Triptolide inhibits esophageal squamous cell carcinoma progression by regulating the circNOX4/miR‐153‐3p/SATB1 signaling pathway

Abstract

Background

To explore the role and mechanism of triptolide in regulating esophageal squamous cell carcinoma (ESCC) progression by mediating the circular RNA (circRNA)‐related pathway.

Methods

The expression levels of circNOX4, miR‐153‐3p and special AT‐rich sequence binding protein‐1 (SATB1) were measured by qRT‐PCR. Cell proliferation was confirmed by cell counting kit‐8 assay and colony formation assay. Flow cytometry was employed to measure cell apoptosis and cell cycle process. Moreover, cell migration and invasion were detected using transwell assay. The protein levels of epithelial‐mesenchymal transformation markers and SATB1 were determined by western blot analysis. Furthermore, dual‐luciferase reporter assay and RIP assay were performed to confirm the interaction between miR‐153‐3p and circNOX4 or SATB1. Xenograft tumor models were built to verify the effects of triptolide and circNOX4 on ESCC tumor growth.

Results

CircNOX4 was highly expressed in ESCC tissues and cells, and its expression could be reduced by triptolide. Triptolide could inhibit ESCC proliferation, cell cycle process, migration, invasion, EMT process, and promote apoptosis, while these effects were reversed by circNOX4 overexpression. MiR‐153‐3p could be sponged by circNOX4, and the promotion effect of circNOX4 on the progression of triptolide‐treated ESCC cells was abolished by miR‐153‐3p overexpression. SATB1 was a target of miR‐153‐3p. Also, SATB1 knockdown reversed the enhancing effect of miR‐153‐3p inhibitor on the progression of triptolide‐treated ESCC cells. Triptolide reduced ESCC tumor growth by regulating the circNOX4/miR‐153‐3p/SATB1 axis.

Conclusion

Triptolide could hinder ESCC progression, which was mainly achieved by regulating the circNOX4/miR‐153‐3p/SATB1 axis.

Triptolide could hinder the proliferation, migration, invasion, and promote apoptosis in ESCC cells, which was mainly achieved by regulating the circNOX4/miR‐153‐3p/SATB1 axis.

INTRODUCTION

Esophageal squamous cell carcinoma (ESCC) is a common type of esophageal cancer, mainly caused by abnormal proliferation of squamous epithelial cells. ¹ The clinical symptoms of ESCC include dysphagia, pain, reflux, and weight loss, which seriously reduce the patient's quality of life. ² , ³ Currently, surgery combined with radiotherapy and chemotherapy is the main treatment for ESCC, but the prognosis of patients has not been greatly improved. ⁴ , ⁵ Therefore, finding new and effective treatments for ESCC is of great importance.

Natural extracts have shown great potential in cancer treatment. ⁶ , ⁷ Triptolide is an epoxyditerpene lactone compound extracted from Tripterygium wilfordii in the Euonymus family, which has anti‐inflammatory and immunosuppressive effects. ⁸ , ⁹ Not only that, many studies have confirmed that triptolide has a good anticancer effect. ¹⁰ , ¹¹ , ¹² A recent study confirmed that triptolide could suppress the proliferation and metastasis of ESCC, thus achieving the goal of inhibiting the progression of ESCC. ¹³ Unfortunately, the molecular mechanism by which triptolide regulates ESCC progression remains unclear.

Circular RNA (circRNA) is a type of endogenous non‐coding RNA that can participate in transcription or post‐transcriptional regulation. ¹⁴ , ¹⁵ CircRNA is found to be a sponge of miRNA, which indirectly realizes the regulation of downstream mRNA through sponging miRNA. ¹⁶ Many studies have confirmed that the abnormal expression of circRNA is related to cancer development. ¹⁷ Therefore, circRNA is also considered to be an important biomarker for cancer treatment. ¹⁸ , ¹⁹ Circ_0023990 (derived from NOX4 gene, named as circNOX4) is a newly discovered upregulated circRNA in colorectal cancer in recent years, and has been proven to accelerate cancer progression by promoting proliferation and metastasis of cancer cells. ²⁰ , ²¹ Using the GEO database, we analyzed the differentially expressed circRNA in ESCC tissues and normal tissues, and found that circNOX4 was overexpressed in ESCC tissues. However, circNOX4 roles in ESCC progression are still unclear.

Our study found that triptolide could reduce the expression of circNOX4, so we speculated that triptolide might mediate ESCC progression by regulating circNOX4 expression. In addition, the molecular mechanism of triptolide regulating ESCC progression was revealed by elucidating the circRNA‐related miRNA/mRNA axis.

METHODS

Tissue samples

A total of 45 paired ESCC tumor tissues and adjacent normal tissues were obtained from 45 ESCC patients at Gaozhou people's Hospital. All tissues were stored at −80°C until used. Each patient signed their informed consent, and our procedure was approved by the Ethics committee of Gaozhou People's Hospital.

Cell culture and triptolide treatment

Human ESCC cells (KYSE410 and ECA109) and esophageal epithelial cell line (HET‐1A) were purchased from Biovector NTCC and grown in RPMI‐1640 medium (Hyclone) containing 10% fetal bovine serum (FBS: Hyclone) and 1% penicillin–streptomycin (Invitrogen) at 37°C with 5% CO₂. Triptolide (Yuanye Bio‐Technology) was diluted to different concentrations (4, 8 and 12 nM) with DMSO solution (Sangon). When the cells reached 90% confluences, the cells were hatched with different concentrations of triptolide for 24 h to detect circNOX4 expression. In subsequent functional tests, the cells were treated with 12 nM triptolide for 24 h.

Cell transfection

Cell transfection was performed using lipofectamine 3000 reagents (Invitrogen). CircNOX4 overexpression vector (oe‐circNOX4), miR‐153‐3p mimic or inhibitor (anti‐miR‐153‐3p), special AT‐rich sequence binding protein‐1 (SATB1) siRNA (si‐SATB1) and their controls were constructed by Ribobio.

Quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR)

Total RNA was collected using TRIzol reagent (Invitrogen). After that, cDNA was obtained with PrimeScript RT reagent kit (Takara). SYBR Green (Invitrogen) was mixed with the specific primers to detect circRNA, miRNA and mRNA expression. In addition, relative expression was analyzed using 2^−ΔΔCt method with β‐actin or U6 as a housekeeping gene. All primer sequences are listed in Table 1.

TABLE 1.

The primer sequences used for qRT‐PCR.

Name		Primers for PCR (5′–3′)
circNOX4	Forward	ACAACTGTTCCTGGCCTGAC
	Reverse	GGATAAGGCTGCAGTTGAGG
NOX4	Forward	CAGATGTTGGGGCTAGGATTG
	Reverse	GAGTGTTCGGCACATGGGTA
miR‐153‐3p	Forward	GCCGAGTTGCATAGTCACAAAA
	Reverse	ATCCAGTGCAGGGTCCGAGG
SATB1	Forward	GATCATTTGAACGAGGCAACTCA
	Reverse	TGGACCCTTCGGATCACTCA
β‐actin	Forward	CTTCGCGGGCGACGAT
	Reverse	CCACATAGGAATCCTTCTGACC
U6	Forward	CTCGCTTCGGCAGCACATA
	Reverse	CGAATTTGCGTGTCATCCT

Abbreviation: qRT‐PCR, quantitative reverse transcription‐polymerase chain reaction.

Detection of circRNA stability

In actinomycin D assay, KYSE410 and ECA109 cells were incubated with actinomycin D solution. At different time points, the RNA extracted from the cells was used for qRT‐PCR to detect RNA expression. In RNase R assay, the RNA from KYSE410 and ECA109 cells was incubated with RNase R, and RNA expression was examined by qRT‐PCR.

Cell counting kit‐8 (CC‐8) assay

CCK‐8 kit (Dojindo) was used for detecting cell viability. According to the kit instructions, KYSE410 and ECA109 cells seeded into 96‐well plates were incubated with CCK8 solution for 4 h. The absorbance at 450 nm was detected using a microplate reader.

Colony formation assay

KYSE410 and ECA109 cells were plated in six‐well plates. After 14 days, the colony numbers were counted under a microscope after being stained with crystal violet (Solarbio).

Flow cytometry

Flow cytometry was performed to measure cell apoptosis and cell cycle process. After treatment or transfection, KYSE410 and ECA109 cells were harvested to collect cell suspensions. The cell suspensions were stained with Annexin V‐FITC (Beyotime) and PI, followed by analyzing the cell apoptosis rate under a flow cytometer. The cell cycle process was assessed using a cell cycle analysis kit (Beyotime). In brief, the cell suspensions were fixed with 70% ethanol and then stained with PI and RNase A followed by assessing the cell cycle distribution.

Transwell assay

We used 24‐well transwell chambers (Corning Inc.) with or without Matrigel (Corning Inc.) for cell invasion or migration, respectively. KYSE410 and ECA109 cells suspended with serum‐free medium were seeded in the upper chamber. Then, 24 h later, the cells that had migrated and invaded into lower chambers were fixed and stained with crystal violet (Solarbio). The migration and invasion cell numbers were counted under a microscope (100×).

Western blot (WB) analysis

Total protein was extracted with radioimmunoprecipitation (RIPA) buffer reagent (Beyotime). The rotein sample was separated by SDS‐PAGE gel, followed by transfer onto a PVDF membrane (Beyotime). The membrane was hatched with primary antibodies, including anti‐E‐cadherin (1:40000, ab40772, Abcam), anti‐N‐cadherin (1:1000, ab18203, Abcam), anti‐Vimentin (1:1000, ab45939, Abcam), anti‐Snail (1:500, ab82846, Abcam), anti‐SATB1 (1:1000, ab101085, Abcam) or anti‐β‐actin (1:5000, ab8227, Abcam), followed by incubation with secondary antibody (1:50000, ab205718, Abcam). The protein signals were visualized using an ECL chemiluminescence detection kit (Vazyme).

Dual‐luciferase reporter assay

The WT or MUT fragments for circNOX4 or SATB1 3′UTR were amplified and then inserted into the pGL3 reporter vector. The constructed WT or MUT reporter vectors were transfected into KYSE410 and ECA109 cells with miR‐NC mimic or miR‐153‐3p mimic. Then, 48 h later, a dual‐luciferase reporter assay system was used to detect relative luciferase activity.

RIP assay

KYSE410 and ECA109 cells were cultured with magnetic beads coupled with human anti‐Ago2 or anti‐IgG in RIP buffer. After that, the immunoprecipitated RNA was used for qRT‐PCR to analyze RNA enrichment.

Xenograft tumor models

Twenty male BALB/c mice (8 weeks old; Vital River, Beijing, China) were randomly divided into four groups (n = 5 per group): Control, triptolide, triptolide + vector and triptolide + oe‐circNOX4. Control and triptolide groups were subcutaneously injected with KYSE410 cells, and the other two groups were injected with KYSE410 cells transfected with vector or oe‐circNOX4. When the tumors grew to about 100 mm³, the mice in three triptolide groups were received intraperitoneal injection of triptolide (0.15 mg/kg) daily, while the mice in the control group were injected with the same amount of DMSO. In addition, tumor volume was detected every 7 days using length × width²/2. After 28 days, the tumor was removed for weighing. Animal experiments were approved by the Animal Ethics committee of Gaozhou people's Hospital.

Immunohistochemistry (IHC) staining

The tumor tissues were fixed, dehydrated, paraffin‐embedded and sectioned. After that, the sections was incubated with anti‐Ki67 or anti‐PCNA and then hatched with Goat anti‐rabbit IgG polyclonal. Pictures were taken under microscopy, and the positive cells of Ki67 and PCNA were quantified by Image Pro‐Plus software.

Statistical analysis

Data are presented as the mean ± SD, analyzed by GraphPad Prism 7 software. Group comparison was tested by student's t‐test or ANOVA. Each experiment was performed in triplicate. p < 0.05 was considered to be statistically significant.

RESULTS

CircNOX4 was upregulated in ESCC tissues and cells and its expression was inhibited by triptolide

In the GEO database (accession: GSE131969), circNOX4 was found to be highly expressed in three paired ESCC tumor tissues compared to three paired normal tissues (Figure 1a). The circRNA ID of circNOX4 was hsa_circ_0023990, which was circularized from the exons (6–10, and) of NOX4 gene with a length of 395 bp (Figure 1b). Through detecting circNOX4 expression in ESCC tumor tissues and adjacent normal tissues, we discovered that circNOX4 was upregulated in ESCC tumor tissues (Figure 1c). Moreover, the expression of circNOX4 also was higher in ESCC cells (KYSE410 and ECA109) than that in HET‐1A cells (Figure 1d). In addition, Actinomycin D assay and RNase R assay were used to assess the stability of circNOX4 and the results suggested that circNOX4 was much more stable than linear NOX4 mRNA (Figure 1E,F), and could withstand the digestion of RNase R (Figure 1g,h). Interestingly, under the treatment with different concentrations of triptolide, circNOX4 expression was significantly reduced in KYSE410 and ECA109 cells as a concentration‐dependent manner (Figure 1i,j). These results showed that circNOX4 might be involved in the regulation of triptolide on ESCC progression.

FIGURE 1.

The expression of circNOX4 in esophageal squamous cell carcinoma (ESCC) tissues and cells. (a) The expression of circNOX4 in three paired ESCC tissues and normal tissues were shown in the GSE131969 database. (b) The basic information of the circular formation of circNOX4 are exhibited. (c) Quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) was used to test the expression of circNOX4 in ESCC tumor tissues (n = 45) and adjacent normal tissues (n = 45). (d) The expression of circNOX4 in HET‐1A and ESCC cells (KYSE410 and ECA109) was measured using qRT‐PCR. Actinomycin D assay (e and f) and RNase R assay (g and h) were utilized to assess the stability of circNOX4. (i and j) The circNOX4 expression was detected by qRT‐PCR in KYSE410 and ECA109 cells treated with different concentrations (4, 8 and 12 nM) of triptolide. *p < 0.05.

Overexpressed circNOX4 partially reversed the inhibitory effect of triptolide on ESCC progression

To explore the role of circNOX4 in triptolide regulating ESCC progression, we overexpressed circNOX4 using circNOX4 overexpression vector. The significantly increased circNOX4 expression confirmed the good transfection efficiency of oe‐circNOX4 in KYSE410 and ECA109 cells (Figure 2a). Function analysis indicated that triptolide could suppress the viability and colony number of KYSE410 and ECA109 cells, while this effect could be reversed by circNOX4 overexpression (Figure 2b,c). The results of flow cytometry suggested that triptolide promoted the apoptosis rate of KYSE410 and ECA109 cells, and induced cell cycle arrest in G0/G1 phase to reduce the cell number in S phase. However, the regulation of triptolide on cell apoptosis and cell cycle process also could be abolished by overexpressing circNOX4 (Figure 2d,e). Also, overexpressed circNOX4 partially reversed the suppression of triptolide on the migration and invasion of KYSE410 and ECA109 cells (Figure 3a,b). Through measuring the expression of epithelial‐mesenchymal transformation (EMT) markers, we uncovered that triptolide enhanced E‐cadherin protein level, and repressed N‐cadherin, vimentin and Snail protein levels in KYSE410 and ECA109 cells, while circNOX4 overexpression also could reverse these effects (Figure 3c,d). All data revealed that triptolide inhibited ESCC cell progression by regulating circNOX4.

FIGURE 2.

Overexpressed circNOX4 reversed the effect of triptolide on proliferation and apoptosis of esophageal squamous cell carcinoma (ESCC) cells. (a) The circNOX4 expression was measured by qRT‐PCR to assess the transfection efficiency of oe‐circNOX4. (b–e) KYSE410 and ECA109 cells were transfected with or without vector or oe‐circNOX4, and then treated with triptolide. Cell counting kit‐8 (CCK‐8) assay (b) and colony formation assay (c) were used to measure cell viability and colony number to evaluate cell proliferation. (d and e) Flow cytometry was performed to determine the cell apoptosis rate and cell cycle process. *p < 0.05.

FIGURE 3.

Overexpressed circNOX4 reversed the effects of triptolide on migration and invasion of esophageal squamous cell carcinoma (ESCC) cells. KYSE410 and ECA109 cells were transfected with or without vector or oe‐circNOX4, and then treated with triptolide. (a and b) The migration and invasion cell numbers were detected using transwell assay. (c and d) WB analysis was utilized to test the protein expression of E‐cadherin, N‐cadherin, Vimentin and Snail. *p < 0.05.

MiR‐153‐3p could be sponged by circNOX4

To perfect the mechanism of circNOX4 participated in triptolide regulated ESCC progression, the Circinteractome software (https://circinteractome.nia.nih.gov/) was used for predicting the targeted miRNA of circNOX4. As shown in Figure 4a, circNOX4 was found to have miR‐153‐3p binding sites. After confirming the transfection efficiency of miR‐153‐3p mimic (Figure 4b), constructed luciferase reporter vectors and miR‐153‐3p mimic were cotransfected into KYSE410 and ECA109 cells to perform a dual‐luciferase reporter assay. By detecting the luciferase activity, we found that miR‐153‐3p mimic could repress the luciferase activity of circNOX4 WT vector without affecting that of the circNOX4 MUT vector (Figure 4c,d). Moreover, the results of RIP assay revealed that the enrichments of circNOX4 and miR‐153‐3p were significantly increased in anti‐Ago2 compared to anti‐IgG (Figure 4e,f). In KYSE410 and ECA109 cells overexpressing circNOX4, we discovered that miR‐153‐3p expression was markedly decreased (Figure 4g). Furthermore, miR‐153‐3p expression was found to be lowly expressed in ESCC tumor tissues and cells (Figure 4h,i). Also, triptolide had a promotion effect on miR‐153‐3p expression in KYSE410 and ECA109 cells (Figure 4j). Therefore, we confirmed that miR‐153‐3p was targeted by circNOX4 and might participate in the regulation of triptolide on ESCC progression.

FIGURE 4.

MiR‐153‐3p could be sponged by circNOX4. (a) The binding sites and corresponding mutate sites between circNOX4 and miR‐153‐3p are shown. (b) The transfection efficiency of miR‐153‐3p mimic was confirmed by detecting miR‐153‐3p expression using quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR). (c and d) Dual‐luciferase reporter assay was performed to evaluate the interaction between circNOX4 and miR‐153‐3p. (e) The expression of miR‐153‐3p in KYSE410 and ECA109 cells transfected with vector or oe‐circNOX4 was measured by qRT‐PCR. (f and g) RIP assay was used to confirm RNA interaction. (h) The expression of miR‐153‐3p in esophageal squamous cell carcinoma (ESCC) tumor tissues (n = 45) and adjacent normal tissues (n = 45) was determined by qRT‐PCR. (i) The miR‐153‐3p expression in HET‐1A and ESCC cells (KYSE410 and ECA109) was detected by qRT‐PCR. (j) QRT‐PCR was used to measure the miR‐153‐3p expression in KYSE410 and ECA109 cells under the treatment with triptolide. *p < 0.05.

MiR‐153‐3p reversed the regulation of circNOX4 on triptolide‐treated ESCC cell progression

To further explore our speculation, KYSE410 and ECA109 cells were cotransfected with oe‐circNOX4 and miR‐153‐3p mimic, and then treated with triptolide. The results showed that the viability and colony number of triptolide‐treated KYSE410 and ECA109 cells enhanced by circNOX4 overexpression could be reversed by miR‐153‐3p mimic (Figure 5a,b). Also, the suppressive effect of circNOX4 overexpression on apoptosis rate in triptolide‐treated KYSE410 and ECA109 cells also could be abolished by overexpressing miR‐153‐3p (Figure 5c). Meanwhile, miR‐153‐3p overexpression also overturned the promotion effect of circNOX4 on the cell cycle, migration and invasion of triptolide‐treated KYSE410 and ECA109 cells (Figure 5d–g). The increased E‐cadherin protein expression and the decreased N‐cadherin, Vimentin and Snail protein expression in triptolide‐treated KYSE410 and ECA109 cells transfected with oe‐circNOX4 + miR‐153‐3p mimic confirmed that miR‐153‐3p reversed the regulation of circNOX4 on the EMT process in triptolide‐treated ESCC cells (Figure 5h,i). All results suggested that triptolide regulated ESCC progression by mediating the circNOX4/miR‐153‐3p axis.

FIGURE 5.

Effects of circNOX4 and miR‐153‐3p overexpression on triptolide‐treated esophageal squamous cell carcinoma (ESCC) cell progression. KYSE410 and ECA109 cells were transfected with or without vector, oe‐circNOX4, oe‐circNOX4 + miR‐NC mimic or oe‐circNOX4 + miR‐153‐3p mimic, and then treated with triptolide. Nontransfected and nontreated cells were used as Control. Cell viability and colony number were detected using cell counting kit‐9 (CCK8) assay (a) and colony formation assay (b) to evaluate cell proliferation. (c–e) Cell apoptosis rate and cell cycle process were analyzed using flow cytometry. (f and g) Transwell assay was used to detect the migration and invasion cell numbers. (h and i) The protein expression of E‐cadherin, N‐cadherin, Vimentin and Snail were determined using WB analysis. *p < 0.05.

SATB1 was a target of miR‐153‐3p

To further the downstream target of miR‐153‐3p, TargetScan software (http://www.targetscan.org/vert_72/) was used for predicting and the 3′UTR of SATB1 was discovered to can interact with miR‐153‐3p (Figure 6a). The luciferase activity of SATB1 3′UTR WT vector rather than that of the SATB1 3′UTR MUT vector could be repressed by miR‐153‐3p mimic, confirming the interaction between miR‐153‐3p and SATB1 (Figure 6b,c,). After overexpressing miR‐153‐3p, the mRNA and protein expression levels of SATB1 were significantly reduced in KYSE410 and ECA109 cells (Figure 6d,e). Furthermore, SATB1 also had an upregulation expression in ESCC tumor tissues and cells at the mRNA level and protein level (Figure 6f–i). In addition, triptolide could markedly decrease the mRNA and protein expression of SATB1 in KYSE410 and ECA109 cells (Figure 6j,k), which was similarly with the expression trend of circNOX4. In KYSE410 and ECA109 cells cotransfected with oe‐circNOX4 and miR‐153‐3p mimic, we discovered that circNOX4 overexpression could remarkably enhance the mRNA and protein expression of SATB1, while this effect could be reversed by miR‐153‐3p mimic (Figure 6l,m). These data confirmed that circNOX4 sponged miR‐153‐3p to regulate SATB1.

FIGURE 6.

SATB1 was a target of miR‐153‐3p. (a) The binding sites and corresponding mutate sites between SATB1 3′UTR and miR‐153‐3p were exhibited. (b and c) The interaction between SATB1 and miR‐153‐3p was confirmed by dual‐luciferase reporter assay. (d and e) The mRNA and protein expression levels of SATB1 in KYSE410 and ECA109 cells transfected with miR‐NC mimic or miR‐153‐3p mimic were measured by quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) and western blot (WB) analysis. (f and g) qRT‐PCR and WB analysis were performed to determine the mRNA and protein expression levels of SATB1 in ESCC tumor tissues (n = 45) and adjacent normal tissues (n = 45). (h and i) The mRNA and protein expression levels of SATB1 in HET‐1A and ESCC cells (KYSE410 and ECA109) were examined by qRT‐PCR and WB analysis. (j and k) QRT‐PCR and WB analysis were used to measure the mRNA and protein expression levels of SATB1 in KYSE410 and ECA109 cells under the treatment with triptolide. (l and m) The mRNA and protein expression levels of SATB1 were tested by qRT‐PCR and WB analysis in KYSE410 and ECA109 cells transfected with vector, oe‐circNOX4, oe‐circNOX4 + miR‐NC mimic or oe‐circNOX4 + miR‐153‐3p mimic. *p < 0.05.

Promotion effect of miR‐153‐3p inhibitor on triptolide‐treated ESCC cell progression could be reversed by SATB1 knockdown

To further confirm that SATB1 was a target of miR‐153‐3p, we constructed the miR‐153‐3p inhibitor and the siRNA of SATB1. The detection results of miR‐153‐3p expression and SATB1 protein expression showed that anti‐miR‐153‐3p and si‐SATB1 could effectively reduce miR‐153‐3p and SATB1 expression, respectively (Figure 7a,b). Function experiments suggested that miR‐153‐3p inhibitor could reverse the suppression effect of triptolide on the viability, colony number, cell cycle process, and the promotion effect on the apoptosis of KYSE410 and ECA109 cells. However, these effects could be abolished by silencing SATB1 (Figure 7c–g). Also, the enhancing effect of miR‐153‐3p inhibitor on the migration and invasion of triptolide‐treated KYSE410 and ECA109 cells also could be overturned by SATB1 knockdown (Figure 7h,i). Additionally, miR‐153‐3p inhibitor also reversed the promotion of triptolide on E‐cadherin protein expression and the inhibition on N‐cadherin, Vimentin and Snail protein expression in KYSE410 and ECA109 cells, while silenced SATB1 also could abolish these effects (Figure 7j,k). These data revealed that miR‐153‐3p targeted SATB1 to participate in the regulation of triptolide on ESCC progression.

FIGURE 7.

Effects of miR‐153‐3p inhibitor and SATB1 knockdown on triptolide‐treated esophageal squamous cell carcinoma (ESCC) cell progression. (a) The miR‐153‐3p expression was measured by quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) to assess the transfection efficiency of anti‐miR‐153‐3p. (b) The protein expression of SATB1 was detected by western blot (WB) analysis to evaluate the transfection efficiency of si‐SATB1. (c–k) KYSE410 and ECA109 cells were transfected with or without anti‐miR‐NC, anti‐miR‐153‐3p, anti‐miR‐153‐3p + si‐NC or anti‐miR‐153‐3p + si‐SATB1, and then treated with triptolide. Nontransfected and nontreated cells were used as Control. Cell counting kit‐8 (CCK‐8) assay (c) and colony formation assay (d) were performed to examine cell viability and colony number to assess cell proliferation. (e–g) Cell apoptosis rate and cell cycle process were determined by flow cytometry. (h and i) The migration and invasion cell numbers were analyzed by transwell assay. (j and k) The protein expression of E‐cadherin, N‐cadherin, Vimentin and Snail were tested by WB analysis. *p < 0.05.

Triptolide reduced ESCC tumor growth in vivo

In the constructed xenograft tumors of ESCC, we found that the tumor size and weight in the triptolide‐treated mice were significantly smaller than those in the control group, while the tumor size and weight were markedly increased after circNOX4 overexpression (Figure 8a,b). By analyzing the tumor volume curve, we determined that the tumor volume of the triptolide treatment group was reduced compared to the control group, and that of the circNOX4 overexpression group was significantly higher than that of the triptolide treatment group (Figure 8c). In the triptolide treatment group, circNOX4 expression was decreased, miR‐153‐3p expression was increased and SATB1 expression was inhibited, while these effects could be reversed by overexpressing circNOX4 (Figure 8d–f). In addition, the results of IHC staining revealed that the positive cells of proliferation markers (Ki67 and PCNA) were significantly reduced in the tumor tissues of triptolide group, and this effect could be abolished by oe‐circNOX4 (Figure 8g). These results confirmed that triptolide inhibited ESCC tumor growth by regulating the circNOX4/miR‐153‐3p/SATB1 axis.

FIGURE 8.

Triptolide reduced esophageal squamous cell carcinoma (ESCC) tumor growth by regulating circNOX4. (a) Tumor images of each group are shown. Tumor weight (b) and tumor volume (c) were determined in each group. (d and e) The expression of circNOX4 and miR‐153‐3p was measured by quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR). (f) The protein expression of SATB1 was detected by western blot analysis. (g) Immunohistochemical (IHC) staining was used to assess the Ki67 and PCNA positive cells (brown) in the tumor tissues of each group. *p < 0.05.

DISCUSSION

Natural extract has advantages of high safety and good efficacy, and is considered an important adjuvant in cancer treatment. ²² For example, resveratrol is a polyphenolic compound derived from peanut, grape, mulberry and other plants, which has been shown to restrain colon cancer invasion and metastasis. ²³ Curcumin derived from the ginger plant turmeric has been shown to have a good inhibitory effect on head and neck cancer. ²⁴ Ginsenoside, a steroidal compound extracted from ginseng, has been proved to have antitumor activity in nasopharyngeal carcinoma. ²⁵ Therefore, the development of natural extracts for the treatment of cancer has great potential.

Triptolide had been confirmed to repress lung cancer cell invasion and migration. ¹⁰ Also, Jiang et al. suggested that triptolide inhibited breast cancer cell growth by decreasing HMGB1 expression. ¹¹ Moreover, triptolide inhibited ovarian cancer cell metastasis via inhibiting MMP7 and MMP19 expression. ²⁶ The above data confirmed the antitumor role of triptolide. At present, studies on triptolide in ESCC progression are limited. Although a previous study has revealed the anti‐ESCC effect of triptolide, ¹³ the underlying molecular mechanism of triptolide in ESCC remains unclear. Here, we investigated the influence of triptolide on the progression of ESCC and confirmed that triptolide had antiproliferative, antimetastasis and proapoptosis roles in ESCC cells. More importantly, the antitumor function of triptolide in ESCC was also verified in this study.

The link between circRNA and the occurrence of human diseases is attracting increasing attention, and its important role in cancer has been in the spotlight. Many cicRNAs have been found to be involved in regulating ESCC progression. For example, Liu et al. revealed that circ_100367 promoted ESCC cell proliferation, migration and radioresistance. ²⁷ In addition, circ_100876 was overexpressed in ESCC tissues, and its knockdown suppressed ESCC cell metastasis and proliferation. ²⁸ Moreover, high circ_0006948 expression was confirmed to accelerate ESCC cell invasion and migration. ²⁹ In this, the GEO database was used to screen out a circRNA, circNOX4, which was highly expressed in ESCC. Consistent with the results of database screening, our study confirmed that circNOX4 was upregulated in ESCC tissues and cells. To our delight, we found that triptolide decreased circNOX4 expression, and the reversal effect of circNOX4 overexpression on triptolide‐mediated functions confirmed that triptolide played an anticancer role in ESCC by reducing circNOX4 expression. It revealed for the first time that triptolide regulated cancer progression by mediating circRNA.

The ceRNA hypothesis provides a direction for elucidating the molecular mechanism of circRNA. ¹⁶ Bioinformatic prediction showed that circNOX4 could sponge miR‐153‐3p. MiR‐153‐3p has been confirmed to be a tumor suppressor in many cancers, including hepatocellular carcinoma, ³⁰ gastric cancer ³¹ and oral cancer. ³² MiR‐153‐3p could hinder ESCC cell proliferation and improve cisplatin sensitivity. ³³ Moreover, miR‐153‐3p was downregulated in ESCC and play a negative role in ESCC progression. ³⁴ Consistent with these previous studies, the lowly expressed miR‐153‐3p in ESCC also was confirmed in our study. The rescue experiments confirmed that circNOX4 regulated triptolide‐treated ESCC cell progression by targeting miR‐153‐3p. Also, miR‐153‐3p expression could be enhanced by triptolide. This confirmed the conclusion that the circNOX4/miR‐153‐3p network participated in the progression of ESCC regulated by triptolide.

In order to find downstream target of miR‐153‐3p and perfect the hypothesis of circRNA/miRNA/mRNA axis, we conducted bioinformatics analysis and found that miR‐153‐3p targeted SATB1. SATB1 is a nuclear matrix binding protein and a global gene regulatory factor. ³⁵ Previous studies have found that overexpressed SATB1 is related to tumor metastasis and proliferation. ³⁶ , ³⁷ Previous studies have confirmed that high expression of SATB1 could promote the malignant progression of ESCC. ³⁸ , ³⁹ Here, we discovered that circNOX4 could positively regulate SATB1 by sponging miR‐153‐3p. The reverse effect of SATB1 silencing on miR‐153‐3p inhibitor showed that miR‐153‐3p regulated ESCC cell progression via targeting SATB1 under the condition of triptolide. Also, the inhibition effect of triptolide on SATB1 expression also revealed that triptolide reduced SATB1 expression to inhibit ESCC progression by circNOX4/miR‐153‐3p network.

The present study had some limitations. Because of the limited sample size, we explored the expression of target genes in only 45 pairs of tissues. In future, a larger sample size is needed to explore the universality of circNOX4, miR‐153‐3p and SATB1 expression, and analyze their clinical relevance, to clear the importance of circNOX4/miR‐153‐3p/SATB1 axis in the process of ESCC. In addition, we performed functional experiments in only two ESCC cell lines, which is inadequate. More ESCC cell lines are needed to confirm our conclusions in the future.

In conclusion, our findings suggested that triptolide could regulate the circNOX4/miR‐153‐3p/SATB1 axis to restrain ESCC proliferation, metastasis and promote apoptosis. Our study revealed the underlying molecular mechanism by which triptolide regulated the development of ESCC. The proposal of the circNOX4/miR‐153‐3p/SATB1 axis also provided a potential target for ESCC molecular targeted therapy.

AUTHOR CONTRIBUTIONS

Conceptualization and Methodology: Hanping Liang and Weibi Che; Formal analysis and data curation: Fengyuan Peng, and Huilong Chen; Validation and investigation: Xihao Xie and Bomeng Wu; Writing—original draft preparation and writing—review and editing: Hanping Liang, Weibi Che and Fengyuan Peng; Approval of final manuscript: all authors.

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no competing interests.

Liang H, Che W, Peng F, Chen H, Xie X, Wu B. Triptolide inhibits esophageal squamous cell carcinoma progression by regulating the circNOX4/miR‐153‐3p/SATB1 signaling pathway. Thorac Cancer. 2024;15(7):538–549. 10.1111/1759-7714.15215

DATA AVAILABILITY STATEMENT

The analyzed data sets generated during the present study are available from the corresponding author on reasonable request.