Abstract
Pulmonary artery remodeling is a characteristic feature of broiler ascites syndrome (BAS). Pulmonary artery endothelial cells (PAECs) regulated by HIF-1α play a critical role in pulmonary artery remodeling, but the underlying mechanisms of HIF-1α in BAS remain unclear. In this experiment, primary PAECs were cultured in vitro and were identified by coagulation factor VIII. After hypoxia and RNA interference, the mRNA and protein expression levels of HIF-1α and VEGF were determined by qPCR and Western blotting. The transcriptome profiles of PAECs were obtained by RNA sequencing. Our results showed that the positive rate of PAECs was more than 90%, hypoxia-induced promoted the proliferation and apoptosis of PAECs, and RNA interference significantly downregulated the expression of HIF-1α, inhibited the proliferation of PAECs, and promoted the apoptosis of PAECs. In addition, transcriptome sequencing analysis indicated that HIF-1α may regulate broiler ascites syndrome by mediating COL4A, vitronectin, vWF, ITGα8, and MKP-5 in the ECM, CAMs and MAPK pathways in PAECs. These studies lay the foundation for further exploration of the mechanisms of pulmonary artery remodeling, and HIF-1α may be a potentially effective gene for the prevention and treatment of BAS.
Key words: broiler ascites syndrome, hypoxia, pulmonary artery endothelial cells, RNA interference, HIF-1α
INTRODUCTION
Broilers ascites syndrome (BAS) is a nutritional metabolic disease characterized by pulmonary artery remodeling, which is caused by the interaction of various factors such as genetics, and feeding management. Hypoxia, as one of the main factors, contributes to the development of this disorder (Yu et al., 2023). Due to the rapid growth of broilers, insufficient oxygen is delivered to the broiler's body, which triggers pulmonary artery remodeling and pulmonary hypertension, ultimately induce the development of broiler ascites syndrome (Li et al., 2019). Pulmonary artery endothelial cells (PAECs) are located in the intima of the pulmonary artery, affecting the activity and growth of vascular. Endothelial cells have been recognized to contribute to vascular remodeling by converting into mesenchymal or SM-like phenotype cells (Zhang et al., 2018). Besides, research has shown that damaged endothelial cells can increase inflammatory adhesion molecules' expression, affecting heart remodeling and heart failure. It was reported that endothelial cells are involved in many pathophysiological processes, such as vasoconstriction, cell growth, and inflammation, which promote the development of hypertension (Evans et al., 2021). It is clear that EC is vital to the development of many diseases. PGC-1α activation in pulmonary vascular endothelial cells has been reported to promote pulmonary artery remodeling and affect ascites in broilers (Rahimi et al., 2023). There is evidence suggests that PAECs are involved and play a crucial role in the pathogenesis of BAS. However, the underlying mechanism of how hypoxia, as one of the major triggers, modulates PAECs to promote the development of pulmonary artery remodeling in BAS is still unknown.
Hypoxia-inducible factor-1α (HIF-1α) is a major regulatory factor that mediates cell and tissue responses to hypoxia (Ke and Costa, 2006). Hypoxia is one of the main triggers of BAS, and HIF-1α is a major regulator of hypoxia signaling, it has been reported in the literature that HIF-1α may be associated with the development of BAS induced by excessive salt in the drinking water of broiler chickens and the expression of HIF-1α in PAECs may play an important role in the development of pulmonary hypertension (Zhang et al., 2013; Wang et al., 2019). HIF-1α has been the subject of extensive research due to its crucial role in numerous diseases. It has been noted that HIF-1α mediates adaptive responses to oxidative stress by nuclear translocation and regulation of gene expression (Li et al., 2019). Besides, HIF-1α promotes Cis-induced renal fibrosis in chronic kidney disease through transcriptional and post-transcriptional activation of Notch-1 (Zhao et al., 2021). Interestingly, HIF-1α is strongly associated with the development of BAS. However, the mechanism of HIF-1α in PAECs in pulmonary artery remodeling in BAS is still unclear.
RNA interference (RNAi) has been widely used as a tool to explore gene-specific function by silencing it. Lentiviral vectors are widely used for high transfection efficiency and long-term stable expression of target genes integrated into the genome of target cells. It has been reported in the literature that interfering lentivirus targeting STAT3, after infiltrating SW1990 cells, successfully achieved silencing STAT3 gene, which led to a decrease in the expression of MMP-2 and VEGF proteins related to tumor invasion and metastasis, and ultimately reduced the invasive ability of pancreatic cancer cells (Yang et al., 2009). It has also been reported that TNF interference by lentivirus significantly inhibited the expression of miR-195a-5p to inhibit NKCC2A to attenuate NaCl-mediated blood pressure elevation (Hao et al., 2023). It is clear that RNA interference is a robust tool for mechanistic research on diseases, but few reports of RNA interference and broiler ascites syndrome have been reported.
To further investigate the mechanism of action of how HIF-1α regulates PAECs to promote the occurrence of pulmonary artery remodeling in BAS. In our study, we used the tissue patch method to culture PAECs in vitro and identified by Coagulation Factor VIII, and construct a hypoxia model and silenced HIF-1α by RNA interference, and we also screened different genes and pathways associated with this mechanism by RNA-Seq. The aim was to elucidate the effect of HIF-1α on the growth of PAECs and the mechanism of action on the development of pulmonary artery remodeling in broiler ascites syndrome.
MATERIALS AND METHODS
Cell Culture
Pulmonary arteries were isolated from white-feather broilers (14–21 days old) and were cut into 1 × 1 mm size using a scalpel and placed onto 2% gelatin-coated cell bottles. The tissue was submerged and cultured in M199 medium (Procell, Wuhan, China) containing 10% fetal bovine serum (BI, Israel). PAECs were identified using Coagulation Factor VIII.
All animals were purchased from the Laboratory Animal Center of Jiangxi Agricultural University (JXAU) and were kept in the animal room of JXAU in accordance with strict laboratory animal management regulations. The animal room alternated day and night for 12 h. The welfare treatment of the animals was guaranteed while trying to minimize their suffering. The Ethics Committee approved the animal care and use procedures of the Institutional Animal Care and Use Committee of Jiangxi Agricultural University. We all complied with all applicable institutional and governmental regulations regarding the ethical use of animals.
Lentivirus Vector Construction
The target site at 535 bp was used as the target site, and the sequence was: F: CACCGCAGCTTCTTTCTCAGAATGACGAATCATTCTGAGAAAGAAGCTGC; R: AAAAGCAGCTTCTTTCTCAGAATGATTCGTCATTCTGAGAAAGAAGCTGC. Primers were designed based on the reported HIF-1α gene sequence in GenBank (forward: 5′-GCGCACACAATTCACCCAAA-3′; reverse: 5′-TTGTACTTGGTTCCAAGAAAAGGA-3′). The interference target sequence was designed by the complete sequence of the HIF-1α gene in the NCBI gene database. The lentiviral vector was double digested with BsmBI and na as the digestion sites and the RNA interference target sequence of HIF-1α was cloned into PU6 promoter to construct the HIF-1α lentiviral vector (positive lentiviral vector, abbreviated as PLV), and the ligated product was transferred into receptor bacteria, and the colonies were further expanded and identified by PCR, and then the positive clones were sequenced and verified. The same method was used to construct a null-interfering recombinant plasmid (negative lentiviral vector, abbreviated as NLV) and perform lentiviral plasmid extraction, quality control, and lentiviral packaging.
Virus Titer Determination
HEK293 cells were cultured in 96-well plates, 2% FBS and 8 μg/mL polybrene were added to the DMEM culture medium to obtain virus dilution medium, and the virus solution was diluted in a gradient with the prepared virus dilution medium. Discard the original medium in the wells, add 50 µL of virus dilution medium, and then take 50 µL of lentivirus diluted in the gradient (containing 1e+0 μL, 1e-1 μL, 1e-2 μL, 1e-3 μL, 1e-4 μL, 1e-5 μL of virus stock solution, respectively) into the wells and mix well. The number of fluorescent cells in each well was observed under a fluorescence microscope to determine the lentivirus titer.
Extraction of Total RNA and qPCR
Total RNA was extracted from the PAECs by adding 1 ml of RNA extraction agents (Vazyme Biotechnology Co, Ltd, Nanjing, Jiangsu, China), 200 μL chloroform and 600 μL isopropanol (Takara Bio Inc, Shiga Prefecture, Japan) in accordance with the reagent instructions in the low-temperature environment, and the concentration and purity of RNA (A260/A280, A260/A230) were measured using a microspectrophotometer (Thermo Fisher Scientific, Waltham, MA).
The reverse transcription step was performed strictly according to the kit instructions, with RNase-free H2O (to 15 μL), 5×gDNA digest mix (3 μL), and total RNA (10 pg–5 μg) to form the 15 μL reaction system. The qPCR reaction was performed according to the recommended system of Hieff qPCR SYBR Green Master Mix (Low Rox Plus) kit using cDNA as the template, and the reaction system was as follows: qPCR SYBR Green Master Mix 10 μL, forward primer 0.4 μL, reverse primer 0.4 μL (Table S1), cDNA 2 μL, ddH2O 7.2 μL to form a 20 μL reaction system. After mixing and centrifugation, the solutions were placed in the PCR thermal cycler for reaction. The amplification procedure was set as follows: 95℃ for 5 min; 55℃ for 10 s; 60℃ for 30 s; this process was repeated for 40 cycles.
Western Blotting
The BCA method was used to measure the concentration of total protein extracted from PAECs. After 12% SDS polyacrylamide gel electrophoresis, the electrophoretic bands were transferred to PVDF membranes by wet transfer method. The PVDF membrane was incubated with the primary antibody on a shaker overnight at 4℃, then incubated with horseradish peroxidase-labeled goat anti-rabbit IgG at room temperature for 40 min. The protein bands were visualized using a highly sensitive ECL chemiluminescence detection kit (Vazyme Biotechnology Co, Ltd). The bands were then developed using a protein imager exposure.
Lentiviral Transfection of PAECs
When the density of PAECs reached 70%, the PAECs were transfected with lentivirus and divided into 3 groups: NC group (Negative Control group), UP group (transfected with NLV), and HRNAi group (transfected with PLV). Mix the plasmids as required (5 μg/well), each tube of Opti-MEM (250 μL/well) and P3000TM (10 μL/well); then add lipofectamine 3000 (7.5 μL/well) to a new EP tube with Opti-MEM (125 μL/well); take 125 μL/well from each of the above 2 EP tubes and mix well. The lipofectamine 3000 plasmid mixture was added to a 6-well plate at 250 μL/well; the fluorescence was observed by fluorescence microscopy after 72 h. Total RNA was extracted from cells in each group, and the mRNA expression of HIF-1α was measured by qPCR.
Cellular Hypoxia Model Construction
PAECs were transfected with lentivirus and cultured under normoxic (21% O2) or hypoxic (1% O2) conditions using a hypoxia chamber (MIC-101, aiputemp, Hangzhou, China). The PAECs were divided into NC group (Negative Control group), UP group (transfected with NLV), HRNAi group (transfected with PLV), NC-A group (Negative group, hypoxia), UP-A (transfected with NLV, hypoxia), and HRNAi-A group (transfected with PLV, hypoxia), NC, UP and HRNAi groups were cultured in normal condition (37℃, 5% CO2, 74% N2, 21% O2).while the NC-A, UP-A and HRNAi-A groups were cultured in hypoxic chambers under hypoxia (37℃, 5% CO2, 94% N2, 1% O2). After 12, 24, and 48 h, the mRNA expression of HIF-1α and VEGF were detected by qPCR, while the protein expression of HIF-1α and VEGF were detected by Western blotting. Additionally, apoptosis of PAECs was detected by Hoechst 33258 staining.
Transcriptome Analysis
Total cellular RNA was extracted from PAECs by using the Trizol method, and concentration(A260/A280) and purity(A260/A230) of RNA were measured using a microspectrophotometer (Thermo Fisher Scientific). The RNA samples meeting the quality requirements were used for subsequent cDNA library construction and transcriptome sequencing studies. The cDNA libraries were sequenced using the Illumina HiSeq high-throughput sequencing platform to obtain raw data. The raw data in FASTQ format from the current trial have been deposited in the National Center for Biotechnology Information (NCBI) Short Read Archive (SRA) database with the accession number PRJNA1007475. The raw data is filtered to remove low-quality sequences to obtain high-quality Clean Reads. The Q30 and GC contents of the samples were calculated by the Illumina HiSeq high-throughput sequencing platform. FPKM was used to quantify transcript and gene expression levels by genetic location information from Mapped Reads. Since biological replicates of the samples were set up for this experiment, edgeR was used for differential expression analysis between sample groups to obtain differentially expressed genes. These genes were further analyzed using various functional annotation databases, such as GO, KEGG, and STRING, to identify their potential functional roles.
Data Analysis
t-Test and one-way analysis of variance (ANOVA) were performed using SPSS Statistics 25 software (SPSS Inc., Chicago, IL). The results were expressed in the form of mean ± SE (square error) in the bar plots. P values less than 0.05 were denoted by *. P values less than 0.01 were denoted by **. P values less than 0.001 were denoted by ***.
RESULTS
Cell Culture and Transfection
After 72 h of culture, the PAECs could be seen extending from the edge of the tissue in all directions and reaching a specific cell density (Figure 1A). The cells were fused in about 5 to 7 d, and they were mostly spindle-shaped or oval, with a more uniform size. The cells are arranged in a protruding pattern, with a strong 3-dimensional sense and swirling distribution, showing a typical "paving stone" characteristic (Figure 1B). The result of cell identification with Coagulation Factor VIII indicated that the cultured cells were PAECs. Under fluorescence microscopy, these cells exhibited a yellow-green cytoplasmic fluorescence. The result of cell identification with Coagulation Factor VIII indicated that the cells were identified The result of cell identification with Coagulation Factor VIII indicated that as PAECs (Figure 1C). Additionally, over 90% of the cultured cells were identified as PAECs. By measuring the fluorescence expression in 293T cells, the lentivirus stock solution titer reached 3 × 108 TU/mL and was deemed suitable for further experiments, and the optimal virus concentration used for the experiments was 1 × 107 TU/mL (Figure 1D). Following lentivirus transfection, the fluorescence efficiency was measured using a fluorescence microscope (ZOE Fluorescent Cell Imager, Bio-Rad, Hercules, CA). We found that the cell fluorescence rate reached 90%, and there were no discernible effects on the physiological state of cells when transfected with lentivirus (Figure 1E).
Figure 1.
PAECs culture, lentivirus titer determination and transfection. (A) The morphology of primary cultured PAECs were observed and photographed under the inverted microscope, 100×. (B) The growth state of PAECs after 5 to 7 d, 200×. (C) Immunofluorescence identification of PAECs, 200×. (D) Lentivirus titers at different dilution ratios, 1e-1μL, 1e-2μL, 1e-3μL, 1e-4μL means volume of virus stock solution, 200×. (E) Fluorescence value of PAECs transfected with lentivirus, NC means NC group, UP means NC group. HRNAi means HRNAi group, 100×.
Expression of mRNA and Protein After Transfection
In our results, the UP group showed no significant changes in HIF-1α expression relative to the normal group, suggesting that the UP group had no impact on the expression of HIF-1α in PAECs. In contrast, the HRNAi group showed significant downregulation of the expression of HIF-1α compared to the NC group (Figure 2A), indicating that lentiviral transfection of PAECs successfully interfered with the expression of HIF-1α (P < 0.01). The results showed that hypoxia upregulated the mRNA and protein expression of HIF-1α. RNA interference with HIF-1α causes down-regulation of mRNA and protein expression of HIF-1α, and the protein expression of HIF-1α was highest at 12 h (Figures 2B, 2D, and 2F). Hypoxia upregulates VEGF mRNA and protein expression. Whereas RNA interference with HIF-1α causes downregulation of mRNA and protein expression of VEGF, and the protein expression of VEGF was highest at 24 h (Figures 2C, 2E, and 2F).
Figure 2.
Expression of mRNA and protein after transfection. (A) mRNA expression of HIF-1α after lentivirus transfection(n = 6). (B) qPCR results showing the mRNA levels of HIF-1α in PAECs treated as indicated (n = 9), expressed relative to the respective control groups. (C) qPCR results showing the mRNA levels of VEGF in PAECs treated as indicated (n = 9), expressed relative to the respective control groups. (D) Western blot analysis of HIF-1α in PAECs treated as indicated (n = 3), expressed relative to the respective control groups, the summary data were shown in (F). (E) Western blot analysis of VEGF in PAECs treated as indicated (n = 3), expressed relative to the respective control groups, the summary data were shown in (F). 12 h, 24 h, 48 h means PAECs culture time. All values are expressed as mean ± S.E.M. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.
Proliferation and Apoptosis of PAECs
We observed a significant increase in the proliferation and fluorescence rate of PAECs as the time of cell culture increased. Hypoxia-induced promotes the proliferation of PAECs, whereas RNA interference with HIF-1α inhibits the proliferation of PAECs (Figure 3A). Based on our apoptosis staining results, we found that the hypoxic group showed varying degrees of bright blue dense staining, suggesting that hypoxia-induced promotes apoptosis of PAECs. Additionally, we observed a significantly higher bright blue fluorescence rate in the HRNAi-A group compared to the NC-A and UP-A groups, suggesting that RNA interference with HIF-1α promotes the apoptosis of PAECs. The fluorescence rate in cells at 48 and 24 h was lower compared to that at 12 h (Figure 3B).
Figure 3.
Proliferation and apoptosis of PAECs. (A) Cell density at different time after hypoxia-induced and lentivirus transfection observed by fluorescence microscope, 12 h, 24 h, 48 h means culture time of PAECs, 100×. (B) Cell apoptosis level of PAECs at different time after hypoxia-induced and lentivirus transfection stained by Hoechst 33258, Apoptotic PAECs show an intensely stained bright blue color (arrow), 12 h, 24 h, 48 h means culture time of PAECs, 100×.
Results of Transcriptome Analysis
Following sequencing quality control, a total of 141.23 Gb Clean Data was obtained, with each sample's Clean Data reaching 6.80 Gb. The percentage of Q30 bases in all samples was 93.45% and above (Table S2). The expression levels of protein-coding genes spanned 6 orders of magnitude, from 10−2 to 104, with log10 (FPKM) most commonly ranging from 0 to 2 and peaking at around 1.5 (Figure S1).
In the comparison between the NC and HRNAi groups, a total of 1070 genes showed differences in expression, 235 of which were upregulated and 835 were downregulated. Compared with the HRNAi-A group, 371 genes were upregulated and 642 genes were downregulated in the NC-A group. Furthermore, in the comparison between the NC group and NC-A group, there were 131 genes upregulated and 215 genes downregulated. Comparing the HRNAi group and the HRNAi-A group, 107 genes were upregulated and 237 genes were downregulated (Figure 4A). The differentially expressed genes (DEGs) were functionally annotated in the database, with the highest number of genes (1027 genes) being annotated in the database between the NC group and the HRNAi group. Following this, the DEGs between the NC-A group and the HRNAi-A group were annotated, with a total of 961 genes. Only 59 genes were annotated in the database between the HRNAi group and the HRNAi-A group, representing the lowest number of differential genes annotated (Table S3).
Figure 4.
Volcanic map and Statistics of GO annotation classification of DEGs. (A) Volcanic map of differentially expressed genes between groups. (B) Statistics of GO annotation classification of DEGs. NC vs. HRNAi: NC group vs. HRNAi group; NC-A vs. HRNAi-A means NC-A group vs. HRNAi-A group; NC vs. NC-A means NC group vs. NC-A group; HRNAi vs. HRNAi-A means HRNAi group vs. HRNAi-A group.
The DEGs between groups were subjected to GO enrichment analysis to classify them into 3 major subclasses Cellular Component (CC), Biological Process (BP), and Molecular Function (MF). In terms of CC, the enriched terms included cell, cell part, and membrane. Under BP, enriched terms included cellular process, single-organism process, biological regulation, stimulus response, and response to stimulus. Lastly, the enriched term under MF was binding (Figure 4B). The DEGs were primarily enriched in Environmental Information Processing (EIP) categories, including the MAPK signaling pathway, cell adhesion molecules (CAMs), and ECM-receptor interaction, In Cellular Processes, the Focal adhesion pathway was highly enriched in DEGs. Furthermore, the VEGF signaling pathway was notably enriched in the NC group compared to the HRNAi group and NC-A group (Figures 5 and 6).
Figure 5.
KEGG enrichment classification histogram. KEGG pathway classification enrichment analysis of DEGs, NC vs. HRNAi: NC group vs. HRNAi group; NC-A vs. HRNAi-A means NC-A group vs. HRNAi-A group; NC vs. NC-A means NC group vs. NC-A group; HRNAi vs. HRNAi-A means HRNAi group vs. HRNAi-A group.
Figure 6.
KEGG enrichment level bubble chart. Bubble map of KEGG enrichment level of DEGs, NC vs. HRNAi: NC group vs. HRNAi group; NC-A vs. HRNAi-A means NC-A group vs. HRNAi-A group; NC vs. NC-A means NC group vs. NC-A group; HRNAi vs. HRNAi-A means HRNAi group vs. HRNAi-A group.
Besides those DEGs that were significantly enriched to some key functional groups, we also identified other 12 specific DEGs (Figure 7) that regulated pulmonary artery remodeling and vascular contraction in this study. The analysis highlights that the ECM pathway, CAMs pathway, and MAPK pathway play essential roles in hypoxia and HIF-1α interference.
Figure 7.
BAS-specific gene transcripts in PAECs. Relative expression levels of VEGFR3, ITGA2, CLDN5, SELE, PLCB2, FGF10, BMP2, KLF2, and KLF4 in AS, NC vs. HRNAi: NC group vs. HRNAi group; NC-A vs. HRNAi-A means NC-A group vs. HRNAi-A group; NC vs. NC-A means NC group vs. NC-A group;HRNAi vs. HRNAi-A means HRNAi group vs. HRNAi-A group, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.
DISCUSSION
In this experiment, we successfully cultured primary PAECs and explored the effects of hypoxia and RNA interference with HIF-1α on the proliferation and apoptosis of PAECs, then we utilized high-throughput sequencing to investigate the relationship between ascites syndrome in broilers and the hypoxia gene HIF-1α at the transcriptome level and to search for important pathways and DEGs for the prevention and treatment of ascites syndrome in broilers.
Construction of Hypoxia Induction Model and Lentivirus Transfection
In our experiment, we simulated a real oxygen-deprived environment by lowering the concentration of oxygen. PAECs were subjected to physical hypoxia by injecting 3 gas mixtures (N2 94%, CO2 5%, O2 1%) using a hypoxia chamber. In our results, it was found that HIF-1α was significantly upregulated by hypoxia-induced. Cellular signaling pathways involving HIF-1α have been identified as universal biosensors and regulators in a variety of living cells under various hypoxic conditions (Carmeliet et al., 1998). It has been indicated that HIF-1a regulates the cellular response to hypoxia and leads to excessive angiogenesis (Huynh et al., 2023). And when hypoxia occurs, the catabolism of HIF-1α decreases, while its synthesis rate remains unchanged or increases through transcriptional or translational regulatory pathways, the concentration of HIF-1α increases rapidly, and the success of hypoxia modeling can be judged by whether the expression of HIF-1α is elevated (Fallah and Rini, 2019). We successfully constructed the PAECs hypoxia-induced model.
RNA interference is a tool that utilizes RNA interference sequences to induce the degradation of mRNA in eukaryotic cells to inhibit the expression of specific genes in the cell and to study the function of specific genes (Kim et al., 2019). In our results, the efficiency of lentiviral transfection of PAECs could reach more than 90%, and the expression of HIF-1α in PACEs was significantly downregulated by RNA interference. It has been reported that the efficiency of transfection of LUAD cells using lentiviral interference with CPSF6 can reach more than 80% (Zu et al., 2022). The methods of transfecting the interfering sequences into cells include chemical synthesis, in vitro transcription and viral vector-mediated. The first 2 methods have many drawbacks, such as low efficiency of siRNA transfection, in vitro synthesized siRNA is easily degraded, and the inhibitory effect on genes is not long-lasting. In contrast, RNA interference transfection with lentiviral vectors is highly efficient (Esposito and Craigie, 1999). We found that HIF-1α was downregulated in the interfering group within 72 h after RNA interference compared with the control group, and it has been reported in the literature that lentivirus interfered with CPSF6 and silenced CPSF6 for more than 7 d (Zu et al., 2022), which suggests that the in vivo expression of lentiviral vectors has a long-lasting inhibitory effect on genes. We observed no adverse effects on PACEs in the UP group, demonstrating that lentivirus is an efficient, durable, and safe transfection vector.
HIF-1α/VEGF Attenuates Hypoxia-Induced Proliferation of PAECs
In our results, the cell density in the hypoxia-induced group was higher than that in the normal group, from which it was known that hypoxia-induced could promote the proliferation of PAECs, and it has been reported in the literature that hypoxia could play a role in promoting cell proliferation through HIF-1α (Carmeliet et al., 1998). Then we used RNA interference technology to silence the expression of HIF-1α, and found that RNA interference with HIF-1α significantly suppress the proliferation of PAECs, which suggests that hypoxia-induced can promote the proliferation of PAECs through HIF-1α. We also examined the expression of VEGF, a proliferation-associated regulator of PAECs, and found that VEGF was upregulated by hypoxia-induced, and we silenced HIF-1α by RNA interference and found that the expression of VEGF was downregulated in a trend consistent with that of HIF-1α. It has been reported that the HIF-1α-VEGF pathway is involved in hypoxia-induced changes in endothelial cell permeability and that VEGF has a role in promoting endothelial cell proliferation (Irwin et al., 2009). Therefore, we hypothesized that HIF-1α promotes hypoxia-induced proliferation of PAECs by regulating VEGF.
HIF-1α Alleviates Hypoxia-Induced Apoptosis in PAECs
Apoptosis is an active cell death process regulated by genes (Taraseviciene-Stewart et al., 2001). In our results, the NC-A group promoted apoptosis in PAECs compared to the NC group. We found that hypoxia induces apoptosis in PAECs. It has been reported in the literature that hypoxia can regulate apoptosis through HIF-1α (Carmeliet et al., 1998). Then we used RNA interference to silence HIF-1α and found that more severe apoptosis was found to occur in PACEs after interfering with HIF-1α. Previous studies have shown that HIF-1α inhibition enhanced Nano-Ni-induced apoptosis (Yuan et al., 2023), which is consistent with our findings. We found that HIF-1α has an inhibitory effect on apoptosis of PAECs, whereas interference with HIF-1α promotes apoptosis of PAECs. Interestingly, the expression of HIF-1α was upregulated after hypoxia but still promoted apoptosis in PAECs. It was reported that Hypoxia causes apoptosis of cell via oxidative stress (Yan et al., 2023). We are of the opinion that hypoxia-induced causes oxidative stress in PAECs, and although the expression of HIF-1α was upregulated, it is possible that HIF-1α inhibits apoptosis to a limited extent and was not sufficient to completely resist the oxidative stress caused by hypoxia, thus promoting apoptosis in PAECs. Therefore, we hypothesize that hypoxia-induced promotes apoptosis of PAECs and HIF-1α inhibited apoptosis of PAECs induced by hypoxia.
ECM Pathway, CAMs Pathway, and MAPK Pathway Are Important Signaling Pathways in BAS
We used transcriptome analysis to explore the effects of hypoxia-induced and HIF-1α interference on PAECs. Combining GO enrichment with KEGG enrichment analysis revealed that biological processes and differential genes regulated by the ECM pathway, CAMs pathway, and MAPK pathway may play a key role in the growth of PAECs.
In our results, we found that the ECM receptor interaction pathway was significantly enriched in the hypoxic group compared to the normoxic group, and in the RNA interference group compared to the RNA noninterference group. It has been shown that hypoxia leads to stable expression of HIF-1α and that upregulation of HIF-1α is involved in the development of pulmonary hypertension by mediating changes in extracellular matrix (ECM) deposition (Thenappan et al., 2018). We found that some differentially expressed genes including collagens (COL4A), vitronectin, and vWF were significantly altered in the ECM pathway. Studies have shown that collagen deposition thickens the triple-layer structure of pulmonary arteries and induces pulmonary hypertension (Volkova et al., 2023). Inhibition of the HIF-1α signaling pathway reduces UCHL1-induced collagen expression in fibroblasts (Guo et al., 2023). This further confirms that HIF-1α has the potential to regulate collagen expression to modulate the growth of PAECs and influence the development of ascites syndrome in broilers. It has been reported that cells promote fibrosis by assembling vitronectin-rich extracellular ecological niches (Peng et al., 2023). The development of fibrosis is closely related to the development of BAS. However, the relationship between the action of vitronectin and HIF-1α needs to be further investigated. vWF as a marker of endothelial cells changed significantly in our results. It has been shown that the development of pulmonary hypertension in chronic thromboembolic is associated with dysregulation of the ADAMTS13-vWF axis (Newnham et al., 2019). This demonstrates that the differential expression of vWF is closely linked to the development of BAS, which is also consistent with the results we obtained. It has been reported in the literature that hypoxia induces endothelial-mesenchymal transition in endothelial cells through modulation of HIF-1α and loss of its specific markers (Wang et al., 2023). This well explains the differential expression of vWF in our results. The above facts suggest that the potential mechanism of action between ECM and HIF-1α is closely related to the development of pulmonary artery remodeling in BAS.
Cell adhesion molecules are essential for maintaining tissue formation and structural integrity. The CAMs signaling pathway was significantly enriched in our transcriptome sequencing results. Some studies demonstrated that restoration of EC shear adaptation via stabilization of PECAM-1 attenuated intimal hyperplasia in PAH animals (Szulcek et al., 2016). This suggests that CAMs play an important role in the development of pulmonary hypertension in broiler ascites syndrome. In our results, the number of differentially expressed genes enriched in the CAMs signaling pathway was 21 compared with NC-A and HRNAi-A, which suggests that relevant genes in the CAMs signaling pathway are differentially regulated by RNA interference with HIF-1α. It has been reported that HIF-1α reduced the mRNA expression of ICAM-1 and the adhesion rate of endothelial cells decreased (Zhou et al., 2023). This further corroborates our results that the mechanism of action of the CAMs signaling pathway with HIF-1α is closely related to the development of BAS. In our results, we found that the expression of ITGα8 (gene 3676) in the CAMs signaling pathway was upregulated. ITGα8, as a member of the integrin family, contributes to the development of fibrosis and plays an important role in cell motility and migration. It has been reported that the interaction between HIF-1α and ITG can contribute to the maintenance of homeostasis in tissue cells under a hypoxic environment (Xu et al., 2021). Our study suggests that HIF-1α induced by hypoxia, together with ITGα8 in the CAMs signaling pathway, may be involved in the development of ascites syndrome in broilers.
MAPK pathway coordinates various cellular activities such as cell proliferation, migration and apoptosis. MAPK pathways were significantly enriched in our results. One study found that MAPK inhibitors reversed hypoxia-induced pulmonary hypertension in rats (Silva et al., 2022). This also demonstrates a potential correlation between the MAPK signaling pathway and the development of BAS. In NC vs. NC-A, the number of DEGs enriched in the MAPK signaling pathway was 7, and in NC-A vs. HRNAi-A, the number of DEGs enriched in the MAPK signaling pathway was 24, suggesting that the relevant genes in the MAPK signaling pathway were significantly dysregulated after RNA interference with HIF-1α, also suggesting that the potential mechanism between HIF-1α and MAPK, which is important for the growth of PAECs, has an indispensable role in the development of BAS. In our results, we found some differentially expressed genes such as MKP-5(k04459, gene15562). MKP-5 regulates vascular and lymphatic permeability and plays a role in cardiac edema and hypertrophic remodeling (Bai et al., 2022). Myocardial remodeling is a hallmark pathological change in BAS, suggesting that MKP-5 is highly associated with BAS. It was reported that MKP-5 pathway is likely associated with the inhibition of hypoxia-induced HIF-1α expression by andrographolide, this implies an inextricable link between MKP-5, HIF-1α and the development of BAS (Lin et al., 2018). Overexpression of MKP-5 promotes the proliferation of cell and reduces apoptosis induced by clopidogrel exposure, demonstrating that MKP-5 have an inhibitory role in the apoptosis of cell (Wu et al., 2020). In our previous results, HIF-1α inhibited apoptosis in PAECs. This also provides an alternative mechanistic explanation for the regulation of apoptosis in PAECs induced by hypoxia by HIF-1α, that is, HIF-1α may regulate MKP-5 and inhibit hypoxia-induced apoptosis in PAECs. Therefore, we suggest that HIF-1α may be involved in hypoxia-induced apoptosis of PAECs by mediating MKP-5 and influencing pulmonary artery remodeling in BAS.
BAS-Specific Gene Transcripts in PAECs
Our study identified other important DEGs such as VEGFR3, ITGA2, CLDN5, SELE, PLCB2, FGF10, BMP2, KLF2, and KLF4, all of which play a key role in pulmonary artery remodeling and vasoconstriction, and are strongly associated with the development of BAS. VEGFR3, ITGA2 and BMP2 are all associated with angiogenesis, which is highly correlated with the development of ascites syndrome in broilers. ITGA2 has been reported to promote angiogenesis in Helicobacter pylori-induced gastric cancer, and angiogenesis is closely related to pulmonary artery remodeling in BAS, suggesting that ITGA2 is a potential gene for the prevention and treatment of BAS in broiler chickens (He et al., 2021). In our results, hypoxia induces HIF-1α and upregulates VEGF, it has been reported that BMP2 and VEGFR3 induce ectopic angiogenesis and there is an interaction between BMP2 and VEGFR3, and it has been reported that conditional endothelial-specific deletion of VEGFR3 in mice leads to impaired BMP signaling response and promotes hypoxia-induced pulmonary hypertension (Hwangbo et al., 2017; Wang et al., 2022). Therefore, we hypothesized that VEGFR3, which binds to VEGF induced by the hypoxia factor HIF-1α and interacts with BMP2, mediates the hypoxia-induced proliferation of PAECs. The importance of CLDN5 in PAH is further emphasized by the findings that Hypoxia treatment for 45 min induces vascularization by triggering downregulation of claudin-5 in zebrafish cerebral vascular endothelial cells (Liu et al., 2023). Hypoxia has been shown to disrupt the membrane localization of Cl-5 and ZO-1 in cerebral capillary endothelial cells in vitro through HIF-1α (Ozgur et al., 2022). However, the potential mechanism of how HIF-1α mediates the regulation of the growth of PAECs by CLDN5, and the modulation of pulmonary arteriolar remodeling in BAS, still remains to be further investigated. In previous studies, PLCB2 was shown to be involved in the formation of vascular networks during embryonic development, which showed potential relevance to BAS prevention (Maeng et al., 2009). It has been reported that FGF can regulate various biological processes such as angiogenesis by controlling the proliferation of target cells, which can prevent and reverse the progression of severe PAH and vascular remodeling, implying that FGF10 has great potential to prevent and control BAS (Yang et al., 2021). In a previous report, SELE was highly associated with BAS, which is also consistent with our results, implying that SELE is a key gene in BAS (Xing et al., 2021). It has been shown that KLF2 is expressed only in endothelial cells and is associated with inhibition of endothelial cell apoptosis and suppression of vascular endothelial growth factor-induced angiogenesis. KLF4 is known to regulate phenotypic shifts in vascular smooth muscle cells by repressing marker genes in vascular smooth muscle cells, and KLF2 and KLF4, as master transcription factors in endothelial cells, play important roles in the pathogenesis of BAS (Sindi et al., 2020; Zhang et al., 2022). These genes may play important roles in pulmonary artery remodeling and angiogenesis and contribute to the prevention of BAS, making them potentially promising candidate genes.
CONCLUSIONS
This work provided new insights into the pathogenesis of BAS and showed that hypoxic conditions significantly promoted the proliferation and apoptosis of PAECs. HIF-1α promoted the proliferation and inhibited the apoptosis of PAECs. Transcriptome analysis is very helpful to study the pathogenesis of BAS. We analyzed the transcriptome results and found that the ECM, CAMs, and MAPK pathways were significantly altered, and HIF-1α may regulate genes such as COL4A, vitronectin, vWF, ITGα8, and MKP-5 to affect the growth of PAECs, and I also analyzed many important DEGs such as VEGFR3, ITGA2, and CLDN5, etc. Our results provide valuable information for understanding the molecular mechanism of hypoxia-induced BAS, which provides an important reference for drug screening and selection of therapeutic targets for the prevention and treatment of BAS, as well as ideas for the treatment of hypertension in humans.
ACKNOWLEDGMENTS
This project was supported by the Regional Science Fund Project (no. 31960723), Jiangxi Provincial Natural Science Foundation General Project (no. 20224BAB205033), the Science and Technology Research Project of Jiangxi Provincial Department of Education (no. GJJ2200406).
Author Contributions: Wen Peng: Conceptualization, Formal analysis, Methodology, Writing - original draft, Software, Validation, Visualization, Writing - review & editing; Weile Fang: Conceptualization, Data curation, Methodology, Software, Validation, Writing - original draft; Xiaona Gao: Methodology, Supervision, Writing - review & editing; Xiaoquan Guo: Validation, Data curation; Guyue Li: Funding acquisition, Resources; Fengping Guo: Project administration, Data curation; Guoliang Hu: Funding acquisition, Resources; Yu Zhuang: Validation, Data curation; Lin Li: Validation, Data curation; Chenxi Jiang: Visualization, Software; Ping Liu: Conceptualization, Funding acquisition, Resources, Supervision, Writing - review & editing.
DISCLOSURES
The authors declare that they have no conflict of interest. The funders had no role in study design, data collection, and interpretation or in the decision to submit the work for publication.
Footnotes
Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2023.103388.
Appendix. Supplementary materials
Figure S1 Comparison of FPKM distribution and density distribution of each sample. (A) FPKM box line plot of each sample. (B) FPKM density distribution comparison plot of each sample.
References
- Bai J., Yin L., Yu W.J., Zhang Y.L., Lin Q.Y., Li H.H. Angiotensin II induces cardiac edema and hypertrophic remodeling through lymphatic-dependent mechanisms. Oxid. Med. Cell. Longev. 2022;2022 doi: 10.1155/2022/5044046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carmeliet P., Dor Y., Herbert J.M., Fukumura D., Brusselmans K., Dewerchin M., Neeman M., Bono F., Abramovitch R., Maxwell P., Koch C.J., Ratcliffe P., Moons L., Jain R.K., Collen D., Keshert E. Role of HIF-1alpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature. 1998;394:485–490. doi: 10.1038/28867. [DOI] [PubMed] [Google Scholar]
- Esposito D., Craigie R. HIV integrase structure and function. Adv. Virus Res. 1999;52:319–333. doi: 10.1016/s0065-3527(08)60304-8. [DOI] [PubMed] [Google Scholar]
- Evans C.E., Cober N.D., Dai Z., Stewart D.J., Zhao Y.Y. Endothelial cells in the pathogenesis of pulmonary arterial hypertension. Eur. Respir. J. 2021;58 doi: 10.1183/13993003.03957-2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fallah J., Rini B.I. HIF inhibitors: status of current clinical development. Curr. Oncol. Rep. 2019;21:6. doi: 10.1007/s11912-019-0752-z. [DOI] [PubMed] [Google Scholar]
- Guo C., Liang L., Zheng J., Xie Y., Qiu X., Tan G., Huang J., Wang L. UCHL1 aggravates skin fibrosis through an IGF-1-induced Akt/mTOR/HIF-1alpha pathway in keloid. FASEB J. 2023;37:e23015. doi: 10.1096/fj.202300153RR. [DOI] [PubMed] [Google Scholar]
- Hao S., Zhao H., Hao D.H., Ferreri N.R. MicroRNA-195a-5p regulates blood pressure by inhibiting NKCC2A. Hypertension. 2023;80:426–439. doi: 10.1161/HYPERTENSIONAHA.122.19794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- He L., Wang W., Shi H., Jiang C., Yao H., Zhang Y., Qian W., Lin R. THBS4/integrin alpha2 axis mediates BM-MSCs to promote angiogenesis in gastric cancer associated with chronic Helicobacter pylori infection. Aging (Albany NY) 2021;13:19375–19396. doi: 10.18632/aging.203334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huynh K.N., Rao S., Roth B., Bryan T., Fernando D.M., Dayyani F., Imagawa D., Abi-Jaoudeh N. Targeting hypoxia-inducible factor-1alpha for the management of hepatocellular carcinoma. Cancers (Basel) 2023;15:2738. doi: 10.3390/cancers15102738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hwangbo C., Lee H.W., Kang H., Ju H., Wiley D.S., Papangeli I., Han J., Kim J.D., Dunworth W.P., Hu X., Lee S., El-Hely O., Sofer A., Pak B., Peterson L., Comhair S., Hwang E.M., Park J.Y., Thomas J.L., Bautch V.L., Erzurum S.C., Chun H.J., Jin S.W. Modulation of endothelial bone morphogenetic protein receptor type 2 activity by vascular endothelial growth factor receptor 3 in pulmonary arterial hypertension. Circulation. 2017;135:2288–2298. doi: 10.1161/CIRCULATIONAHA.116.025390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Irwin D.C., McCord J.M., Nozik-Grayck E., Beckly G., Foreman B., Sullivan T., White M., J. J. T C., Bailey D., Flores S.C., Majka S., Klemm D., van Patot M.C. A potential role for reactive oxygen species and the HIF-1alpha-VEGF pathway in hypoxia-induced pulmonary vascular leak. Free Radic. Biol. Med. 2009;47:55–61. doi: 10.1016/j.freeradbiomed.2009.03.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ke Q., Costa M. Hypoxia-inducible factor-1 (HIF-1) Mol. Pharmacol. 2006;70:1469–1480. doi: 10.1124/mol.106.027029. [DOI] [PubMed] [Google Scholar]
- Kim D., Reyes-Ordonez A., Chen J. Lentivirus-mediated RNAi in skeletal myogenesis. Methods Mol. Biol. 2019;1889:95–110. doi: 10.1007/978-1-4939-8897-6_7. [DOI] [PubMed] [Google Scholar]
- Li Y., Ren W., Wang X., Yu X., Cui L., Li X., Zhang X., Shi B. MicroRNA-150 relieves vascular remodeling and fibrosis in hypoxia-induced pulmonary hypertension. Biomed. Pharmacother. 2019;109:1740–1749. doi: 10.1016/j.biopha.2018.11.058. [DOI] [PubMed] [Google Scholar]
- Lin H.C., Su S.L., Lin W.C., Lin A.H., Yang Y.C., Lii C.K., Chen H.W. Andrographolide inhibits hypoxia-induced hypoxia-inducible factor 1alpha and endothelin 1 expression through the heme oxygenase 1/CO/cGMP/MKP-5 pathways in EA.hy926 cells. Environ. Toxicol. 2018;33:269–279. doi: 10.1002/tox.22514. [DOI] [PubMed] [Google Scholar]
- Liu Q., Song T., Chen B., Zhang J., Li W. Ferroptosis of brain microvascular endothelial cells contributes to hypoxia-induced blood-brain barrier injury. FASEB J. 2023;37:e22874. doi: 10.1096/fj.202201765R. [DOI] [PubMed] [Google Scholar]
- Maeng Y.S., Choi H.J., Kwon J.Y., Park Y.W., Choi K.S., Min J.K., Kim Y.H., Suh P.G., Kang K.S., Won M.H., Kim Y.M., Kwon Y.G. Endothelial progenitor cell homing: prominent role of the IGF2-IGF2R-PLCbeta2 axis. Blood. 2009;113:233–243. doi: 10.1182/blood-2008-06-162891. [DOI] [PubMed] [Google Scholar]
- Newnham M., South K., Bleda M., Auger W.R., Barbera J.A., Bogaard H., Bunclark K., Cannon J.E., Delcroix M., Hadinnapola C., Howard L.S., Jenkins D., Mayer E., Ng C., Rhodes C.J., Screaton N., Sheares K., Simpson M.A., Southwood M., Su L., Taboada D., Traylor M., Trembath R.C., Villar S.S., Wilkins M.R., Wharton J., Graf S., Pepke-Zaba J., Laffan M., Lane D.A., Morrell N.W., Toshner M. The ADAMTS13-VWF axis is dysregulated in chronic thromboembolic pulmonary hypertension. Eur. Respir. J. 2019;53 doi: 10.1183/13993003.01805-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ozgur B., Helms H., Tornabene E., Brodin B. Hypoxia increases expression of selected blood-brain barrier transporters GLUT-1, P-gp, SLC7A5 and TFRC, while maintaining barrier integrity, in brain capillary endothelial monolayers. Fluids Barriers CNS. 2022;19:1. doi: 10.1186/s12987-021-00297-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peng Y., Li L., Shang J., Zhu H., Liao J., Hong X., Hou F.F., Fu H., Liu Y. Macrophage promotes fibroblast activation and kidney fibrosis by assembling a vitronectin-enriched microenvironment. Theranostics. 2023;13:3897–3913. doi: 10.7150/thno.85250. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rahimi M., Rahimi S., Karimi T.M., Sharafi M., Masoudi A.A., Grimes J.L. Peroxisome proliferator-activated receptor gamma (PPARgamma) activation: a potential treatment for ascites syndrome in broiler chickens. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Silva G.F., Da S.J., de Alencar A., de Moraes C.D.S.M., Montagnoli T.L., de Souza R.B., de Freitas R., Sudo R.T., Fraga C., Zapata-Sudo G. Novel p38 mitogen-activated protein kinase inhibitor reverses hypoxia-induced pulmonary arterial hypertension in rats. Pharmaceuticals (Basel) 2022;15:900. doi: 10.3390/ph15070900. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sindi H.A., Russomanno G., Satta S., Abdul-Salam V.B., Jo K.B., Qazi-Chaudhry B., Ainscough A.J., Szulcek R., Jan B.H., Morgan C.C., Pullamsetti S.S., Alzaydi M.M., Rhodes C.J., Piva R., Eichstaedt C.A., Grunig E., Wilkins M.R., Wojciak-Stothard B. Therapeutic potential of KLF2-induced exosomal microRNAs in pulmonary hypertension. Nat. Commun. 2020;11:1185. doi: 10.1038/s41467-020-14966-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Szulcek R., Happe C.M., Rol N., Fontijn R.D., Dickhoff C., Hartemink K.J., Grunberg K., Tu L., Timens W., Nossent G.D., Paul M.A., Leyen T.A., Horrevoets A.J., de Man F.S., Guignabert C., Yu P.B., Vonk-Noordegraaf A., van Nieuw A.G., Bogaard H.J. Delayed microvascular shear adaptation in pulmonary arterial hypertension. Role of platelet endothelial cell adhesion molecule-1 cleavage. Am. J. Respir. Crit. Care Med. 2016;193:1410–1420. doi: 10.1164/rccm.201506-1231OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Taraseviciene-Stewart L., Kasahara Y., Alger L., Hirth P., Mc M.G., Waltenberger J., Voelkel N.F., Tuder R.M. Inhibition of the VEGF receptor 2 combined with chronic hypoxia causes cell death-dependent pulmonary endothelial cell proliferation and severe pulmonary hypertension. FASEB J. 2001;15:427–438. doi: 10.1096/fj.00-0343com. [DOI] [PubMed] [Google Scholar]
- Thenappan T., Chan S.Y., Weir E.K. Role of extracellular matrix in the pathogenesis of pulmonary arterial hypertension. Am. J. Physiol. Heart Circ. Physiol. 2018;315:H1322–H1331. doi: 10.1152/ajpheart.00136.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Volkova E., Procell L., Kong L., Santhanam L., Gerecht S. Vascular stiffening in aging females with a hypertension-induced HIF2A gain-of-function mutation. Bioeng. Transl. Med. 2023;8:e10403. doi: 10.1002/btm2.10403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang C., Xing Y., Zhang J., He M., Dong J., Chen S., Wu H., Huang H.Y., Chou C.H., Bai L., He F., She J., Su A., Wang Y., Thistlethwaite P.A., Huang H.D., Yuan J.X., Yuan Z.Y., Shyy J.Y. MED1 regulates BMP/TGF-beta in endothelium: implication for pulmonary hypertension. Circ. Res. 2022;131:828–841. doi: 10.1161/CIRCRESAHA.122.321532. [DOI] [PubMed] [Google Scholar]
- Wang E.L., Zhang J.J., Luo F.M., Fu M.Y., Li D., Peng J., Liu B. Cerebellin-2 promotes endothelial-mesenchymal transition in hypoxic pulmonary hypertension rats by activating NF-kappaB/HIF-1alpha/Twist1 pathway. Life Sci. 2023;328 doi: 10.1016/j.lfs.2023.121879. [DOI] [PubMed] [Google Scholar]
- Wang Z., Yang K., Zheng Q., Zhang C., Tang H., Babicheva A., Jiang Q., Li M., Chen Y., Carr S.G., Wu K., Zhang Q., Balistrieri A., Wang C., Song S., Ayon R.J., Desai A.A., Black S.M., Garcia J., Makino A., Yuan J.X., Lu W., Wang J. Divergent changes of p53 in pulmonary arterial endothelial and smooth muscle cells involved in the development of pulmonary hypertension. Am. J. Physiol. Lung Cell Mol. Physiol. 2019;316:L216–L228. doi: 10.1152/ajplung.00538.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu H., Ming W., Tan J., Lu Q., Mulmi S.S., Li N., Wu G., Zhang Z., Shi R. Role of MKP-5-p38/MAPK pathway in clopidogrel-induced gastric mucosal epithelial cells apoptosis and tight junction dysfunction. Am. J. Transl. Res. 2020;12:1741–1753. [PMC free article] [PubMed] [Google Scholar]
- Xing Y., Zhao J., Zhou M., Jing S., Zhao X., Mao P., Qian J., Huang C., Tian Z., Wang Q., Zeng X., Li M., Yang J. The LPS induced pyroptosis exacerbates BMPR2 signaling deficiency to potentiate SLE-PAH. FASEB J. 2021;35:e22044. doi: 10.1096/fj.202100851RR. [DOI] [PubMed] [Google Scholar]
- Xu Z., Zheng J., Zhang Y., Wu H., Sun B., Zhang K., Wang J., Zang F., Zhang X., Guo L., Wu X. Increased expression of integrin alpha 6 in nucleus pulposus cells in response to high oxygen tension protects against intervertebral disc degeneration. Oxid. Med. Cell Longev. 2021;2021 doi: 10.1155/2021/8632823. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yan T., Li X., Wang X., Zhang Y., He B., Jia Y., Xiao W. Rhodiola wallichiana var.cholaensis protects against myocardial ischemia-reperfusion injury by attenuating oxidative stress-mediated apoptosis via enhancing Nrf2 signaling. Int. J. Cardiol. 2023;384:62–73. doi: 10.1016/j.ijcard.2023.05.014. [DOI] [PubMed] [Google Scholar]
- Yang G., Huang C., Cao J., Huang K.J., Jiang T., Qiu Z.J. Lentivirus-mediated shRNA interference targeting STAT3 inhibits human pancreatic cancer cell invasion. World J. Gastroenterol. 2009;15:3757–3766. doi: 10.3748/wjg.15.3757. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang L., Zhou F., Zheng D., Wang D., Li X., Zhao C., Huang X. FGF/FGFR signaling: from lung development to respiratory diseases. Cytokine Growth Factor Rev. 2021;62:94–104. doi: 10.1016/j.cytogfr.2021.09.002. [DOI] [PubMed] [Google Scholar]
- Yu J., Liu X., Wang K., Wang H., Han Y., Kang J., Deng R., Zhou H., Duan Z. Underlying mechanism of Qiling Jiaogulan Powder in the treatment of broiler ascites syndrome. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yuan J., Mo Y., Zhang Y., Zhang Y., Zhang Q. Nickel nanoparticles induce autophagy and apoptosis via HIF-1alpha/mTOR signaling in human bronchial epithelial cells. Environ. Pollut. 2023;329 doi: 10.1016/j.envpol.2023.121670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang J., Feng X., Zhao L., Wang W., Gao M., Wu B., Qiao J. Expression of hypoxia-inducible factor 1alpha mRNA in hearts and lungs of broiler chickens with ascites syndrome induced by excess salt in drinking water. Poult. Sci. 2013;92:2044–2052. doi: 10.3382/ps.2013-03097. [DOI] [PubMed] [Google Scholar]
- Zhang L., Li Y.M., Zeng X.X., Wang X.Y., Chen S.K., Gui L.X., Lin M.J. Galectin-3-mediated transdifferentiation of pulmonary artery endothelial cells contributes to hypoxic pulmonary vascular remodeling. Cell Physiol. Biochem. 2018;51:763–777. doi: 10.1159/000495331. [DOI] [PubMed] [Google Scholar]
- Zhang X., Zheng B., Zhao L., Shen J., Yang Z., Zhang Y., Fan R., Zhang M., Ma D., Zheng L., Zhao M., Liu H., Wen J. KLF4-PFKFB3-driven glycolysis is essential for phenotypic switching of vascular smooth muscle cells. Commun. Biol. 2022;5:1332. doi: 10.1038/s42003-022-04302-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao H., Han Y., Jiang N., Li C., Yang M., Xiao Y., Wei L., Xiong X., Yang J., Tang C., Xiao L., Liu F., Liu Y., Sun L. Effects of HIF-1alpha on renal fibrosis in cisplatin-induced chronic kidney disease. Clin. Sci. (Lond) 2021;135:1273–1288. doi: 10.1042/CS20210061. [DOI] [PubMed] [Google Scholar]
- Zhou X., Tang Y., Cao T., Ning L., Li Y., Xie X., Hu Y., He B., Peng B., Liu S. Treponema pallidum lipoprotein Tp0768 promotes the migration and adhesion of THP-1 cells to vascular endothelial cells through stress of the endoplasmic reticulum and the NF-kappaB/HIF-1alpha pathway. Mol. Microbiol. 2023;119:86–100. doi: 10.1111/mmi.15010. [DOI] [PubMed] [Google Scholar]
- Zu Y., Wang D., Ping W., Sun W. The roles of CPSF6 in proliferation, apoptosis and tumorigenicity of lung adenocarcinoma. Aging (Albany NY) 2022;14:9300–9316. doi: 10.18632/aging.204407. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1 Comparison of FPKM distribution and density distribution of each sample. (A) FPKM box line plot of each sample. (B) FPKM density distribution comparison plot of each sample.







