomycin (93%) and tetracycline (30%), with 21% of the isolates being MDR [11].

Of particular concern is the occurrence of extended-spectrum β-lactamase (ESBL)-producing bacteria in human or food producing animal, given that these enzymes confer resistance to penicillins and third- and fourth-generation cephalosporins, which are clinically important antibiotics for human and animal medicine [12]. The emergence of ESBL bacteria has been caused by the widespread circulation of plasmids containing different β-lactamases, including SHV-, TEM-, CTX-M, and Toho β-Lactamases, OXA, PER, VEB-1, BES-1 and other ESBLs [13]. In addition, quinolones are broad spectrum antibiotics that can be effective for the treatment of pathogenic Enterobacteriaceae infections. The new generation fluoroquinolones (FQs) are widely used in human and veterinary medicine, perhaps facilitating the concomitant rise in FQ resistance. One growing concern about FQ resistance is its association with ESBL production in Enterobacteriaceae [14], with mutations in the quinolone-resistance-determining regions (QRDRs), a common mechanism of quinolone resistance that can lead to complicated treatment of gram-negative bacterial infections. Resistance to quinolones is mainly caused by spontaneous point mutations that substitute amino acids in the QRDRs of either gyrA or parC, or both genes [15]. Monitoring and surveillance of ESBLs and QRDRs in bacterial contaminants in common foods such as fresh fruits and vegetables is an important strategy to reduce human foodborne infection with these resistant bacteria.

Although Thailand is a major producer of fresh fruits and vegetables, epidemiological data on phenotypic and genotypic AMR are very limited. Furthermore, much of Thai cuisine makes use of fresh, raw, or partially cooked produce items, leading to possible direct exposure to foodborne AMR bacteria like S. enterica and E. coli. Although contamination of AMR bacteria in fresh vegetables has been widely documented in Thailand [[16], [17], [18]], genetic characterization of virulence profiles, and semi-quantitative analysis of AMR phenotype are relatively limited. Therefore, the objectives of this study were to characterize the virulence factors, AMR profiles and their determinants, and to genetically characterize ESBL and QRDR mutation regions in gyrA and parC of S. enterica and E. coli isolated from fresh vegetables and fruits from the retail markets in Bangkok, Thailand.

2. Materials and methods

2.1. Bacterial isolates

A total of 392 E. coli and 59 S. enterica isolates were previously obtained from a longitudinal epidemiological study conducting active surveillance for bacterial contamination of various produce commodities common in Thai cuisine (cabbage, coriander, cucumber, lettuce, spring onion, sweet basil, tomato) obtained from open-air fresh markets and enclosed supermarkets throughout Bangkok, Thailand, between May 2018 and February 2019 [19]. Fresh markets were defined as open-air retail operations in which fresh fruits and vegetables are sold in bulk and generally not packaged nor refrigerated; supermarkets were generally enclosed retail operations with temperature control and produce items packaged before retail display. Produce commodities were further classified as grown under organic or conventional farming conditions, as indicated by the retail label or self-reported by the fresh market vendor (Table 1). Sampling procedures, bacterial isolation and confirmation, Salmonella serotyping, and storage conditions of the isolates at the Department of Veterinary Public Health, Faculty of Veterinary Science, Chulalongkorn University are fully described in a previous publication [19]. The methods of this study were carried out with relevant guidelines and regulations of Chulalongkorn University, the Institutional Biosafety Committee of the Faculty of Veterinary Committee (IBC 2231042). Briefly, all samples were purchased and separately packed in a sterile plastic bag using sterile conditions. During transportation the sample was maintained at < 10 °C in a cool box, then processed within 24 h after collection. Approximately, 25 g of each vegetable and 200 g of each fruit were added into Buffered Peptone Water (BPW) (Difco, MD, USA) to make a ten-fold serial dilution. For the isolation of E. coli, one mL of each BPW dilution was inoculated in nine mL lactose broth (Difco) and incubated at 37 °C overnight. Then, one loopful of the suspension was transferred to a nine mL EC broth (Difco) and incubated at 45.5 °C for 24 h. One loopful of positive EC broth was streaked on the Levine's Eosin-Methylene Blue (L-EMB) agar (Difco), incubated at 37 °C for 24 h, and biochemically confirmed using indole and Triple Sugar Iron (TSI) (Difco).

Table 1.

S. enterica (n = 59) and E. coli (n = 392) isolates obtained from produce commodities from open-air fresh markets and supermarkets throughout Bangkok, Thailand, 2018–2019.

Type of vegetable	No. of bacterial isolations
	Supermarket		Fresh market	Total (n = 451)>
	Conventional	Organic	Conventional	Total (n = 451)>
*S. enterica*
Sweet basil	11	0	10	21
Spring onion	3	1	2	6
Coriander	1	2	10	13
Cabbage	0	0	0	0
Lettuce	4	0	12	16
Cucumber	0	0	3	3
Tomato	0	0	0	0
Total	19	3	37	59
*E. coli*
Sweet basil	27	23	29	79
Spring onion	18	18	26	62
Coriander	23	22	28	73
Cabbage	5	2	27	34
Lettuce	25	18	28	71
Cucumber	11	7	26	44
Tomato	6	8	15	29
Total	115	98	179	392
Grand total	134	101	216	451

Open in a new tab

For the isolation of Salmonella spp., the inoculated suspension was transferred to Modified Semi-Solid Rappaport-Vassiliadis (MSRV) (Difco) agar and incubated at 42 °C for 24 h. One loopful of positive MSRV plates was streaked on Xylose Lysine Deoxycholate (XLD) (Difco) and Hektoen Enteric (HE) (Difco) agar plates, incubated at 37 °C and biochemically confirmed according to the U.S. FDA BAM [20]. Salmonella serotyping was performed using a slide agglutination test according to Kauffman and White scheme [21] with commercially available antisera (S&A Reagents Lab, Bangkok, Thailand). All E. coli and S. enterica isolates were kept in 20% glycerol and stored at −80 °C.

2.2. Antimicrobial susceptibility testing

All isolates of S. enterica and E. coli were tested for minimum inhibitory concentrations (MIC) using a two-fold agar dilution method against nine antimicrobial agents (the recommended clinical breakpoints and the concentration ranges are in parentheses): ampicillin (AMP, 32 μg/mL, 0.5–1024 μg/mL), chloramphenicol (CHP, 32 μg/mL, 1–256 μg/mL), ciprofloxacin (CIP, 1 μg/mL, 0.008–64 μg/mL), gentamicin (GEN, 8 μg/mL, 0.125–64 μg/mL), streptomycin (STR, 32 μg/mL, 1–512 μg/mL), sulfamethoxazole (SUL, 512 μg/mL, 4–4096 μg/mL), tetracycline (TET, 16 μg/mL, 0.125–256 μg/mL), trimethoprim (TRI, 16 μg/mL, 0.125–1024 μg/mL), and colistin (COL, 2 μg/mL, 0.125–128 μg/mL) according to the standard protocol [22].

Briefly, the bacterial isolates were grown on Muller-Hinton agar (MHA) (Difco, MD, USA) at 37 °C overnight. A bacterial suspension with turbidity equivalent to 0.5 McFarland was then prepared in a 0.85% NaCl solution, diluted 10-fold, and inoculated onto MHA containing the indicated concentrations of antimicrobial agents as described above. The inoculated MHA plates were incubated at 37 °C for 16–18 h. E. coli ATCC 25922, Staphylococcus aureus ATCC 29213, and Pseudomonas aeruginosa ATCC 27853 were used as quality control strains. Bacterial isolates that exhibited concurrent resistance at least one antimicrobial agent in three or more than three different classes of antimicrobials were considered MDR different classes of antimicrobials were considered MDR.

For carbapenems, the disk diffusion method was used for antimicrobial susceptibility screening for all isolates using imipenem (IPM, 10 μg) and meropenem (MEM, 10 μg) according to standard protocols [22]. Briefly, the concentration of bacteria was adjusted by 0.5 McFarland standard and the suspension inoculated in MHA using a sterile cotton swab. Antimicrobial disks were placed in inoculated plates, followed by incubation at 37 °C for 16–18 h. The clinical breakpoints of an inhibition clear zone for both imipenem and meropenem are at least 19 mm, with inhibition zones less than 19 mm defined as resistant strains. E. coli ATCC 25922, S. aureus ATCC 29213, and P. aeruginosa ATCC 27853 were used as quality control strains.

2.3. Determination of ESBL production

Disk diffusion was used to identify production of ESBLs for all isolates according to the Clinical & Laboratory Standards Institute [22]. Briefly, the concentration of bacteria was adjusted to a 0.5 McFarland standard and the suspension inoculated onto MHA using a sterile cotton swab. The initial screening of ESBL production was identified by disk diffusion using ceftazidime (30 μg), cefotaxime (30 μg), and cefpodoxime (10 μg) (Liofilchem, Roseto Degli Abruzzi, Italy). The antimicrobial disks were placed on inoculated plates, followed by incubation at 37 °C for 16–18 h. Isolates that produced an inhibition clear zone of at least 11 mm in diameter were defined as resistant strains. Isolates that showed resistance to at least one cephalosporin test were then subjected to ESBL phenotypic confirmation by a combination disk assay using cefotaxime (30 μg) and ceftazidime (30 μg) with and without clavulanic acid (10 μg) (Liofilchem). Isolates that showed an increase equal to and greater than 5 mm in the zone of inhibition in a combination disk were considered ESBL producers.

2.4. DNA preparation and PCR amplification

Preparation of genomic bacterial DNA was carried out using the whole cell boiling method [23]. A loopful of the bacterial isolate on nutrient agar (Difco) was suspended into 200 μL of sterile RNase-free water. The suspension was boiled for 10 min in a water bath and iced for 10 min, and the suspension then centrifuged at 14,000 rpm for 10 min to remove debris. The supernatant containing DNA was transferred to a sterile tube and stored at −20 °C until used as a template in the PCR assays.

The 25 μl PCR reaction mixture consisted of 12.5 μL 2 × Dream Taq PCR Master, 1 μL each primer, 1 μL template DNA, and 9.5 μL nuclease-free water. The concentration of primers, the annealing temperatures, and the sizes of the amplicons are shown in Table 2. The thermal cycling conditions were carried out at 94 °C for 5 min, followed by 30 cycles of 94 °C for 1 min, the annealing temperature for 1 min, 72 °C for 1 min, and a final extension at 72 °C for 5 min. The PCR product was analyzed by performing 1.5% agarose gel electrophoresis stained with Redsafe™ nucleic acid staining solution (Intron Biotechnology, Seongnam, Republic of Korea) for 40 min at 120 V using a horizontal electrophoresis apparatus. The gels were visualized using a UV transilluminator coupled with a digital gel imaging system.

Table 2.

PCR primer pairs used to identify AMR, ESBL, and virulence genes in E. coli and S. enterica.

Gene	Primer	Oligonucleotide sequences	Annealing (C)	Product size (bp)	Reference
Ampicillin
bla_TEM	bla_TEM-F	ATCAGTTGGGTGCACGAGTG	60	608	[24]
bla_TEM	bla_TEM-R	ACGCTCACCGGCTCCAGA			[24]
bla_pse	bla_PSE-F	GCTCGTATAGGTGTTTCCGTTT	60	575	[25]
bla_pse	bla_PSE-R	CGATCCGCCGAHTGTTCCATCC			[25]
Chloramphenicol
catA	catA-F	CCAGACCGTTCAGCTGGATA	58	454	[26]
	catA-R	CATCAGCACCTTGTCGCCT			[26]
cmlA	cmlA-F	TGGACCGCTATCGGACCG	57	641	[26]
	cmlA-R	CGCAAGACACTTGGGCTGC			[26]
floR	floR-F	ATGGTGATGCTCGGCGTGGGCCA	58	800	[27]
	floR-R	GCGCCGTTGGCGGTAACAGACACCGTGA			[27]
Tetracycline
tetA	tetA-F	GCTGTCGGATCGTTTCGG	60	658	[26]
	tetA-R	CATTCCGAGCATGAGTGCC			[26]
tetB	tetB-F	CTGTCGCGGCATCGGTCAT	60	615	[26]
	tetB-R	CAGGTAAAGCGATCCCACC			[26]
tetW	tetW-F	ATGAACATTCCCACCGTTA	53	101	[28]
	tetW-R	ATATCGGCGGAGAGCT			[28]
tetO	tetO-F	CAACATTAACGGAAAGTTT	53	104	[28]
	tetO-R	TTGACGCTCCAAATTCA			[28]
tetT	tetT-F	CCATATAGAGGTTCCACCA	53	73	[28]
	tetT-R	TGACCCTATTGGTAGTG			[28]
Trimethoprim
dfrA1	dfrA1-F	GGAGTGCCAAAGGTGAACAGC	55	367	[29]
	dfrA1-R	GAGGCGAAGTCTTGGGTAAAAAC			[29]
dfrA12	dfrA12-F	TTCGCAGACTCACTGAGGG	55	330	[26]
	dfrA12-R	CGGTTGAGACAAGCTCGAAT			[26]
dfrA14	dfrA14-F	GATTGGTTGCGGTCCA	53	379	[30]
	dfrA14-R	CTCAAAAACAACTTCGAAGG			[30]
Streptomycin
strA	strA-F	TGGCAGGAGGAACAGGAGG	57	405	[26]
	strA-R	AGGTCGATCAGACCCGTGC			[26]
strB	strB-F	GCGGACACCTTTTCCAGCCT	57	621	[26]
	strB-R	TCCGCCATCTGTGCAATGCG			[26]
aadA	aadA-F	CCCCTGGAGAGAGCGAGATT	61	152	[31]
	aadA-R	CGTGGCTGGCTCGAAGATAC			[31]
Gentamicin
aadB	aadB-F	CCTGCTTGGTGGGCAGAC	55	244	[32]
	aadB-R	CGGCACGCAAGACCTC			[32]
aphA-1	aphA-1-F	TGAACAAGTCTGGAAAGA	50	114	[28]
	aphA-1-R	CCTATTAATTTCCCCTC			[28]
Ciprofloxacin
qnrA	qnrA-F	AGAGGATTTCTCACGCCAGG	54	580	[33]
	qnrA-R	TGCCAGGCACAGATCTTGAC			[33]
qnrB	qnrB-F	GGMATHGAAATTCGCCACTG	54	264	[33]
	qnrB-R	TTTGCYGYYCGCCAGTCGAAC			[33]
qnrS	qnrS-F	GCAAGTTCATTGAACAGGGT	54	428	[33]
	qnrS-R	TCTAAACCGTCGAGTTCGGCG			[33]
Sulfamethoxazole
Sul1	sul1-F	CGGCGTGGGCTACCTGAACG	66	433	[34]
	sul1-R	GCCGATCGCGTGAAGTTCCG			[34]
Sul2	sul2-F	CGGCATCGTCAACATAACCT	66	721	[34]
	sul2-R	TGTGCGGATGAAGTCAGCTC			[34]
Sul3	sul3-F	CAACGGAAGTGGGCGTTGTGGA	66	244	[34]
	sul3-R	GCTGCACCAATTCGCTGAACG			[34]
Colistin
mcr-1	mcr-1-F	AGTCCGTTTGTTCTTGTGGC	58	320	[35]
	mcr-1-R	AGATCCTTGGTCTCGGCTTG			[35]
mcr-2	mcr-2-F	CAAGTGTGTTGGTCGCAGTT	58	715	[35]
	mcr-2-R	TCTAGCCCGACAAGCATACC			[35]
mcr-3	mcr-3-F	AAATAAAAATTGTTCCGCTTATG	58	929	[35]
	mcr-3-R	AATGGAGATCCCCGTTTTT			[35]
mcr-4	mcr-4-F	TCACTTTCATCACTGCGTTG	58	1116	[35]
	mcr-4-R	TTGGTCCATGACTACCAATG			[35]
mcr-5	mcr-5-F	ATGCGGTTGTCTGCATTTATC	58	1644	[35]
	mcr-5-R	TCATTGTGGTTGTCCTTTTCTG			[35]
Carbapenem
bla_NDM	bla_NDM-F	GGTTTGGCGATCTGGTTTTC	52	621	[36]
	bla_NDM-R	CGGAATGGCTCATCACGATC			[36]
bla_OXA	bla_OXA-F	ACACAATACATATCAACTTCGC	62	813	[37]
	bla_OXA-R	AGTGTGTGTTTAGAATGGTGATC			[37]
ESBL gene
bla_SHV	bla_SHV-F	TTATCTCCCTGTTAGCCACC	50	797	[38]
bla_SHV	bla_SHV-R	GATTTGCTGATTTCGCTCGG			[38]
bla_CTX-M	bla_CTX-M-F	CGATGTGCAGTACCAGTAA	60	585	[39]
	bla_CTX-M-R	AGTGACCAGAATCAGCGG			[39]
Disinfectant genes
qacE	qacE-F	CCCGAATTCATGAAAGGCTGGCTT	55	350	[40]
	qacE-R	TAAGCTTTCACCATGGCGTCGG			[40]
Integrons
Int1	int1-F	CCTGCACGGTTCGAATG	58	497	[41]
	int1-R	TCGTTTGTTCGCCCAGC			[41]
Int2	int2-F	GGCAGACAGTTGCAAGACAA	58	247	[41]
	int2-R	AAGCGATTTTCTGCGTGTTT			[41]
Int3	int3-F	CCGGTTCAGTCTTTCCTCAA	58	155	[41]
	int3-R	GAGGCGTGTACTTGCCTCAT			[41]
Integrative and conjugative elements
Int_sxt	int_SXT-F	GCTGGATAGGTTAAGGGCGG	58	592	[41]
	int_SXT-R	CTCTATGGGCACTGTCCACATTG			[41]
Virulence genes
stx1^a	stx-1-F	CAACACTGGATGATCTCAG	55	349	[42]
	stx-1-R	CCCCCTCAACTGCTAATA			[42]
stx2^a	stx-2-F	ATCAGTCGTCACTCACTGGT	55	110	[42]
	stx-2-R	CTGCTGTCACAGTGACAAA			[42]
invA^b	invA-F	GTGAAATTATCGCCACGTTCGGGCAA	58	284	[43]
	invA-R	TCATCGCACCGTCAAAGGAACC			[43]
spvR^b	spvR-F	CAGGTTCCTTCAGTATCGCA	58	310	[43]
	spvR-R	TTTGGCCGGAAATGGTCAGT			[43]
fimA^b	fimA-F	CCTTTCTCCATCGTCCTGAA	58	85	[43]
	fimA-R	TGGTGTTATCTGCCTGACCA			[43]
stn^b	stn-F	CTTTGGTCGTAAAATAAGGCG	58	260	[43]
	stn-R	TGCCCAAAGCAGAGAGATTC			[43]
QRDR region
gyrA	gyrA-F	GCTGAAGAGCTCCTATCTGG	58	436	[44]
	gyrA-R	GGTCGGCATGACGTCCGG			[44]
parC	parC-F	GTACGTGATCATGGATCGTG	58	390	[44]
	parC-R	TTCCTGCATGGTGCCGTCG			[44]

Open in a new tab

represented the gene that used for only E. coli isolates.

represented the gene that used for only S. enterica isolates.

2.5. Genotypic detection of AMR, ESBL, virulence factors, and integrons

All primers used for AMR, ESBL, virulence factors and integrons are described in Table 2. The presence of AMR genes was determined in all isolates with the corresponding resistance phenotype.

The presence of virulence genes associated with the pathogenesis of S. enterica (invA, fimA, stn, and spvR) and E. coli (stx1 and stx2) were also determined. For resistance determinants, the presence of Integrative and Conjugative Elements (ICEs; Int_sxt) and class 1, 2, and 3 integrons (int1, int2, and int3) was determined in all isolates.

2.6. Nucleotide sequencing of ESBL and QRDR

Three E. coli isolates carrying bla_CTX and one S. enterica carrying both bla_CTX and bla_TEM were submitted for nucleotide sequencing. Nine isolates of resistance to ciprofloxacin were selected, including one S. enterica isolate and eight E. coli isolates to characterize the QRDR mutation, and two susceptible ciprofloxacin isolates from each of S. enterica and E. coli served as negative control strains. All bacterial isolates were examined for the presence of gyrA and parC using the primers listed in Table 2.

All PCR products were purified and sequenced (Macrogen, Inc., Seoul, Republic of Korea), with sequences analyzed using the Molecular Evolutionary Genetic Analysis (Mega) software version 11 [45]. Reference sequences were downloaded from the GenBank database available from the National Centre for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov). The accession numbers for the various genes were as follows: gyrA: OQ268120, OQ268121, OQ268122, OQ268123, OQ268124, OQ268125, OQ268126, OQ268127, OQ268128; parC: OQ268129, OQ268130, OQ268131, OQ268132, OQ268133, OQ268134, OQ268135, OQ268136, OQ268137; blaCTX-M-55: OQ281750, OQ281751, OQ281752, OQ281753; blaCTX-M-15: OQ281754; blaTEM-1: OQ281755.

2.7. Statistical analysis

Descriptive statistics were used to describe the prevalence of AMR, MDR, ESBL production, and virulence factors for the group of S. enterica and E. coli isolates. McNemar's chi-square test was used to examine the association between the AMR phenotype and the genotype. The median and range of MICs between susceptible and resistance bacteria were also compared. Logistic regression was used to determine the association between the odds of tetracycline resistance and the various virulence factors, non-tetracycline resistance, and their genetic determinants. Odds ratio (OR) > 1 is considered a positive relationship, while OR < 1 is a negative relationship. Stepwise forward selection and backward elimination were used to select the final statistical model. The two-sided hypotheses test was used based on a P - value < 0.05. All statistical analyses were performed with SPSS version 22 (IBM Company, Chicago, USA).

3. Results

3.1. Prevalence and patterns of AMR for isolates of S. enterica and E. coli

Fifteen percent of all isolates of S. enterica, (n = 9/59) were resistant to at least one antimicrobial, while the prevalence of MDR was 6.8% (n = 4/59). The highest prevalence of AMR in S. enterica was to tetracycline (11.9%, n = 7/59), followed by streptomycin (8.5%, n = 5/59), ampicillin (6.8%, n = 4/59), ceftazidime (6.8%, n = 4/59), and sulfamethoxazole (5.1%, n = 3/59) (Table 3). Resistance to colistin, imipenem, and meropenem was not observed among these isolates. The bacteria isolated from cucumbers exhibited the highest prevalence of AMR, which was against tetracycline (33.3%, n = 1/3), but the low sample size of the isolates for this commodity makes this value somewhat unreliable (Fig. 1A). Furthermore, S. enterica isolated from cucumber and coriander were more frequently AMR compared to isolates from other products, while no AMR isolates were obtained from spring onion and lettuce (Fig. 1A). It is interesting that none of the S. enterica isolated from conventional produce from all 19 of the sampled supermarkets exhibited phenotypic AMR; in contrast, one of the three isolates of S. enterica from organic produce from supermarkets exhibited MDR (Table 3).

Table 3.

Phenotypic resistance of S. enterica (n = 59) and E. coli (n = 392) isolated from produce commodities from supermarkets and open-air fresh markets throughout Bangkok, Thailand.

Antimicrobials	No. of resistance isolates (%)
	Supermarket		Fresh market	Total
	Conventional	Organic	Conventional	Total
*S. enterica*	n = 19	n = 3	n = 37	n = 59
Ampicillin	0 (0.0)	1 (33.3)	3 (8.1)	4 (6.8)
Tetracycline	0 (0.0)	1 (33.3)	6 (16.2)	7 (11.9)
Trimethoprim	0 (0.0)	1 (33.3)	1 (2.7)	2 (3.4)
Sulfamethoxazole	0 (0.0)	1 (33.3)	2 (5.4)	3 (5.1)
Streptomycin	0 (0.0)	1 (33.3)	4 (10.8)	5 (8.5)
Ciprofloxacin	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)
Chloramphenicol	0 (0.0)	1 (33.3)	1 (2.7)	2 (3.4)
Gentamicin	0 (0.0)	1 (33.3)	2 (5.4)	2 (3.4)
Colistin	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)
Imipenem	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)
Meropenem	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)
Ceftazidime	0 (0.0)	2 (66.7)	2 (5.4)	4 (6.8)
Cefotaxime	0 (0.0)	1 (33.3)	2 (5.4)	3 (5.1)
Cefpodoxime	0 (0.0)	1 (33.3)	2 (5.4)	3 (5.1)
ESBL producer	0 (0.0)	1 (33.3)	2 (5.4)	3 (5.1)
MDR	0 (0.0)	1 (33.3)	3 (8.1)	4 (6.8)
*E. coli*	n = 115	n = 98	n = 179	n = 392
Ampicillin	25 (21.7)	22 (22.5)	37 (20.7)	84 (21.4)
Tetracycline	29 (25.2)	21 (21.4)	38 (21.2)	88 (22.5)
Trimethoprim	15 (13.0)	11 (11.2)	15 (8.4)	41 (10.5)
Sulfamethoxazole	12 (10.4)	13 (13.3)	20 (11.2)	45 (11.5)
Streptomycin	12 (10.4)	7 (7.1)	18 (10.1)	37 (9.4)
Ciprofloxacin	4 (3.5)	0 (0.0)	4 (2.2)	8 (2.0)
Chloramphenicol	6 (5.2)	9 (9.2)	8 (4.5)	23 (5.8)
Gentamicin	1 (0.8)	0 (0.0)	4 (2.2)	5 (1.3)
Colistin	2 (1.7)	0 (0.0)	0 (0.0)	2 (0.5)
Imipenem	0 (0.0)	1 (1.0)	0 (0.0)	1 (0.3)
Meropenem	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)
Ceftazidime	2 (1.7)	1 (1.0)	1 (1.1)	4 (1.0)
Cefotaxime	2 (1.7)	2 (2.0)	2 (1.1)	6 (1.5)
Cefpodoxime	2 (1.7)	2 (2.0)	2 (1.1)	6 (1.5)
ESBL producer	2 (1.7)	1 (1.0)	1 (0.6)	4 (1.0)
MDR	19 (16.5)	14 (14.3)	27 (15.1)	60 (15.3)

Open in a new tab

MDR – multidrug resistant.

Fig. 1 — The distribution of phenotypic resistance of (A) *S. enterica* (n = 59) and (B) *E. coli* (n = 392) isolated from different produce commodities common to Thai cuisine. Antimicrobials tested were ampicillin (AMP), chloramphenicol (CHL), ciprofloxacin (CIP), colistin (COL), gentamicin (GEN), Imipenem (IMP), meropenem (MRP), sulfamethoxazole (SMZ), streptomycin (STR), tetracycline (TET), and trimethoprim (TMP). ESBL – extended-spectrum β-lactamase; MDR – multidrug resistant. Percentages within parentheses are within-column proportions (for example, cucumbers provided three *S. enterica* isolates, among which 33.3% or 1/3 exhibited ampicillin resistance).

The median MIC for the nine S. enterica isolates exhibiting AMR was 3 times higher than the clinical breakpoint for all antimicrobials tested, except for colistin since all isolates were susceptible to this antibiotic (Fig. 2A). Furthermore, the median MICs for trimethoprim, sulfamethoxazole, chloramphenicol, and gentamicin exceeded the upper MIC detection limit for this study. For example, the median MIC for sulfamethoxazole resistance was higher than 4096 $μ$ g/mL, which is at least four-fold higher than its clinical breakpoint of 512 $μ$ g/mL. Six AMR patterns were observed among these AMR S. enterica isolates, with the most common pattern being TET (6.8%, n = 4/59), followed by 1.7% (n = 1/59) of each pattern of AMP-CHL-CIP-GEN-SMZ-STR-TET-TMP, AMP-CHL-GEN-SMZ-STR-TET-TMP, AMP-GEN-STR, AMP-SMZ-STR-TET and STR (Table 4).

Fig. 2 — The range of minimum inhibitory concentrations (MICs) for the group of (A) *S. enterica* (n = 59) and (B) *E. coli* (n = 392) isolates. The concentration ranges of each antimicrobial agent used for the antimicrobial susceptibility test are shown as light blue (susceptible range) and light orange (resistance range) with a clinical breakpoint (red line) for resistance. The median MICs are indicated at the susceptible point (blue) and resistance point (orange). AMP – ampicillin; CHL – chloramphenicol; CIP – ciprofloxacin; COL – colistin; GEN – gentamicin; SMZ – sulfamethoxazole; STR – streptomycin; TET – tetracycline; TMP – trimethoprim; FM – fresh market; SPM – supermarket; CONV – conventional produce; ORG – organic produce.

Table 4.

Resistance patterns of S. enterica (n = 59) isolated from produce commodities sold in supermarkets and open-air fresh markets from throughout Bangkok, Thailand.

AMR pattern	No. (%) of isolates with AMR pattern
	Supermarket		Fresh market	Total (n = 59)>
	Conventional (n = 19)>	Organic (n = 3)>	Conventional (n = 37)>	Total (n = 59)>
AMP-CHL-CIP-GEN-SMZ-STR-TET-TMP	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)
AMP-CHL-GEN-SMZ-STR-TET-TMP	0 (0.0)	1 (33.3)	0 (0.0)	1 (1.7)
AMP-GEN-STR	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)
AMP-SMZ-STR-TET	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)
STR	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)
TET	0 (0.0)	0 (0.0)	4 10.8)	4 (6.8)

Open in a new tab

AMP – ampicillin, CHL – chloramphenicol, CIP – ciprofloxacin, GEN – gentamicin, SMZ – sulfamethoxazole, STR – streptomycin, TET – tetracycline, TMP – trimethoprim.

One hundred and three out of 392 E. coli isolates (26.3%) exhibited phenotypic AMR to at least one or more antimicrobials, with about half (15.3%, n = 60/392) of these isolates exhibiting MDR. The highest prevalence of AMR was to tetracycline (22.5%, n = 88/392), followed by ampicillin (21.4%, n = 84/392), sulfamethoxazole (11.5%, n = 45/392), trimethoprim (10.5%, n = 41/392), and streptomycin (9.4%, n = 37/392) (Table 3, Fig. 1B). Resistance to tetracycline was highest in isolates from tomatoes (41.4%, n = 12/29), followed by spring onions (32.3%, n = 20/62) and cabbage (29.4%, n = 10/34). Similarly, a high prevalence of ampicillin resistance among E. coli was observed for isolates from tomatoes (34.5%), spring onions (33.9%) and cabbage (26.5%). E. coli isolated from spring onions exhibited the highest prevalence of MDR (24.2%), followed by isolates from cabbage (24.2%) (Fig. 1B). The median MICs of trimethoprim, sulfamethoxazole, and gentamicin were above the detection limit (Fig. 2B). The prevalence of AMR for E. coli isolated from supermarket produce reportedly grown under conventional methods compared organic conditions were not significantly different (P > 0.05).

In this study, 38 E. coli AMR patterns were observed, with the predominant resistance patterns being AMP-TET (5.4%, n = 21/392), followed by AMP-STR-TET (2.8%, n = 11/392), and TET (1.8%, n = 7/392) (Table 5).

Table 5.

Resistance patterns of E. coli (n = 392) isolated from produce commodities sold in supermarkets and open-air fresh markets from throughout Bangkok, Thailand.

AMR pattern	No. (%) of isolates with AMR pattern
	Supermarket		Fresh market	Total (n = 392)>
	Conventional (n = 115)>	Organic (n = 98)>	Conventional (n = 179)>	Total (n = 392)>
AMP	2 (1.7)	0 (0.0)	0 (0.0)	2 (0.5)
AMP-CHL-CIP-GEN-SMZ-STR-TET-TMP	0 (0.0)	0 (0.0)	1 (0.6)	1 (0.3)
AMP-CHL-CIP-SMZ-TET-TMP	1 (0.7)	0 (0.0)	3 (1.7)	4 (1.0)
AMP-CHL-COL-SMZ-STR-TET-TMP	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
AMP-CHL-GEN-SMZ-STR-TET	0 (0.0)	0 (0.0)	1 (0.6)	1 (0.3)
AMP-CHL-GEN-SMZ-TET-TMP	0 (0.0)	0 (0.0)	1 (0.6)	1 (0.3)
AMP-CHL-SMZ-STR-TET	1 (0.7)	1 (1.0)	0 (0.0)	2 (0.5)
AMP-CHL-SMZ-STR-TET-TMP	1 (0.7)	4 (4.1)	1 (0.6)	6 (1.5)
AMP-CHL-SMZ-TET	0 (0.0)	1 (1.0)	0 (0.0)	1 (0.3)
AMP-CHL-SMZ-TET-TMP	0 (0.0)	2 (2.0)	0 (0.0)	2 (0.5)
AMP-CHL-SMZ-TMP	0 (0.0)	1 (1.0)	0 (0.0)	1 (0.3)
AMP-CHL-TET-TMP	1 (0.7)	0 (0.0)	1 (0.6)	2 (0.5)
AMP-CIP-TET-TMP	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
AMP-GEN	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
AMP-GEN-SMZ-STR-TET	0 (0.0)	0 (0.0)	1 (0.6)	1 (0.3)
AMP-IMP	0 (0.0)	1 (1.0)	0 (0.0)	1 (0.3)
AMP-SMZ	0 (0.0)	0 (0.0)	1 (0.6)	1 (0.3)
AMP-SMZ-STR-TET	1 (0.7)	0 (0.0)	2 (1.1)	3 (0.8)
AMP-SMZ-STR-TET-TMP	1 (0.7)	1 (1.0)	3 (1.7)	5 (1.3)
AMP-SMZ-TET	1 (0.7)	1 (1.0)	1 (0.6)	3 (0.8)
AMP-SMZ-TET-TMP	1 (0.7)	2 (2.0)	3 (1.7)	6 (1.5)
AMP-SMZ-TMP	0 (0.0)	0 (0.0)	2 (1.1)	2 (0.5)
AMP-STR-TET	3 (2.6)	1 (1.0)	7 (3.9)	11 (2.8)
AMP-STR-TET-TMP	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
AMP-TET	5 (4.3)	7 (7.1)	9 (5.0)	21 (5.4)
AMP-TET-TMP	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
AMP-TMP	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
CHL-TET-TMP	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
CIP	2 (1.7)	0 (0.0)	0 (0.0)	2 (0.5)
COL	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
SMZ-STR-TET	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
SMZ-TET-TMP	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
SMZ-TMP	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
STR	0 (0.0)	0 (0.0)	1 (0.6)	1 (0.3)
STR-TET	2 (1.7)	0 (0.0)	1 (0.6)	3 (0.8)
TET	3 (2.6)	1 (1.0)	3 (1.7)	7 (1.8)
TET-TMP	1 (0.7)	0 (0.0)	0 (0.0)	1 (0.3)
TMP	0 (0.0)	1 (1.0)	0 (0.0)	1 (0.3)

Open in a new tab

AMP – ampicillin, CHL – chloramphenicol, CIP – ciprofloxacin, COL – colistin, GEN – gentamicin, IMP – imipenem, MRP – meropenem, SMZ – sulfamethoxazole, STR – streptomycin, TET – tetracycline, TMP – trimethoprim.

3.2. Genetic analysis of AMR in S. enterica and E. coli isolates

Among all resistance genes that were analyzed, qnrS (11.9%) was the most common among S. enterica isolates, followed by tetB (6.8%), tetA (5.1%), strA (5.1%), strB (5.1%), and qnrB (5.1%). The least common AMR gene found in S. enterica was dfrA12, sul2, sul3, cmlA, bla_TEM, and qacE (Table 6). Interestingly, a single S. enterica isolate from sweet basil from a supermarket carried bla_TEM, tetB, strA, and strB (data not shown). Among supermarket organic vegetable isolates (n = 3), the most predominant resistance gene was qnrS (66.7%), found in spring onions and coriander, followed by single detection (1/3) of tetA, sul2, strA, strB, and floR (data not shown). For conventional vegetables from fresh markets, the most frequent AMR gene was the qnrS (13.5%, n = 5/37), which was found in sweet basil, followed by qnrB (8.1%), tetB (8.1%), tetA (5.4%), and aadA (5.4%) (data not shown).

Table 6.

Genotypic characteristics of S. enterica (n = 59) isolated from produce commodities sold in supermarkets and open-air fresh markets from throughout Bangkok, Thailand.

Genes	No. (%) of isolates with specified gene
	Supermarket		Fresh market	Total (n = 59)>
	Conventional (n = 19)>	Organic (n = 3)>	Conventional (n = 37)>	Total (n = 59)>
AMR genes
bla_TEM	1 (5.3)	0 (0.0)	1 (2.7)	2 (3.4)
tetA	0 (0.0)	1 (33.3)	2 (5.4)	3 (5.1)
tetB	1 (5.3)	0 (0.0)	3 (8.1)	4 (6.8)
dfrA12	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)
sul2	0 (0.0)	1 (33.3)	0 (0.0)	1 (1.7)
sul3	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)
strA	1 (5.3)	1 (33.3)	1 (2.7)	3 (5.1)
strB	1 (5.3)	1 (33.3)	1 (2.7)	3 (5.1)
aadA	0 (0.0)	0 (0.0)	2 (5.4)	2 (3.4)
qnrB	0 (0.0)	0 (0.0)	3 (8.1)	3 (5.1)
qnrS	0 (0.0)	2 (66.7)	5 (13.5)	7 (11.9)
cmlA	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)
floR	0 (0.0)	1 (33.3)	1 (2.7)	2 (3.4)
bla_CTX-M-55	0 (0.0)	1 (33.3)	1 (2.7)	2 (3.4)
bla_TEM-1	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)
qacE	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)
Integrons
int1	0 (0.0)	0 (0.0)	2 (5.4)	2 (3.4)
Virulence genes
invA	19 (100.0)	3 (100.0)	36 (97.3)	58 (98.3)
spvR	19 (100.0)	3 (100.0)	37 (100.0)	59 (100.0)
fimA	19 (100.0)	3 (100.0)	36 (97.3)	58 (98.3)
stn	0 (0.0)	0 (0.0)	1 (2.7)	1 (1.7)

Open in a new tab

Note: only positive genes were shown in this table.

Among E. coli isolates, the predominant resistance genes were bla_TEM (20.2%), tetA (19.1%), and qnrS (14.8%) (Table 7). In E. coli isolates from conventional vegetables collected from supermarkets (n = 115), the prevalence of resistance genes for tetA, bla_TEM, and qnrS was 20.0%, 18.3%, and 15.7%, respectively (Table 7). For supermarket organic vegetable isolates (n = 98), the predominant AMR genes were bla_TEM (23.5%), tetA (22.4%) and qnrS (16.3%). For conventional vegetables from fresh markets (n = 179), bla_TEM (19.6%) was the most common among the isolates, followed by tetA (16.8%), qnrS (13.4%), sul2 (6.1%), and sul3 (6.1%) (Table 7).

Table 7.

Genotypic characteristics of E. coli (n = 392) isolated from produce commodities sold in supermarkets and open-air fresh markets from throughout Bangkok, Thailand.

Genes	No. (%) of isolates with specified gene
	Supermarket		Fresh market	Total (n = 392)>
	Conventional (n = 115)	Organic (n = 98)	Conventional (n = 179)>	Total (n = 392)>
AMR genes
bla_TEM	21 (18.3)	23 (23.5)	35 (19.6)	79 (20.2)
bla_PSE	0 (0.0)	0 (0.0)	1 (0.6)	1 (0.3)
tetA	23 (20.0)	22 (22.4)	30 (16.8)	75 (19.1)
tetB	3 (2.6)	0 (0.0)	2 (1.1)	5 (1.3)
tetW	2 (1.7)	5 (5.1)	3 (1.7)	10 (2.6)
dfrA1	2 (1.7)	0 (0.0)	1 (0.6)	3 (0.8)
dfrA12	3 (2.6)	7 (7.1)	7 (3.9)	17 (4.3)
dfrA14	6 (5.2)	4 (4.1)	5 (2.8)	15 (3.8)
sul1	0 (0.0)	1 (1.0)	5 (2.8)	6 (1.5)
sul2	7 (6.1)	5 (5.1)	11 (6.1)	23 (5.9)
sul3	3 (2.6)	6 (6.1)	11 (6.1)	20 (5.1)
strA	11 (9.6)	6 (6.1)	9 (5.0)	26 (6.6)
strB	10 (8.7)	6 (6.1)	9 (5.0)	25 (6.4)
aadA	5 (4.3)	7 (7.1)	8 (4.5)	20 (5.1)
qnrA	0 (0.0)	1 (1.0)	0 (0.0)	1 (0.3)
qnrB	0 (0.0)	2 (2.0)	0 (0.0)	2 (0.5)
qnrS	18 (15.7)	16 (16.3)	24 (13.4)	58 (14.8)
cmlA	3 (2.6)	7 (7.1)	8 (4.5)	18 (4.6)
floR	6 (5.2)	9 (9.2)	6 (3.4)	21 (5.4)
aadB	1 (0.9)	0 (0.0)	0 (0.0)	1 (0.3)
mcr-1	1 (0.9)	0 (0.0)	0 (0.0)	1 (0.3)
bla_CTX-M-15	1 (0.9)	0 (0.0)	0 (0.0)	1 (0.3)
bla_CTX-M-55	1 (0.9)	0 (0.0)	1 (0.6)	2 (0.5)
qacE	1 (0.9)	0 (0.0)	0 (0.0)	1 (0.3)
Integrons
int1	11 (9.6)	7 (7.1)	9 (5.0)	27 (6.9)

Open in a new tab

Note: only positive genes were shown in this table.

Overall, the prevalence of AMR genes detected in these produce commodities did not differ significantly (P > 0.05) between reported conventional and organic cultivation practices for the S. enterica and E. coli isolates.

A single S. enterica and eight E. coli isolated from conventional cultivation practices that were resistant to ciprofloxacin had gyrA and parC mutations. S. enterica (n = 1) isolated from conventional coriander with co-occurrence qnrS was found to have the double-point mutation in gyrA (Ser83Phe and Asp87Gly) and a single-point mutation in parC (Ser80Arg), with MIC of 16 $μ$ g/mL. Among the eight E. coli isolates, the frequency of resistance to ciprofloxacin was detected mainly in spring onions (n = 5/8) (Table 8). For the gyrA gene, all E. coli isolates were found to have a double point mutation in Ser83Leu and Asp87Asn with and without the presence of the qnrS gene. Seven out of eight E. coli isolates had a parC mutation in Ser80Ile (n = 4), with MICs between 4 and 16 $μ$ g/mL and double point mutation in Ser80Ile and Glu84Gly (n = 3), with MICs between 16 and 32 $μ$ g/mL. An E. coli isolate with a low MIC (1 $μ$ g/mL) did not exhibit the mutation of parC.

Table 8.

Ciprofloxacin resistant E. coli (n = 8) and S. enterica (n = 1) isolates from conventional produce cultivation with PMQR genes and gyrA and parC mutations in the QRDR.

ID	Source	Vegetable	MIC (μg/mL)	PMQR	QRDR
ID	Source	Vegetable	MIC (μg/mL)	PMQR	gyrA mutation		parC mutation
EC035	FM	Spring onion	1	qnrS	Ser83Leu	–	–	–
EC047	FM	Spring onion	4	–	Ser83Leu	Asp87Asn	Ser80Ile	–
EC078	FM	Tomato	16	–	Ser83Leu	Asp87Asn	Ser80Ile	–
EC106	FM	Spring onion	32	qnrS	Ser83Leu	Asp87Asn	Ser80Ile	Glu84Gly
EC179	SPM	Sweet basil	16	–	Ser83Leu	Asp87Asn	Ser80Ile	–
EC239	SPM	Spring onion	16	–	Ser83Leu	Asp87Asn	Ser80Ile	Glu84Gly
EC247	SPM	Spring onion	4	qnrS	Ser83Leu	–	Ser80Ile	–
EC377	SPM	Cabbage	32	qnrS	Ser83Leu	Asp87Asn	Ser80Ile	Glu84Gly
SE01	FM	Coriander	16	qnrS	Ser83Phe	Asp87Asn	Ser80Arg	–

Open in a new tab

EC – E. coli, SE – S. enterica, FM – fresh market, SPM – supermarket, MIC – minimum inhibitory concentration, PMQR – plasmid-mediated quinolone resistance, QRDR – quinolone-resistance determining region.

3.3. ESBL production in S. enterica and E. coli isolates

A small proportion of the S. enterica (5.1%, n = 3/59) isolates exhibited ESBL production (Table 3), which were only found in coriander (15.4%, n = 2/13) and sweet basil (4.8%, n = 1/21) (Fig. 1A). Among the three ESBL positive isolates, an organic produce (coriander) collected in the supermarket was S. enterica serovar Afula (data not shown), and the other two conventional vegetables (coriander and sweet basil) from the fresh market were S. enterica serovar Schwarzengrunt and Uganda (data not shown). All ESBL producing isolates were MDR, in which a serovar Afula harbored bla_CTX-M-55 and a serovar Uganda had both bla_TEM-1 and bla_CTX-M-55, while a serovar Schwarzengrunt contained none of these genes.

Similar to S. enterica, a small proportion of E. coli isolates (1.0%, n = 4/392) exhibited ESBL production, with one isolate from organically-grown commodities (1.0%, n = 1/98, sweet basil), two isolates from conventionally-grown commodities (1.7%, n = 2/115, spring onion and coriander) from a supermarket, and one conventionally-grown cabbage (0.6%, n = 1/179) from a fresh market (Fig. 1B). Two E. coli isolated from sweet basil and cabbage that produced ESBL were MDR. Based on the nucleotide sequence, the two ESBL-producing E. coli isolates of spring onion and coriander collected from supermarkets carried bla_CTX-M-55 and bla_CTX-M-15, respectively. Furthermore, an E. coli isolate from a fresh market tomato, which did not produce ESBL, contained bla_CTX-M-55 (Table 7).

3.4. Occurrence of virulence genes, ICEs, and class 1, 2, and 3 integrons

All S. enterica isolates harbored spvR (100.0%), followed by invA (98.3%) and fimA (98.3%), while stn (1.7%) was the least detected gene (Table 6). None of the E. coli isolates had detectable stx1 and stx2 (Table 7). The presence of int1 was observed in two isolates of S. enterica (3.4%) and 27 isolates of E. coli (6.9%) (Table 6, Table 7). None of these S. enterica and isolates E. coli contained ICEs (int_sxt) and integrons (int2 and int3).

3.5. Associations between AMR phenotype and genotype

The association between the AMR phenotype and genotype, virulence factors, the production of ESBL, and resistance determinants was examined separately among S. enterica and E. coli isolates. The dependent variable (outcome) was the presence or absence of tetracycline resistance based on its high prevalence among these isolates of S. enterica and E. coli. The odds of resistance to tetracycline among isolates of S. enterica were positively associated with the co-occurrence of ampicillin resistance (OR = 5.01, P = 0.001) and the presence of tetB (OR = 5.01, P = 0.001) (Table 9). The odds of resistance to tetracycline among isolates of E. coli were positively associated with ampicillin resistance (OR = 3.64, P < 0.0001), streptomycin resistance (OR = 5.45, P < 0.0001), and the presence of tetA (OR = 6.75, P < 0.0001) (Table 9).

Table 9.

Multivariate logistic regression of factors associated with tetracycline resistance in S. enterica (n = 59) and E. coli (n = 392) isolates.

Predictor	Odds ratio	Std. Err.^a	95% C.I.^b	P - value
S. enterica
Ampicillin resistance	5.01	1.53	2.00–8.02	0.001
tetB	5.01	1.53	2.00–8.02	0.001
Constant	−3.9	1.01	−5.89 – (−1.93)	<0.0001
AIC^c	24.84
*E. coli*
Ampicillin resistance	3.64	0.83	2.01–5.27	<0.0001
Streptomycin resistance	5.45	1.30	2.90–8.00	<0.0001
tetA	6.75	1.17	4.45–9.04	<0.0001
Constant	−4.65	0.58	−5.79 – (−3.51)	<0.0001
AIC^c	65.32

Open in a new tab

Std. Err.: Standard Error.

C.I.: Confidence Interval.

AIC: Akaike Information Criteria.

4. Discussion

4.1. AMR and its determinants, virulence factors, and semi-quantitative analysis

This study has demonstrated the occurrence of virulence factors, AMR, ESBL production, and resistance determinants among S. enterica and E. coli isolated from fresh vegetables and fruits from retail markets throughout Bangkok, Thailand. Approximately 50% of resistant S. enterica and E. coli isolates exhibited MDR. While previous study by Srisamran et al. [19] indicated a higher occurrence of E. coli contamination in fresh market samples compared to those from supermarkets, a relatively comparable prevalence of AMR and MDR E. coli was observed in samples from both types of markets. With respect to S. enterica isolated from these two retail venues, the prevalence of AMR was over 2-times higher in isolates from fresh market samples (21.6%) compared to isolates from supermarket samples (9.1%), with the prevalence of MDR similarly higher in fresh market samples (8.1%) compared to isolates from supermarket samples (4.5%). This suggests that the levels of AMR and MDR in E. coli were not significantly affected by the source of fresh fruits and vegetables. Nevertheless, the phenotypic AMR in Salmonella isolated from fresh markets was approximately twice as high as that found in supermarkets. Multiple processes of AMR contamination can operate at either the production field level (e.g., runoff from agricultural lands, irrigation water supplies contaminated with AMR bacteria from domestic or municipal sewage, use of unprocessed livestock manure as soil amendment), during processing and distribution (e.g., rodent fecal contamination of storage bins, inadequate personal hygiene of packers), or during retail display (e.g., fecal contamination of display cases, excessive handling by consumers) [5,[46], [47], [48]]. Given that the arithmetic mean concentration of E. coli eluted from the surface of fresh fruits and vegetables from supermarkets and fresh markets grown under conventional conditions was 5.3 × 10⁵ and 1.1 × 10³ MPN/g [19], combined with the observation that 15–25% of these E. coli isolates were either AMR or MDR, there is ample opportunity for human exposure and potential oral consumption of these resistant bacteria from Bangkok's retail distribution of fresh fruits and vegetables. Exposure to AMR S. enterica, especially with isolates that harbor one more virulence genes, further heightens the public health and food safety concern when consuming produce items either raw or minimally washed, as can often occur in popular dishes of Thai cuisine.

In this study, the most common resistance phenotype exhibited by S. enterica was tetracycline (11.9%), with a median MIC between 128 and 256 $μ$ g/mL. This relatively high MIC value is at least three times higher than the clinical breakpoint of 16 μg/mL for tetracycline, indicating that infection by these AMR bacteria may cause a failure of tetracycline treatment. However, a low prevalence of resistance (<10%) was observed for many of the antimicrobials tested in this study, including streptomycin, ampicillin, sulfamethoxazole, trimethoprim, chloramphenicol, gentamicin, and ciprofloxacin. During the past decade, MDR salmonellosis has been considered endemic in many developing countries, especially South-central and Southeast Asia [49]. In the same study, resistance to ampicillin, chloramphenicol, and trimethoprim-sulfamethoxazole has been reported to lead to the use of FQs (e.g., ciprofloxacin) as an alternative antimicrobial for the treatment of human salmonellosis. In this study, only 1.7% of S. enterica isolates were resistant to ciprofloxacin, which was isolated from conventional coriander collected from a fresh market. Although there was a low prevalence of resistance to ciprofloxacin, the median MIC was 16 $μ$ g/mL, which was four times higher than the clinical breakpoint. Similarly, the MICs of Salmonella isolates resistant to chloramphenicol, ampicillin, trimethoprim, and sulfamethoxazole were 3, 3–5, 7, and 4 times higher than the susceptible cutoff point. This finding indicates that human and animal infection with these AMR S. enterica could pose a serious health threat and lead to failure of treatment due to the limited choices of effective antimicrobials.

In this study, it was observed that E. coli isolates showed significant resistance to tetracycline (22.5%) and ampicillin (21.4%), with median MIC values 3 times higher for tetracycline and 4–5 times higher for ampicillin compared to the cutoff values. This finding was consistent with previous studies in fresh produce whereby the majority of AMR was against tetracycline and ampicillin [48,50]. Resistance to tetracycline and ampicillin has been commonly reported in livestock and in environmental samples [46,51,52]. Therefore, it is not surprising to find these resistant bacteria circulating in the environment and capable of contaminating fresh fruits and vegetables. Furthermore, these two antimicrobials are classified as Highly Important Antimicrobials (HIA) by the World Health Organization (WHO) and Veterinary Critically Important Antimicrobial Agents (VCIA) by the World Organization for Animal Health (OIE) [53,54], implying the health threats posed by AMR for One Health (human, animal, and environmental health).

It should be noted that chloramphenicol is one of the prohibited antimicrobials in food-producing animals according to the regulations of the Ministry of Agriculture and Cooperatives of Thailand [55]. However, this study found a prevalence of chloramphenicol resistance of 3.4% in Salmonella and 5.8% in E. coli, with median MIC values between 64 and 256 $μ$ g/mL, which was higher than the clinical breakpoint, and all chloramphenicol resistant isolates were MDR. Furthermore, the cmlA and floR genes that encode for chloramphenicol resistance were detected in more than half of all resistant isolates (56% in Salmonella and 84% in E. coli), which also coexist with int1 gene (56%). The cassette-borne cmlA group is commonly associated with MDR integrons or transposons in a range of enteric genera. Additionally, the independent acquisition of mobile elements carrying cat, cmlA, floR, or cfr genes can result in the simultaneous presence of multiple types of phenicol resistance genes within the same bacteria, even in cases where the use of chloramphenicol in food-producing animals is limited [56,57].

4.2. ESBL-producing isolates and their genotype

ESBL-producing bacteria are of increasing public health concern, with these bacteria among the most important causes of nosocomial and community-acquired infections [58]. ESBL genes can spread through horizontal gene transfer, which may harbor additional AMR genes [46]. In contrast to prior research, the occurrence of ESBL-producing bacteria in fresh fruits and vegetables was lower in this study [2,17,59]. Furthermore, bla_CTX-M was the only ESBL gene detected in this study and bla_CTX-M-55 (n = 4/7) was the most common CTX-M group 1. CTX-M-55 has been increasingly observed from different isolates from humans, livestock and the environment in many Asian countries, including Thailand [52,60,61]. CTX-M-55 is a derivative of CTX-M-15, where CTX-M-55 has a single amino acid substitution (Ala77Val) that causes increased activity against ceftazidime [62]. Furthermore, in this study, one of the ESBL producing S. enterica isolates harbored bla_CTX-M-55 that co-occurred with bla_TEM-1. More importantly, most of the isolates with bla_CTX-M-55 were MDR (n = 3/4). A S. enterica isolate from conventional sweet basil in a fresh market containing bla_CTX-M-55 also contained TEM1 and int1, which was similar with a previous study reporting CTX-M-55 isolated from vegetables in northern Thailand [18]. In general, this study indicated that vegetables may be a source of human exposure to bacteria producing ESBL. The origins of ESBL-producing bacterial isolates are likely due to processes such as contamination from organic manure commonly used in agriculture, fecal contamination through irrigation water, agricultural runoff, or dispersal of human sewage [11,63]. Due to the complexity of environmental dissemination for ESBL-producing bacteria, further investigation by examining potential sources of contamination, such as water, soil, contact surfaces, and animals, and using molecular techniques to track dissemination of these bacteria should be performed using a One Health approach.

4.3. QRDR mutations

Quinolone resistance is commonly mediated by mutations in the QRDR of gyrA and parC. In this study, six out of eight ciprofloxacin-resistant E. coli isolates carried a double mutation of Ser83Leu and Asp87Asn in the gyrA mutation with a high MIC level, while two isolates carried a single Ser83Leu mutation in gyrA which had a lower MIC level than a double mutation of gyrA. The isolate resistant to ciprofloxacin at 1 $μ$ g/mL did not carry any mutation in parC, but a single Ser80Ile parC mutation was resistant at 4–16 $μ$ g/mL and a double mutation of Ser80Ile and Glu84Gly in parC was found in isolates resistant at 16–32 $μ$ g/mL. This implies that a single mutation in gyrA can generate resistance to quinolones, but additional mutations in gyrA and/or parC are needed for high-level resistance to ciprofloxacin, which is in agreement with a previous work [52].

4.4. int1 gene with MDR phenotype

The class 1 integron (int1) is one of the most common mobile genetic elements that can transfer the resistance genotype to its variable regions or between bacterial species. This element has been suggested to be an indicator of AMR monitoring for the occurrence and removal efficiency of AMR genes in wastewater due to its positive association with the resistance genes. This is because int1 was strongly correlated with human pathogens and a large number of resistance genes [64]. Although the isolates in this collection harbored int1 with low prevalence, greater than 80% and 95% of int1 positive isolates were MDR. Our data suggests that int1 may be critical for monitoring AMR in the environment, especially for the MDR phenotype. This gene should be added as a target resistance determinant for observation of MDR bacteria under the One Health paradigm.

4.5. Associations between AMR phenotype and genotype

This study addressed the association between the AMR phenotype and genotype based on logistic regression models. The odds of tetracycline resistance for these S. enterica isolates were five-times higher if the isolate was also resistant to ampicillin (OR = 5.0) or carried the tetB gene (OR = 5.0). A similar association was observed in E. coli; the odds of tetracycline resistance was 6.8-times higher if the isolate carried the tetA gene. In addition, the odds for tetracycline resistance was 3.6-times and 5.5-times higher for isolates of E. coli that were also resistant to ampicillin or streptomycin, respectively. This finding indicates that there was close association with or mechanisms of co-selection for resistance to tetracycline, ampicillin, and streptomycin. This co-occurrence of resistance may be the result of mobile genetic elements such as integrons and plasmids, which are important routes of AMR genomic transfer between bacteria. Associations of genes that encode resistance against several important antimicrobial classes, including aminoglycosides, β-lactams, phenicols, quinolones, tetracyclines and sulfonamides, has been previously consistently reported.

5. Conclusion

This study is the first report on semi-quantitative analysis of phenotypic and genotypic AMR on the surface of raw vegetables and fruits from open-air fresh markets and supermarkets throughout Bangkok, Thailand. These epidemiological data on bacterial AMR can be used for risk assessments of AMR contamination in raw produce and also help establish a baseline of contamination to then quantify future trends of AMR contamination subsequent to monitoring and surveillance. Recently, Thailand's national strategic plan for 2017–2022 established an AMR surveillance system under the One Health approach that will standardize and harmonize AMR surveillance protocols in human, animal, food, and environmental sectors, including crop production (e.g., vegetables and fruits). The occurrence of E. coli and S. enterica that harbored bla_CTX-M-55 with MDR indicates the possible foodborne transmission of AMR and MDR bacteria from fresh produce to humans, especially for produce commodities consume raw or minimally processed. It might be prudent to further investigate the dynamics of bacterial AMR dissemination and persistence in other environmental settings to prevent the spread of resistant E. coli and S. enterica, and in addition, practice safe hygiene, washing raw vegetables before consumption, and avoiding excessive use of antimicrobials in human and animal health to help prevent the spread of AMR.

Data availability statement

Data will be made available on request.

CRediT authorship contribution statement

Benjawan Saechue: Writing – original draft, Validation, Methodology, Formal analysis. Edward R. Atwill: Writing – review & editing, Supervision, Software. Saharuetai Jeamsripong: Writing – review & editing, Writing – original draft, Validation, Supervision, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization.

Declaration of competing interest

The authors declare no conflict of interest.

Acknowledgements

This study was supported by the University of California Davis, United States (A18-1020-S001); Second Century Fund (C2F), Chulalongkorn University, Thailand; National Research Council of Thailand, Thailand (Project ID N42A660897).

References

1.Abatcha M.G., Effarizah M.E., Rusul G. Antibiotic susceptibility and molecular characterization of Salmonella enterica serovar Paratyphi B isolated from vegetables and processing environment in Malaysia. Int. J. Food Microbiol. 2019;290:180–183. doi: 10.1016/j.ijfoodmicro.2018.09.021. [DOI] [PubMed] [Google Scholar]
2.Sapkota S., Adhikari S., Pandey A., Khadka S., Adhikari M., Kandel H., Pathak S., Pandey A. Multi-drug resistant extended-spectrum beta-lactamase producing E. coli and Salmonella on raw vegetable salads served at hotels and restaurants in Bharatpur, Nepal. BMC Res. Notes. 2019;12(1):516. doi: 10.1186/s13104-019-4557-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Mwanza F., Komba E.V.G., Kambarage D.M. Occurrence and determination of antimicrobial resistant Escherichia coli isolates in fish and vegetables as indicator organism of faecal contamination in Dar es Salaam, Tanzania. Int. J. Microbiol. 2021;2021 doi: 10.1155/2021/6633488. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.FAO . FAO; Bangkok, Thailand: 2019. Monitoring and Surveillance of Antimicrobial Resistance in Bacteria from Healthy Food Animals Intended for Consumption. [Google Scholar]
5.Rahman M., Alam M.U., Luies S.K., Kamal A., Ferdous S., Lin A., Sharior F., Khan R., Rahman Z., Parvez S.M., Amin N., Hasan R., Tadesse B.T., Taneja N., Islam M.A., Ercumen A. Contamination of fresh produce with antibiotic-resistant bacteria and associated risks to human health: a scoping review. Int. J. Environ. Res. Public Health. 2021;19(1) doi: 10.3390/ijerph19010360. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Phodha T., Riewpaiboon A., Malathum K., Coyte P. Annual relative increased in inpatient mortality from antimicrobial resistant nosocomial infections in Thailand. Epidemiol. Infect. 2019;147(e133) doi: 10.1017/s0950268818003436. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Majowicz S.E., Musto J., Scallan E., Angulo F.J., Kirk M., O’Brien S.J., Jones T.F., Fazil A., Hoekstra R.M., International Collaboration on Enteric Disease “Burden of Illness” Studies The global burden of nontyphoidal Salmonella gastroenteritis. Clin. Infect. Dis. 2010;50(6):882–889. doi: 10.1086/650733. [DOI] [PubMed] [Google Scholar]
8.Reddy S.P., Wang H., Adams J.K., Feng P.C. Prevalence and characteristics of Salmonella serotypes isolated from fresh produce marketed in the United States. J. Food Prot. 2016;79(1):6–16. doi: 10.4315/0362-028x.jfp-15-274. [DOI] [PubMed] [Google Scholar]
9.Kuan C., Rukayadi Y., Ahmad S., Radzi W.C.M., Kuan C., Yeo S., Thung T., New C., Chang W., Loo Y. Antimicrobial resistance of Listeria monocytogenes and Salmonella Enteritidis isolated from vegetable farms and retail markets in Malaysia. Int. Food Res. J. 2017;24(4):1831–1839. [Google Scholar]
10.Nguyen D.T.A., Awasthi S.P., Hoang P.H., Nguyen P.D., Jayedul H., Hatanaka N., Hinenoya A., Van Dang C., Faruque S.M., Yamasaki S. Prevalence, serovar, and antimicrobial resistance of nontyphoidal Salmonella in vegetable, fruit, and water samples in Ho Chi Minh City, Vietnam, Foodborne. Pathog. Dis. 2021;18(5):354–363. doi: 10.1089/fpd.2020.2891. [DOI] [PubMed] [Google Scholar]
11.Araujo S., Silva I.A., Tacão M., Patinha C., Alves A., Henriques I. Characterization of antibiotic resistant and pathogenic Escherichia coli in irrigation water and vegetables in household farms. Int. J. Food Microbiol. 2017;257:192–200. doi: 10.1016/j.ijfoodmicro.2017.06.020. [DOI] [PubMed] [Google Scholar]
12.Kawamura K., Nagano N., Suzuki M., Wachino J.-i., Kimura K., Arakawa Y. ESBL-producing Escherichia coli and its rapid rise among healthy people. Food Safety. 2017;5(4):122–150. doi: 10.14252/foodsafetyfscj.2017011. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Paterson D.L., Bonomo R.A. Extended-spectrum beta-lactamases: a clinical update. Clin. Microbiol. Rev. 2005;18(4):657–686. doi: 10.1128/cmr.18.4.657-686.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Correia S., Poeta P., Hebraud M., Capelo J.L., Igrejas G. Mechanisms of quinolone action and resistance: where do we stand? J. Med. Microbiol. 2017;66(5):551–559. doi: 10.1099/jmm.0.000475. [DOI] [PubMed] [Google Scholar]
15.Hooper D.C., Jacoby G.A. Mechanisms of drug resistance: quinolone resistance. Ann. N. Y. Acad. Sci. 2015;1354(1):12–31. doi: 10.1111/nyas.12830. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Chanseyha C., Sadiq M.B., Cho T.Z.A., Anal A.K. Prevalence and analysis of antibiotic resistant genes in Escherichia coli and Salmonella isolates from green leaf lettuce. Chiang Mai J. Sci. 2018;45:1274–1286. http://cmuir.cmu.ac.th/jspui/handle/6653943832/64112 [Google Scholar]
17.Romyasamit C., Sornsenee P., Chimplee S., Yuwalaksanakun S., Wongprot D., Saengsuwan P. Prevalence and characterization of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolated from raw vegetables retailed in Southern Thailand. PeerJ. 2021;9 doi: 10.7717/peerj.11787. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Chotinantakul K., Woottisin S., Okada S. The Emergence of CTX-M-55 in extended-spectrum beta-lactamase-producing Escherichia coli from vegetables sold in local markets of northern Thailand. Jpn. J. Infect. Dis. 2022;75(3):296–301. doi: 10.7883/yoken.jjid.2021.139. [DOI] [PubMed] [Google Scholar]
19.Srisamran J., Atwill E.R., Chuanchuen R., Jeamsripong S. Detection and analysis of indicator and pathogenic bacteria in conventional and organic fruits and vegetables sold in retail markets. Food Qual. Saf. 2022;6 doi: 10.1093/fqsafe/fyac013. [DOI] [Google Scholar]
20.Andrews W.H., Jacobson A., Hammack T. Bacteriological analytical manual (BAM) chapter 5: Salmonella. Bacteriological Analytical Manual. 2018;110 [Google Scholar]
21.Grimont P.A., Weill F.-X. Institute Pasteur; France: 2007. Antigenic Formulae of the Salmonella Serovars, WHO Collaborating Centre for Reference and Research on Salmonella. [Google Scholar]
22.CLSI . 31st editionM100. Wayne; USA: 2021. Performance Standards for Antimicrobial Susceptibility Testing. [Google Scholar]
23.Ahmed O.B., Dablool A. Quality improvement of the DNA extracted by boiling method in gram negative bacteria. Int. J. Bioassays. 2017;6(4):5347–5349. [Google Scholar]
24.Kozak G.K., Boerlin P., Janecko N., Reid-Smith R.J., Jardine C. Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl. Environ. Microbiol. 2009;75(3):559–566. doi: 10.1128/AEM.01821-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Li R., Lai J., Wang Y., Liu S., Li Y., Liu K., Shen J., Wu C. Prevalence and characterization of Salmonella species isolated from pigs, ducks and chickens in Sichuan Province, China. Int. J. Food Microbiol. 2013;163(1):14–18. doi: 10.1016/j.ijfoodmicro.2013.01.020. [DOI] [PubMed] [Google Scholar]
26.Chuanchuen R., Pathanasophon P., Khemtong S., Wannaprasat W., Padungtod P. Susceptibilities to antimicrobials and disinfectants in Salmonella isolates obtained from poultry and swine in Thailand. J. Vet. Med. Sci. 2008;70(6):595–601. doi: 10.1292/jvms.70.595. [DOI] [PubMed] [Google Scholar]
27.Ying Y., Wu F., Wu C., Jiang Y., Yin M., Zhou W., Zhu X., Cheng C., Zhu L., Li K. Florfenicol resistance in Enterobacteriaceae and whole-genome sequence analysis of florfenicol-resistant Leclercia adecarboxylata strain R25. Int. J. Genomics. 2019;2019 doi: 10.1155/2019/9828504. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Yin Y., Zhu D., Yang G., Su J., Duan G. Diverse antibiotic resistance genes and potential pathogens inhabit in the phyllosphere of fresh vegetables. Sci. Total Environ. 2022;815 doi: 10.1016/j.scitotenv.2021.152851. [DOI] [PubMed] [Google Scholar]
29.Shahrani M., Dehkordi F.S., Momtaz H. Characterization of Escherichia coli virulence genes, pathotypes and antibiotic resistance properties in diarrheic calves in Iran. Biol. Sci. 2014;47(1):1–13. doi: 10.1186/0717-6287-47-28. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Kadlec K., Kehrenberg C., Schwarz S. Molecular basis of resistance to trimethoprim, chloramphenicol and sulphonamides in Bordetella bronchiseptica. J. Antimicrob. Chemother. 2005;56(3):485–490. doi: 10.1093/jac/dki262. [DOI] [PubMed] [Google Scholar]
31.Hinthong W., Pumipuntu N., Santajit S., Kulpeanprasit S., Buranasinsup S., Sookrung N., Chaicumpa W., Aiumurai P., Indrawattana N. Detection and drug resistance profile of Escherichia coli from subclinical mastitis cows and water supply in dairy farms in Saraburi Province, Thailand. PeerJ. 2017;5 doi: 10.7717/peerj.3431. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Stedtfeld R.D., Guo X., Stedtfeld T.M., Sheng H., Williams M.R., Hauschild K., Gunturu S., Tift L., Wang F., Howe A., Chai B., Yin D., Cole J.R., Tiedje J.M., Hashsham S.A. Primer set 2.0 for highly parallel qPCR array targeting antibiotic resistance genes and mobile genetic elements. FEMS Microbiol. Ecol. 2018;94(9) doi: 10.1093/femsec/fiy130. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Cattoir V., Poirel L., Rotimi V., Soussy C.-J., Nordmann P. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother. 2007;60(2):394–397. doi: 10.1093/jac/dkm204. [DOI] [PubMed] [Google Scholar]
34.Khan S.B., Khan M.A., Ahmad I., ur Rehman T., Ullah S., Dad R., Sultan A., Memon A.M. Phentotypic, gentotypic antimicrobial resistance and pathogenicity of Salmonella enterica serovars Typimurium and Enteriditis in poultry and poultry products. Microb. Pathog. 2019;129:118–124. doi: 10.1016/j.micpath.2019.01.046. [DOI] [PubMed] [Google Scholar]
35.Rebelo A.R., Bortolaia V., Kjeldgaard J.S., Pedersen S.K., Leekitcharoenphon P., Hansen I.M., Guerra B., Malorny B., Borowiak M., Hammerl J.A. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Euro Surveill. 2018;23(6):17–672. doi: 10.2807/1560-7917.es.2018.23.6.17-00672. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Poirel L., Walsh T.R., Cuvillier V., Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011;70(1):119–123. doi: 10.1016/j.diagmicrobio.2010.12.002. [DOI] [PubMed] [Google Scholar]
37.Costa D., Poeta P., Sáenz Y., Coelho A.C., Matos M., Vinué L., Rodrigues J., Torres C. Prevalence of antimicrobial resistance and resistance genes in faecal Escherichia coli isolates recovered from healthy pets. Vet. Microbiol. 2008;127(1–2):97–105. doi: 10.1016/j.vetmic.2007.08.004. [DOI] [PubMed] [Google Scholar]
38.Hasman H., Mevius D., Veldman K., Olesen I., Aarestrup F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005;56(1):115–121. doi: 10.1093/jac/dki190. [DOI] [PubMed] [Google Scholar]
39.Batchelor M., Hopkins K., Threlfall E., Clifton-Hadley F., Stallwood A., Davies R., Liebana E. blaCTX-M genes in clinical Salmonella isolates recovered from humans in England and Wales from 1992 to 2003, Antimicrob. Agents Chemother. 2005;49(4):1319–1322. doi: 10.1128/aac.49.4.1319-1322.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Gomaa F.A.M., Helal Z.H., Khan M.I. High Prevalence of blaNDM-1, blaVIM, qacE, and qacEΔ1 genes and their association with decreased susceptibility to antibiotics and common hospital biocides in clinical isolates of Acinetobacter baumannii. Microorganisms. 2017;5(2):18. doi: 10.3390/microorganisms5020018. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Kitiyodom S., Khemtong S., Wongtavatchai J., Chuanchuen R. Characterization of antibiotic resistance in Vibrio spp. isolated from farmed marine shrimps (Penaeus monodon) FEMS Microbiol. Ecol. 2010;72(2):219–227. doi: 10.1111/j.1574-6941.2010.00846.x. [DOI] [PubMed] [Google Scholar]
42.Pal A., Ghosh S., Ramamurthy T., Yamasaki S., Tsukamoto T., Bhattacharya S.K., Nair G.B., Takeda Y. Shiga-toxin producing Escherichia coli from healthy cattle in a semi-urban community in Calcutta, India. Indian J. Med. Res. 1999;110:83–85. [PubMed] [Google Scholar]
43.Chaudhary J., Nayak J., Brahmbhatt M., Makwana P. Virulence genes detection of Salmonella serovars isolated from pork and slaughterhouse environment in Ahmedabad, Gujarat, Vet. World. 2015;8(1):121. doi: 10.14202/vetworld.2015.121-124. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Chuanchuen R., Padungtod P. Antimicrobial resistance genes in Salmonella enterica isolates from poultry and swine in Thailand. J. Vet. Med. Sci. 2009;71(10):1349–1355. doi: 10.1292/jvms.001349. [DOI] [PubMed] [Google Scholar]
45.Tamura K., Stecher G., Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021;38(7):3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Bandyopadhyay S., Samanta I. Antimicrobial resistance in agri-food chain and companion animals as a re-emerging menace in post-COVID epoch: low-and middle-income countries perspective and mitigation strategies. Front. Vet. Sci. 2020;7:620. doi: 10.3389/fvets.2020.00620. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Marti R., Scott A., Tien Y.-C., Murray R., Sabourin L., Zhang Y., Topp E. Impact of manure fertilization on the abundance of antibiotic-resistant bacteria and frequency of detection of antibiotic resistance genes in soil and on vegetables at harvest. Appl. Environ. Microbiol. 2013;79(18):5701–5709. doi: 10.1128/aem.01682-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Shah M.S., Eppinger M., Ahmed S., Shah A.A., Hameed A., Hasan F. Multidrug-resistant diarrheagenic E. coli pathotypes are associated with ready-to-eat salad and vegetables in Pakistan. J. Korean Soc. Appl. Biol. Chem. 2015;58(2):267–273. doi: 10.1007/s13765-015-0019-9. [DOI] [Google Scholar]
49.Crump J.A., Sjolund-Karlsson M., Gordon M.A., Parry C.M. Epidemiology, clinical presentation, laboratory diagnosis, antimicrobial resistance, and antimicrobial management of invasive Salmonella infections. Clin. Microbiol. Rev. 2015;28(4):901–937. doi: 10.1128/cmr.00002-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Li Y., Zhang M., Luo J., Chen J., Wang Q., Lu S., Ji H. Antimicrobial resistance of Escherichia coli isolated from retail foods in northern Xinjiang, China. Food Sci. Nutr. 2020;8(4):2035–2051. doi: 10.1002/fsn3.1491. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Wu X., Angkititrakul S., Richards A.L., Pulsrikarn C., Khaengair S., Keosengthong A., Siriwong S., Suksawat F. Risk of antimicrobial resistant non-typhoidal Salmonella during asymptomatic infection passage between pet dogs and their human caregivers in Khon Kaen, Thailand. Antibiotics. 2020;9(8):477. doi: 10.3390/antibiotics9080477. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Pungpian C., Sinwat N., Angkititrakul S., Prathan R., Chuanchuen R. Presence and transfer of antimicrobial resistance determinants in Escherichia coli in pigs, pork, and humans in Thailand and Lao PDR Border provinces. Microb. Drug Resist. 2021;27(4):571–584. doi: 10.1089/mdr.2019.0438. [DOI] [PubMed] [Google Scholar]
53.World Organisation for Animal Health OIE list of antimicrobial agents of veterinary importance. OIE International Committee. 2015;33:1–9. [Google Scholar]
54.World Health Organisation WHO guidelines on use of medically important antimicrobials in food-producing animals. Antimicrob. Resist. Infect. Control. 2017;7:1–8. doi: 10.1186/s13756-017-0294-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Department of Livestock Development Ministry of Agriculture and Cooperatives. Notification of the Department of Livestock Development: specify materials which not allowed to be used as ingredients in animal feed. 2016. https://legal.dld.go.th/web2012/news/P15/13318220159.pdf [internet]. Available from: (in Thai)
56.Roberts M.C., Schwarz S. Tetracycline and phenicol resistance genes and mechanisms: importance for agriculture, the environment, and humans. J. Environ. Qual. 2016;45(2):576–592. doi: 10.2134/jeq2015.04.0207. [DOI] [PubMed] [Google Scholar]
57.Partridge S.R., Kwong S.M., Firth N., Jensen S.O. Mobile genetic elements associated with antimicrobial resistance. Clin. Microbiol. Rev. 2018;31(4):10–1128. doi: 10.1128/cmr.00088-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Nji E., Kazibwe J., Hambridge T., Joko C.A., Larbi A.A., Damptey L.A.O., Nkansa-Gyamfi N.A., Stålsby Lundborg C., Lien L.T.Q. High prevalence of antibiotic resistance in commensal Escherichia coli from healthy human sources in community settings. Sci. Rep. 2021;11(1):3372. doi: 10.1038/s41598-021-82693-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Richter L., Du Plessis E.M., Duvenage S., Korsten L. Occurrence, identification, and antimicrobial resistance profiles of extended-spectrum and AmpC β-lactamase-producing Enterobacteriaceae from fresh vegetables retailed in Gauteng Province, South Africa. Foodborne Pathog. Dis. 2019;16(6):421–427. doi: 10.1089/fpd.2018.2558. [DOI] [PubMed] [Google Scholar]
60.Tansawai U., Walsh T.R., Niumsup P.R. Extended spectrum ß-lactamase-producing Escherichia coli among backyard poultry farms, farmers, and environments in Thailand. Poult. Sci. 2019;98(6):2622–2631. doi: 10.3382/ps/pez009. [DOI] [PubMed] [Google Scholar]
61.Trongjit S., Assavacheep P., Samngamnim S., My T.H., An V.T.T., Simjee S., Chuanchuen R. Plasmid-mediated colistin resistance and ESBL production in Escherichia coli from clinically healthy and sick pigs. Sci. Rep. 2022;12(1):2466. doi: 10.1038/s41598-022-06415-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Kiratisin P., Apisarnthanarak A., Saifon P., Laesripa C., Kitphati R., Mundy L.M. The emergence of a novel ceftazidime-resistant CTX-M extended-spectrum beta-lactamase, CTX-M-55, in both community-onset and hospital-acquired infections in Thailand, Diagn. Microbiol. Infect. Dis. 2007;58(3):349–355. doi: 10.1016/j.diagmicrobio.2007.02.005. [DOI] [PubMed] [Google Scholar]
63.Eltai N.O., Al Thani A.A., Al-Ansari K., Deshmukh A.S., Wehedy E., Al-Hadidi S.H., Yassine H.M. Molecular characterization of extended spectrum beta-lactamases Enterobacteriaceae causing lower urinary tract infection among pediatric population. Antimicrob. Resist. Infect. Control. 2018;7(90) doi: 10.1186/s13756-018-0381-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Zheng W., Huyan J., Tian Z., Zhang Y., Wen X. Clinical class 1 integron-integrase gene–a promising indicator to monitor the abundance and elimination of antibiotic resistance genes in an urban wastewater treatment plant. Environ. Int. 2020;135 doi: 10.1016/j.envint.2019.105372. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be made available on request.

[bib1] 1.Abatcha M.G., Effarizah M.E., Rusul G. Antibiotic susceptibility and molecular characterization of Salmonella enterica serovar Paratyphi B isolated from vegetables and processing environment in Malaysia. Int. J. Food Microbiol. 2019;290:180–183. doi: 10.1016/j.ijfoodmicro.2018.09.021. [DOI] [PubMed] [Google Scholar]

[bib2] 2.Sapkota S., Adhikari S., Pandey A., Khadka S., Adhikari M., Kandel H., Pathak S., Pandey A. Multi-drug resistant extended-spectrum beta-lactamase producing E. coli and Salmonella on raw vegetable salads served at hotels and restaurants in Bharatpur, Nepal. BMC Res. Notes. 2019;12(1):516. doi: 10.1186/s13104-019-4557-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib3] 3.Mwanza F., Komba E.V.G., Kambarage D.M. Occurrence and determination of antimicrobial resistant Escherichia coli isolates in fish and vegetables as indicator organism of faecal contamination in Dar es Salaam, Tanzania. Int. J. Microbiol. 2021;2021 doi: 10.1155/2021/6633488. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib4] 4.FAO . FAO; Bangkok, Thailand: 2019. Monitoring and Surveillance of Antimicrobial Resistance in Bacteria from Healthy Food Animals Intended for Consumption. [Google Scholar]

[bib5] 5.Rahman M., Alam M.U., Luies S.K., Kamal A., Ferdous S., Lin A., Sharior F., Khan R., Rahman Z., Parvez S.M., Amin N., Hasan R., Tadesse B.T., Taneja N., Islam M.A., Ercumen A. Contamination of fresh produce with antibiotic-resistant bacteria and associated risks to human health: a scoping review. Int. J. Environ. Res. Public Health. 2021;19(1) doi: 10.3390/ijerph19010360. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib6] 6.Phodha T., Riewpaiboon A., Malathum K., Coyte P. Annual relative increased in inpatient mortality from antimicrobial resistant nosocomial infections in Thailand. Epidemiol. Infect. 2019;147(e133) doi: 10.1017/s0950268818003436. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib7] 7.Majowicz S.E., Musto J., Scallan E., Angulo F.J., Kirk M., O’Brien S.J., Jones T.F., Fazil A., Hoekstra R.M., International Collaboration on Enteric Disease “Burden of Illness” Studies The global burden of nontyphoidal Salmonella gastroenteritis. Clin. Infect. Dis. 2010;50(6):882–889. doi: 10.1086/650733. [DOI] [PubMed] [Google Scholar]

[bib8] 8.Reddy S.P., Wang H., Adams J.K., Feng P.C. Prevalence and characteristics of Salmonella serotypes isolated from fresh produce marketed in the United States. J. Food Prot. 2016;79(1):6–16. doi: 10.4315/0362-028x.jfp-15-274. [DOI] [PubMed] [Google Scholar]

[bib9] 9.Kuan C., Rukayadi Y., Ahmad S., Radzi W.C.M., Kuan C., Yeo S., Thung T., New C., Chang W., Loo Y. Antimicrobial resistance of Listeria monocytogenes and Salmonella Enteritidis isolated from vegetable farms and retail markets in Malaysia. Int. Food Res. J. 2017;24(4):1831–1839. [Google Scholar]

[bib10] 10.Nguyen D.T.A., Awasthi S.P., Hoang P.H., Nguyen P.D., Jayedul H., Hatanaka N., Hinenoya A., Van Dang C., Faruque S.M., Yamasaki S. Prevalence, serovar, and antimicrobial resistance of nontyphoidal Salmonella in vegetable, fruit, and water samples in Ho Chi Minh City, Vietnam, Foodborne. Pathog. Dis. 2021;18(5):354–363. doi: 10.1089/fpd.2020.2891. [DOI] [PubMed] [Google Scholar]

[bib11] 11.Araujo S., Silva I.A., Tacão M., Patinha C., Alves A., Henriques I. Characterization of antibiotic resistant and pathogenic Escherichia coli in irrigation water and vegetables in household farms. Int. J. Food Microbiol. 2017;257:192–200. doi: 10.1016/j.ijfoodmicro.2017.06.020. [DOI] [PubMed] [Google Scholar]

[bib12] 12.Kawamura K., Nagano N., Suzuki M., Wachino J.-i., Kimura K., Arakawa Y. ESBL-producing Escherichia coli and its rapid rise among healthy people. Food Safety. 2017;5(4):122–150. doi: 10.14252/foodsafetyfscj.2017011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib13] 13.Paterson D.L., Bonomo R.A. Extended-spectrum beta-lactamases: a clinical update. Clin. Microbiol. Rev. 2005;18(4):657–686. doi: 10.1128/cmr.18.4.657-686.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib14] 14.Correia S., Poeta P., Hebraud M., Capelo J.L., Igrejas G. Mechanisms of quinolone action and resistance: where do we stand? J. Med. Microbiol. 2017;66(5):551–559. doi: 10.1099/jmm.0.000475. [DOI] [PubMed] [Google Scholar]

[bib15] 15.Hooper D.C., Jacoby G.A. Mechanisms of drug resistance: quinolone resistance. Ann. N. Y. Acad. Sci. 2015;1354(1):12–31. doi: 10.1111/nyas.12830. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib16] 16.Chanseyha C., Sadiq M.B., Cho T.Z.A., Anal A.K. Prevalence and analysis of antibiotic resistant genes in Escherichia coli and Salmonella isolates from green leaf lettuce. Chiang Mai J. Sci. 2018;45:1274–1286. http://cmuir.cmu.ac.th/jspui/handle/6653943832/64112 [Google Scholar]

[bib17] 17.Romyasamit C., Sornsenee P., Chimplee S., Yuwalaksanakun S., Wongprot D., Saengsuwan P. Prevalence and characterization of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolated from raw vegetables retailed in Southern Thailand. PeerJ. 2021;9 doi: 10.7717/peerj.11787. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib18] 18.Chotinantakul K., Woottisin S., Okada S. The Emergence of CTX-M-55 in extended-spectrum beta-lactamase-producing Escherichia coli from vegetables sold in local markets of northern Thailand. Jpn. J. Infect. Dis. 2022;75(3):296–301. doi: 10.7883/yoken.jjid.2021.139. [DOI] [PubMed] [Google Scholar]

[bib19] 19.Srisamran J., Atwill E.R., Chuanchuen R., Jeamsripong S. Detection and analysis of indicator and pathogenic bacteria in conventional and organic fruits and vegetables sold in retail markets. Food Qual. Saf. 2022;6 doi: 10.1093/fqsafe/fyac013. [DOI] [Google Scholar]

[bib20] 20.Andrews W.H., Jacobson A., Hammack T. Bacteriological analytical manual (BAM) chapter 5: Salmonella. Bacteriological Analytical Manual. 2018;110 [Google Scholar]

[bib21] 21.Grimont P.A., Weill F.-X. Institute Pasteur; France: 2007. Antigenic Formulae of the Salmonella Serovars, WHO Collaborating Centre for Reference and Research on Salmonella. [Google Scholar]

[bib22] 22.CLSI . 31st editionM100. Wayne; USA: 2021. Performance Standards for Antimicrobial Susceptibility Testing. [Google Scholar]

[bib23] 23.Ahmed O.B., Dablool A. Quality improvement of the DNA extracted by boiling method in gram negative bacteria. Int. J. Bioassays. 2017;6(4):5347–5349. [Google Scholar]

[bib24] 24.Kozak G.K., Boerlin P., Janecko N., Reid-Smith R.J., Jardine C. Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl. Environ. Microbiol. 2009;75(3):559–566. doi: 10.1128/AEM.01821-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib25] 25.Li R., Lai J., Wang Y., Liu S., Li Y., Liu K., Shen J., Wu C. Prevalence and characterization of Salmonella species isolated from pigs, ducks and chickens in Sichuan Province, China. Int. J. Food Microbiol. 2013;163(1):14–18. doi: 10.1016/j.ijfoodmicro.2013.01.020. [DOI] [PubMed] [Google Scholar]

[bib26] 26.Chuanchuen R., Pathanasophon P., Khemtong S., Wannaprasat W., Padungtod P. Susceptibilities to antimicrobials and disinfectants in Salmonella isolates obtained from poultry and swine in Thailand. J. Vet. Med. Sci. 2008;70(6):595–601. doi: 10.1292/jvms.70.595. [DOI] [PubMed] [Google Scholar]

[bib27] 27.Ying Y., Wu F., Wu C., Jiang Y., Yin M., Zhou W., Zhu X., Cheng C., Zhu L., Li K. Florfenicol resistance in Enterobacteriaceae and whole-genome sequence analysis of florfenicol-resistant Leclercia adecarboxylata strain R25. Int. J. Genomics. 2019;2019 doi: 10.1155/2019/9828504. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib28] 28.Yin Y., Zhu D., Yang G., Su J., Duan G. Diverse antibiotic resistance genes and potential pathogens inhabit in the phyllosphere of fresh vegetables. Sci. Total Environ. 2022;815 doi: 10.1016/j.scitotenv.2021.152851. [DOI] [PubMed] [Google Scholar]

[bib29] 29.Shahrani M., Dehkordi F.S., Momtaz H. Characterization of Escherichia coli virulence genes, pathotypes and antibiotic resistance properties in diarrheic calves in Iran. Biol. Sci. 2014;47(1):1–13. doi: 10.1186/0717-6287-47-28. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib30] 30.Kadlec K., Kehrenberg C., Schwarz S. Molecular basis of resistance to trimethoprim, chloramphenicol and sulphonamides in Bordetella bronchiseptica. J. Antimicrob. Chemother. 2005;56(3):485–490. doi: 10.1093/jac/dki262. [DOI] [PubMed] [Google Scholar]

[bib31] 31.Hinthong W., Pumipuntu N., Santajit S., Kulpeanprasit S., Buranasinsup S., Sookrung N., Chaicumpa W., Aiumurai P., Indrawattana N. Detection and drug resistance profile of Escherichia coli from subclinical mastitis cows and water supply in dairy farms in Saraburi Province, Thailand. PeerJ. 2017;5 doi: 10.7717/peerj.3431. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib32] 32.Stedtfeld R.D., Guo X., Stedtfeld T.M., Sheng H., Williams M.R., Hauschild K., Gunturu S., Tift L., Wang F., Howe A., Chai B., Yin D., Cole J.R., Tiedje J.M., Hashsham S.A. Primer set 2.0 for highly parallel qPCR array targeting antibiotic resistance genes and mobile genetic elements. FEMS Microbiol. Ecol. 2018;94(9) doi: 10.1093/femsec/fiy130. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib33] 33.Cattoir V., Poirel L., Rotimi V., Soussy C.-J., Nordmann P. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother. 2007;60(2):394–397. doi: 10.1093/jac/dkm204. [DOI] [PubMed] [Google Scholar]

[bib34] 34.Khan S.B., Khan M.A., Ahmad I., ur Rehman T., Ullah S., Dad R., Sultan A., Memon A.M. Phentotypic, gentotypic antimicrobial resistance and pathogenicity of Salmonella enterica serovars Typimurium and Enteriditis in poultry and poultry products. Microb. Pathog. 2019;129:118–124. doi: 10.1016/j.micpath.2019.01.046. [DOI] [PubMed] [Google Scholar]

[bib35] 35.Rebelo A.R., Bortolaia V., Kjeldgaard J.S., Pedersen S.K., Leekitcharoenphon P., Hansen I.M., Guerra B., Malorny B., Borowiak M., Hammerl J.A. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Euro Surveill. 2018;23(6):17–672. doi: 10.2807/1560-7917.es.2018.23.6.17-00672. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib36] 36.Poirel L., Walsh T.R., Cuvillier V., Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011;70(1):119–123. doi: 10.1016/j.diagmicrobio.2010.12.002. [DOI] [PubMed] [Google Scholar]

[bib37] 37.Costa D., Poeta P., Sáenz Y., Coelho A.C., Matos M., Vinué L., Rodrigues J., Torres C. Prevalence of antimicrobial resistance and resistance genes in faecal Escherichia coli isolates recovered from healthy pets. Vet. Microbiol. 2008;127(1–2):97–105. doi: 10.1016/j.vetmic.2007.08.004. [DOI] [PubMed] [Google Scholar]

[bib38] 38.Hasman H., Mevius D., Veldman K., Olesen I., Aarestrup F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005;56(1):115–121. doi: 10.1093/jac/dki190. [DOI] [PubMed] [Google Scholar]

[bib39] 39.Batchelor M., Hopkins K., Threlfall E., Clifton-Hadley F., Stallwood A., Davies R., Liebana E. blaCTX-M genes in clinical Salmonella isolates recovered from humans in England and Wales from 1992 to 2003, Antimicrob. Agents Chemother. 2005;49(4):1319–1322. doi: 10.1128/aac.49.4.1319-1322.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib40] 40.Gomaa F.A.M., Helal Z.H., Khan M.I. High Prevalence of blaNDM-1, blaVIM, qacE, and qacEΔ1 genes and their association with decreased susceptibility to antibiotics and common hospital biocides in clinical isolates of Acinetobacter baumannii. Microorganisms. 2017;5(2):18. doi: 10.3390/microorganisms5020018. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib41] 41.Kitiyodom S., Khemtong S., Wongtavatchai J., Chuanchuen R. Characterization of antibiotic resistance in Vibrio spp. isolated from farmed marine shrimps (Penaeus monodon) FEMS Microbiol. Ecol. 2010;72(2):219–227. doi: 10.1111/j.1574-6941.2010.00846.x. [DOI] [PubMed] [Google Scholar]

[bib42] 42.Pal A., Ghosh S., Ramamurthy T., Yamasaki S., Tsukamoto T., Bhattacharya S.K., Nair G.B., Takeda Y. Shiga-toxin producing Escherichia coli from healthy cattle in a semi-urban community in Calcutta, India. Indian J. Med. Res. 1999;110:83–85. [PubMed] [Google Scholar]

[bib43] 43.Chaudhary J., Nayak J., Brahmbhatt M., Makwana P. Virulence genes detection of Salmonella serovars isolated from pork and slaughterhouse environment in Ahmedabad, Gujarat, Vet. World. 2015;8(1):121. doi: 10.14202/vetworld.2015.121-124. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib44] 44.Chuanchuen R., Padungtod P. Antimicrobial resistance genes in Salmonella enterica isolates from poultry and swine in Thailand. J. Vet. Med. Sci. 2009;71(10):1349–1355. doi: 10.1292/jvms.001349. [DOI] [PubMed] [Google Scholar]

[bib45] 45.Tamura K., Stecher G., Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021;38(7):3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib46] 46.Bandyopadhyay S., Samanta I. Antimicrobial resistance in agri-food chain and companion animals as a re-emerging menace in post-COVID epoch: low-and middle-income countries perspective and mitigation strategies. Front. Vet. Sci. 2020;7:620. doi: 10.3389/fvets.2020.00620. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib47] 47.Marti R., Scott A., Tien Y.-C., Murray R., Sabourin L., Zhang Y., Topp E. Impact of manure fertilization on the abundance of antibiotic-resistant bacteria and frequency of detection of antibiotic resistance genes in soil and on vegetables at harvest. Appl. Environ. Microbiol. 2013;79(18):5701–5709. doi: 10.1128/aem.01682-13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib48] 48.Shah M.S., Eppinger M., Ahmed S., Shah A.A., Hameed A., Hasan F. Multidrug-resistant diarrheagenic E. coli pathotypes are associated with ready-to-eat salad and vegetables in Pakistan. J. Korean Soc. Appl. Biol. Chem. 2015;58(2):267–273. doi: 10.1007/s13765-015-0019-9. [DOI] [Google Scholar]

[bib49] 49.Crump J.A., Sjolund-Karlsson M., Gordon M.A., Parry C.M. Epidemiology, clinical presentation, laboratory diagnosis, antimicrobial resistance, and antimicrobial management of invasive Salmonella infections. Clin. Microbiol. Rev. 2015;28(4):901–937. doi: 10.1128/cmr.00002-15. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib50] 50.Li Y., Zhang M., Luo J., Chen J., Wang Q., Lu S., Ji H. Antimicrobial resistance of Escherichia coli isolated from retail foods in northern Xinjiang, China. Food Sci. Nutr. 2020;8(4):2035–2051. doi: 10.1002/fsn3.1491. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib51] 51.Wu X., Angkititrakul S., Richards A.L., Pulsrikarn C., Khaengair S., Keosengthong A., Siriwong S., Suksawat F. Risk of antimicrobial resistant non-typhoidal Salmonella during asymptomatic infection passage between pet dogs and their human caregivers in Khon Kaen, Thailand. Antibiotics. 2020;9(8):477. doi: 10.3390/antibiotics9080477. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib52] 52.Pungpian C., Sinwat N., Angkititrakul S., Prathan R., Chuanchuen R. Presence and transfer of antimicrobial resistance determinants in Escherichia coli in pigs, pork, and humans in Thailand and Lao PDR Border provinces. Microb. Drug Resist. 2021;27(4):571–584. doi: 10.1089/mdr.2019.0438. [DOI] [PubMed] [Google Scholar]

[bib53] 53.World Organisation for Animal Health OIE list of antimicrobial agents of veterinary importance. OIE International Committee. 2015;33:1–9. [Google Scholar]

[bib54] 54.World Health Organisation WHO guidelines on use of medically important antimicrobials in food-producing animals. Antimicrob. Resist. Infect. Control. 2017;7:1–8. doi: 10.1186/s13756-017-0294-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib55] 55.Department of Livestock Development Ministry of Agriculture and Cooperatives. Notification of the Department of Livestock Development: specify materials which not allowed to be used as ingredients in animal feed. 2016. https://legal.dld.go.th/web2012/news/P15/13318220159.pdf [internet]. Available from: (in Thai)

[bib56] 56.Roberts M.C., Schwarz S. Tetracycline and phenicol resistance genes and mechanisms: importance for agriculture, the environment, and humans. J. Environ. Qual. 2016;45(2):576–592. doi: 10.2134/jeq2015.04.0207. [DOI] [PubMed] [Google Scholar]

[bib57] 57.Partridge S.R., Kwong S.M., Firth N., Jensen S.O. Mobile genetic elements associated with antimicrobial resistance. Clin. Microbiol. Rev. 2018;31(4):10–1128. doi: 10.1128/cmr.00088-17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib58] 58.Nji E., Kazibwe J., Hambridge T., Joko C.A., Larbi A.A., Damptey L.A.O., Nkansa-Gyamfi N.A., Stålsby Lundborg C., Lien L.T.Q. High prevalence of antibiotic resistance in commensal Escherichia coli from healthy human sources in community settings. Sci. Rep. 2021;11(1):3372. doi: 10.1038/s41598-021-82693-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib59] 59.Richter L., Du Plessis E.M., Duvenage S., Korsten L. Occurrence, identification, and antimicrobial resistance profiles of extended-spectrum and AmpC β-lactamase-producing Enterobacteriaceae from fresh vegetables retailed in Gauteng Province, South Africa. Foodborne Pathog. Dis. 2019;16(6):421–427. doi: 10.1089/fpd.2018.2558. [DOI] [PubMed] [Google Scholar]

[bib60] 60.Tansawai U., Walsh T.R., Niumsup P.R. Extended spectrum ß-lactamase-producing Escherichia coli among backyard poultry farms, farmers, and environments in Thailand. Poult. Sci. 2019;98(6):2622–2631. doi: 10.3382/ps/pez009. [DOI] [PubMed] [Google Scholar]

[bib61] 61.Trongjit S., Assavacheep P., Samngamnim S., My T.H., An V.T.T., Simjee S., Chuanchuen R. Plasmid-mediated colistin resistance and ESBL production in Escherichia coli from clinically healthy and sick pigs. Sci. Rep. 2022;12(1):2466. doi: 10.1038/s41598-022-06415-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib62] 62.Kiratisin P., Apisarnthanarak A., Saifon P., Laesripa C., Kitphati R., Mundy L.M. The emergence of a novel ceftazidime-resistant CTX-M extended-spectrum beta-lactamase, CTX-M-55, in both community-onset and hospital-acquired infections in Thailand, Diagn. Microbiol. Infect. Dis. 2007;58(3):349–355. doi: 10.1016/j.diagmicrobio.2007.02.005. [DOI] [PubMed] [Google Scholar]

[bib63] 63.Eltai N.O., Al Thani A.A., Al-Ansari K., Deshmukh A.S., Wehedy E., Al-Hadidi S.H., Yassine H.M. Molecular characterization of extended spectrum beta-lactamases Enterobacteriaceae causing lower urinary tract infection among pediatric population. Antimicrob. Resist. Infect. Control. 2018;7(90) doi: 10.1186/s13756-018-0381-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib64] 64.Zheng W., Huyan J., Tian Z., Zhang Y., Wen X. Clinical class 1 integron-integrase gene–a promising indicator to monitor the abundance and elimination of antibiotic resistance genes in an urban wastewater treatment plant. Environ. Int. 2020;135 doi: 10.1016/j.envint.2019.105372. [DOI] [PubMed] [Google Scholar]

PERMALINK

Occurrence and molecular characteristics of antimicrobial resistance, virulence factors, and extended-spectrum β-lactamase (ESBL) producing Salmonella enterica and Escherichia coli isolated from the retail produce commodities in Bangkok, Thailand

Benjawan Saechue

Edward R Atwill

Saharuetai Jeamsripong

Abstract

Highlights

1. Introduction

2. Materials and methods

2.1. Bacterial isolates

Table 1.

2.2. Antimicrobial susceptibility testing

2.3. Determination of ESBL production

2.4. DNA preparation and PCR amplification

Table 2.

2.5. Genotypic detection of AMR, ESBL, virulence factors, and integrons

2.6. Nucleotide sequencing of ESBL and QRDR

2.7. Statistical analysis

3. Results

3.1. Prevalence and patterns of AMR for isolates of S. enterica and E. coli

Table 3.

Fig. 1.

Fig. 2.

Table 4.

Table 5.

3.2. Genetic analysis of AMR in S. enterica and E. coli isolates

Table 6.

Table 7.

Table 8.

3.3. ESBL production in S. enterica and E. coli isolates

3.4. Occurrence of virulence genes, ICEs, and class 1, 2, and 3 integrons

3.5. Associations between AMR phenotype and genotype

Table 9.

4. Discussion

4.1. AMR and its determinants, virulence factors, and semi-quantitative analysis

4.2. ESBL-producing isolates and their genotype

4.3. QRDR mutations

4.4. int1 gene with MDR phenotype

4.5. Associations between AMR phenotype and genotype

5. Conclusion

Data availability statement

CRediT authorship contribution statement

Declaration of competing interest

Acknowledgements

References

Associated Data

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases