Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Feb 20;103(5):103576. doi: 10.1016/j.psj.2024.103576

Microbial profile of broiler carcasses processed at a university scale mobile poultry processing unit

Rebecca Stearns *, Kristina Bowen *, Robert L Taylor Jr *, Joe Moritz *, Kristen Matak *, Janet Tou *, Annette Freshour *, Jacek Jaczynski *, Timothy Boltz †, Xiang Li ‡, Carly Long *, Cangliang Shen *,1
PMCID: PMC10912918  PMID: 38430779

Abstract

Chicken and chicken products have been associated with foodborne pathogens such as Salmonella, Campylobacter, and Escherichia coli (E. coli). Poultry comprises an important segment of the agricultural economy (75 million birds processed as of 2019) in West Virginia (WV). The risk of pathogens on processed chickens has risen with the increased popularity of mobile poultry processing units (MPPUs). This study evaluated the microbial safety of broilers processed in a MPPU in WV. This study assessed aerobic plate counts (APCs), E. coli counts and the presence/absence of Salmonella and Campylobacter on 96 broiler carcasses following each MPPU step of scalding, eviscerating, and chilling. Samples were either chilled in ice water only (W) or ice water with 5 ppm chlorine (CW). The highest number of bacteria recovered from carcasses were APCs (4.21 log10CFU/mL) and E. coli (3.77 log10CFU/mL; P = 0.02). A total reduction of 0.30 (P = 0.10) and 0.63 (P = 0.01) log10CFU/mL for APCs and E. coli, respectively, occurred from chilling carcasses in CW. Overall, results show that E. coli, Salmonella, and Campylobacter were significantly (P < 0.05) reduced from the initial scalding to the chilling step. However, Salmonella frequency doubled (15.63–34.38%) after the evisceration step, indicating that washing carcasses after evisceration may be a critical control point in preventing cross-contamination by Salmonella. Proper chilling is also an important microbial mitigation step in MPPU processing. Results indicate that Campylobacter was more resistant to chilling than Salmonella. Campylobacter was not completely inactivated until carcasses were chilled in CW, whereas W was sufficient to reduce Salmonella on carcasses. The results led to the conclusion that although 5 ppm chlorine (Cl2) achieved more bacterial reductions than water alone, the reductions were not always significant (P > 0.05). Further MPPU studies are needed to verify more effective chilling and processing strategies.

Key words: Mobile poultry processing, Salmonella, Campylobacter, broilers

INTRODUCTION

Chicken is the most consumed meat (Centers for Disease Control and Prevention, 2022) in the U.S. and the second most consumed in the world (33%) according to the U.S.-Centers for Disease Control and Prevention (CDC) and the United States Department of Agriculture (USDA) (United States Department of Agriculture, 2023). The National Chicken Council (NCC) forecasts that U.S. broiler consumption will increase from 45.5 kg in 2023 to 45.9 kg per capita in 2024. Broiler consumption has increased dramatically since the 1960s (10.7 kg) per capita (National Chicken Council, 2022) due to multiple factors, including population growth, increased convenience of chicken products (i.e., boneless and pre-cooked), nutritional aspects compared to other meats, and affordability compared to beef (United States Department of Agriculture Economic Research Service, 2012).

Despite its popularity and benefits, poultry is the meat commodity attributed to the highest rate of bacterial foodborne illness (18%) and fatalities in the U.S. (19%) (Painter et al., 2013; Lianou et al., 2017). The CDC estimates that 1 million people a year in the U.S. get sick from contaminated chicken (Centers for Disease Control and Prevention, 2022). More poultry-related foodborne illness fatalities in the U.S. were associated with Salmonella spp. than other bacteria in 1998 to 2008 (Painter et al., 2013). The most common microbes associated with contaminated chicken were Campylobacter and Salmonella. (Centers for Disease Control and Prevention, 2022). According to the U.S. Food and Drug Administration (FDA) 2018 National Antimicrobial Resistance Monitoring Systems (NARMS) report, approximately 1 in 25 packages of chicken were contaminated with Salmonella (United States Food and Drug Administration, 2020). A 1998 to 2012 analysis revealed that 25% of the 1,114 foodborne illness outbreaks in the U.S. originated from poultry sources. Approximately 7% of the 149 outbreaks were traced to the pathogen Campylobacter spp. (Chai et al., 2017; Wessels et al., 2021). Since 2013, there have been approximately 9 Salmonellosis outbreak incidents out of the 1,087 reported foodborne illnesses related to chicken and chicken products (Centers for Disease Control and Prevention, 2019b). Additionally, the CDC reported one outbreak of Shiga toxin-producing Escherichia coli O157:H7 (STEC O157:H7) from rotisserie chicken salad that affected 19 individuals in 2015 (Centers for Disease Control and Prevention, 2019a) and one outbreak of Campylobacter jejuni (C. jejuni) from chicken liver pâté that caused 3 known foodborne illnesses in 2013 to 2014 (Marus, 2019).

Since chicken serves as an excellent reservoir for pathogens, it is essential poultry processors understand the contamination risks and implement methods to reduce those risks (Wessels et al., 2021). The need for safe poultry processing has increased in West Virginia (WV) due to the integration of mobile poultry processing units (MPPUs) or trailers made available for small-quantity poultry processors by the WV Famers Market Association (WV-FMA) (Jones, 2020). Interest in pasture raised poultry production and on-farm mobile poultry processing has risen rapidly in the past two decades due to a growing demand for locally grown products (Mancinelli et al., 2018). Currently, the United States Department of Agriculture-Food Safety and Inspection Service (USDA-FSIS) allows small-quantity, local producers to harvest ≤20,000 poultry on-farm with an exemption from inspection each calendar year. Recently, some Mid-Atlantic states, including Kentucky, Pennsylvania, Ohio, and Massachusetts, started offering MPPUs for individual small farm processors to raise and process ≤20,000 broilers per year for local and intrastate direct-to-consumer sales (Li et al., 2017).

According to the WV Department of Agriculture (WVDA), poultry products account for most of the livestock inventory in WV. Annual broiler production in WV reached 83.3 million birds in 2018 and 75 million birds in 2019, which totaled a value of $176.9 million for those years (West Virginia Department of Agriculture, 2020). Currently, WV ranks 14th in the nation in broiler production (West Virginia Department of Agriculture, 2020). Most of the commercial poultry production in WV takes place in the eastern part of the state, with Hardy County producing approximately half of the broilers in that area (West Virginia Department of Agriculture, 2020; 2021). Additionally, a significant increase in direct-to-consumer sales of locally pastured poultry products at farmers markets has generated positive economic impacts for WV broiler producers.

As locally grown, pastured poultry gains popularity over time, understanding microbial risks to poultry safety and evaluating relevant strategies to mitigate such risks becomes increasingly important. Currently, concerns exist on whether products processed by an MPPU for sale at farmers markets would increase food safety risks. Several studies evaluated the presence of foodborne pathogens in poultry products from an MPPU, confirming a need to assess the safety status of products processed by these mobile poultry harvest operations. A microbiological survey reported that 100% of the 180 small-scale pasture-raised broilers processed in an MPPU pilot plant in a southeast state were positive for Campylobacter spp. (Trimble et al., 2013). The MPPU processed poultry products vary based on the variety of available equipment, producer resources, and facilities. This diversity, along with the absence of regulatory guidance, failed to yield data necessary to validate the safety of poultry products, including raw chicken/broiler carcasses, generated by the MPPU. Microbial profiles of broilers processed by available commercial MPPU's are needed to develop MPPU-Good Manufacturing Practices/Sanitizing Standard Operation Procedures (GMPs/SSOPs) and Hazard Analysis Critical Control Points (HACCP) plans.

Therefore, the objectives of this study are to characterize the microbial quality of broilers (total aerobic plate counts and generic Escherichia coli), and the presence/absence of Salmonella and Campylobacter after processing in a university scale MPPU.

MATERIALS AND METHODS

Rearing of Broiler Chickens

This study tested 96 birds raised at the WVU Poultry Farm (Morgantown, WV) for APCs, generic E. coli, Campylobacter, and Salmonella spp. All animals were reared according to protocols approved by WVU Animal Care and Use Committee (IACUC Protocol #1602000612.1). The flock consisted of day-old male Hubbard × Ross 308 chicks obtained from a commercial hatchery (Myers Poultry, South Fork, PA). All chicks were vaccinated against Mareck's disease and coccidiosis before arrival. The chicks were allocated to identical floor pens within 3 rooms (32 pens per room). The stocking density for flocks was 18 to 21 chickens per pen. The pens were 0.8 m wide and 2.4 m long. Each room was cross-ventilated with negative pressure and heated via forced air. Prior to chick placement, the rooms were heated to 32℃ and gradually decreased (1°C decrease per week) for optimal rearing conditions. Other housing conditions included a decreasing light program as well as feed and water for ad libitum consumption via hoppers and nipple drinkers (2 per pen), respectively. The lighting schedule was as follows: 24L:0D from d0 to d3, 23L:1D from d4 to d7, 20L:4D from d8 to d24, and 18L:6D from d25 to d35 (Boney and Moritz, 2017). The feed was provided by the WVU pilot mill and consisted of 54.3% corn, 37.5% soybean meal, 3.9% soybean oil, 22.2% crude protein, and 3021 kcal/kg. Feed was restricted 8 h prior to slaughter. Built-up litter originating from a commercial barn was utilized in the floor pens. The litter utilized was windrowed, and each pile attained a minimum internal temperature of 54°C and was turned once temperatures began to drop. Once the piles reached an internal temperature of 54°C for a second time, the litter was evenly spread in the pens. One day prior to bird placement, the litter was top-dressed with fresh pine shavings and treated with a commercially available acidifier to reduce ammonia emissions. Flocks were reared for 49 d in the winter season.

Broiler Carcasses Processing at the Enclosed MPPU Facility

The MPPU facility was enclosed and consisted of a kill line conveyor, scalder, plucker, stainless steel table (used for manual evisceration), 2-compartment sink, and walk-in refrigerator. After euthanasia, broilers were hung on shackles, exsanguinated and then processed (Figure 1). Prior to exsanguination, a stun knife was used and a V jugularis cut was made. The broilers were then allowed to bleed out for several minutes before placing in the scalder. The weight of the broilers ranged from 3.82 to 4.16 kg. The MPPU processing occurred in the following order: 1) exsanguination for 60 s; 2) scalding in the scalder (Brower, IA) for 60 s at 62.8°C; 3) de-feathering (Ashley Machine Inc., IN); 4) manual evisceration; and 5) carcass chilling at 1.7–2.8°C for 24 h. Thirty-two birds were processed after the 3 steps, scalding/defeathering, evisceration, and chilling, totaling 96 total samples.

Figure 1.

Figure 1

Open in a new tab

Mobile poultry processing unit (MPPU) processing line steps.

The chilling methods used in this study were ice water (W) or ice water with the addition of 5 ppm Cl2 (CW). Both the W and CW baths were prepared in 167 L containers filled with 133 L municipal water (Morgantown, WV) and ice. The temperature of the chill containers was measured using a probe thermometer (Exergen Corporation, Watertown, MA). The W and CW initial temperatures were 1.39 to 1.89°C and 1.50 to 1.94°C, respectively. All chilling tanks were placed in a walk-in cooler for 24 h. The average temperatures of the chill tanks after 24 h were 4.2 to 4.5°C for W and 4.3 to 4.6°C for CW, respectively. Prior to immersion chilling, chicken samples were rinsed in running tap water to remove visible debris.

Preparation of Microbial Analysis

Thirty-two fresh carcass samples were taken after each of the 3 steps, scalding/de-feathering, eviscerating, and chilling. De-feathering occurred immediately following scalding via an automatic process so scalding samples were taken after carcasses were automatically plucked by the machine. The 32 chilled carcasses and 32 chill water samples taken from the last step were equally divided by the W (16 samples) and CW (16 samples) chill tanks, totaling 16 carcasses and water samples for each type of chill tank. After each step, samples were placed in a sterile poultry sampling bag (VWR, PA) containing 400 ml sterile tryptic soy broth (TSB, Hardy Diagnostics, MD) followed by vigorously shaking the bag for 30 s to detach bacteria from the carcasses. The rinse from each bag was poured into sterile containers, sealed tightly, and then immediately transported to the WVU food microbiology lab (8 km apart) for microbial analysis. Chill water samples were also collected from the W and CW tanks after the carcasses had chilled 24h. Total aerobic plate counts (APCs) and generic E. coli populations were tested on petri-films, and the presence/absence of Salmonella and Campylobacter spp. were determined by using the modified U.S. Food and Drug Administration's Bacteriological Analytical Manual (FDA's-BAM) and PCR method.

APCs and Generic E. coli Analysis

The APCs and generic E. coli plate counts were conducted on 3M petri-films (St. Paul, MN). Before manually counting the colonies, the rinse samples were serially diluted using 0.1% sterilized buffered peptone water (BPW, Hardy Diagnostics, Santa Maria, CA) and plated onto petri-films and incubated at 35°C (New Brunswick Scientific Co., NJ) for 24 h.

Determination of the Presence of Salmonella on Broiler Carcasses

Samples post-scalding and post evisceration were tested for the presence/ absence of Salmonella spp. using the PCR protocol (Jawad and Al-Charrakh, 2016). Chilled samples were first assessed using the modified FDA's-BAM method and then the presumptive positive samples were confirmed using PCR. A total of 32 post-chilled broiler carcasses and 32 chill water samples (16 W and 16 CW samples) were tested using the modified FDA's-BAM method. All samples were tested in duplicate. Samples were first pre-enriched in BPW for 24 h at 35°C. Then 0.1 mL of pre-enriched cultures were added to Rappaport Vassiliadis broth (RV, Hardy Diagnostics, Santa Maria, CA) and incubated for another 24 h at 42°C. Subcultures from the enrichment broth were then streak-plated on HardyCHROM Salmonella / XLT-4 Agar bi-plates (Hardy Diagnostics, Santa Maria, CA) and incubated for 24 h at 35°C. Presumptive Salmonella spp. cells were isolated and re-streaked on XLT-4 agar and incubated under the conditions mentioned. PCR testing was not conducted on chilled samples unless microbial analysis revealed positive cell growth of Salmonella (refer to PCR protocol section below).

Determination of the Presence of Campylobacter spp. on Broiler Carcasses

Post-scalded and eviscerated samples were tested for the presence/ absence of Campylobacter spp. using the PCR protocol. Chilled samples were first assessed using the modified FDA's-BAM method and then the presumptive positive samples were visually confirmed using PCR. Campylobacter spp. was assessed on a total of 32 postchilled broiler carcasses and 32 chill water samples. All samples were tested in duplicate. Similar to the analysis of Salmonella, PCR testing was not conducted on chilled samples unless microbial analysis was positive for Campylobacter colonies. Five milliliters of the rinse samples from chilled carcasses were enriched with 5 mL Bolton broth (Thermo Scientific, IL) in sterile 15 mL centrifuge tubes, sealed tightly, and incubated at 42°C for 48 h. After the enrichment tubes were incubated, 10-fold dilutions of each sample were prepared, and 100-μL aliquots were directly spread plated onto Campy FDA agar (FDA, Hardy Diagnostics, PA). All plates were incubated at 42°C for 48 h. A microaerobic atmosphere (85% nitrogen, 10% carbon dioxide, and 5% oxygen) was created to incubate agar plates using Campy gas sachets and sealed containers (United States Department of Agriculture Food Safety and Inspection Service, 2021). After initial incubation, presumptive Campylobacter spp. cells were isolated, re-streaked on FDA agar, and incubated under the same conditions as before. The presence/ absence of presumptive cells was recorded and confirmed using PCR (refer to PCR protocol section below).

Preparation of Bacteria Cultures for PCR Testing

All poultry rinse samples were placed in the freezer at −20°C for 24 h to equilibrate before storing at −80°C until PCR was performed. The rinse samples being tested were thawed in a walk-in refrigerator at 2°C for 48 h before PCR testing. All samples from the scalding (n = 32) and evisceration (n = 32) processing steps plus those chilled samples (n = 4) that were positive for cell growth were tested using the PCR protocol. After thawing, 20 ml samples were extracted and added to sterile 50 mL centrifuge tubes containing 20 mL fresh TSB or Bolton broth for suspected Salmonella and Campylobacter samples, respectively. The tubes were incubated for 24 h at 35 and 42°C for suspected Salmonella and Campylobacter samples, respectively. Samples were tested in duplicate. Salmonella Typhimurium (S. Typhimurium ATCC 14028) and Campylobacter jejuni (C. jejuni ATCC RM5032, RM1188, and RM1464) were used as positive controls in this PCR protocol.

PCR Primer Sequences

In this study, primers (Integrate DNA Technologies, IA) targeting and amplifying the16S rRNA (5′- ATCTAATGGCTTAACCATTAAAC - 3′) (3′- GGACGGTAACTAGTTTAGTATT – 5′) and mapA (5′- CTATTTTATTTTGAGTGCTTGTG- 3′) (3′ -GCTTTATTTGCCATTTGTTTTATTA - 5′) gene of Campylobacter and the ompC gene (5′- ACCGCTAACGCTCGCCTGTAT - 3′) (3′- AGAGGTGGACGGGTTGCTGCCGTT - 5′) of Salmonella were used. The primers were tested against positive (pure cultures) and negative (H2O) controls as references. The expected amplicon size of mapA, 16S rRNA, and ompC were 589, 800, and 204 bp, respectively (Puente et al., 1987, 1995; Martínez-Flores et al., 1999; Denis et al., 1999; Inglis and Kalischuk, 2004; Jha et al., 2012). Amplicon sizes were compared to a 100bp DNA ladder under UV light.

PCR Protocol

Before starting the PCR protocol, 400 uL of samples were centrifuged at 14,000 rpm for 1 min (Microfuge 18 Centrifuge, CA). The supernatant was discarded, and the pellet was resuspended in 60 uL sterile PCR H2O. Then, 50 uL of lysed bacteria was extracted and placed in a new, sterile PCR tube. The lysed bacteria were incubated for 10 min at 95°C in the thermocycler (Applied Biosystems, CA). Using fresh, sterile PCR tubes, 2 µL of bacteria samples and 18 uL of master mix (MM) (20 µL total volume) (yielded 5 samples) were spun down/stripped in the centrifuge to combine solutions. The reaction mixture (MM) contained the following reagents: 20 µL of 5 × PCR buffer and 2 µl of dNTP (10 mM each), 10 µM 5′- end primer, 10 µM 3′- end primer, 57 µL H2O, and 0.25 µL GoTaq G2 DNA polymerase (5 units/µL) (Promega, WI) (Jawad and Al-Charrakh, 2016). The PCR was performed in the thermocycler using the following annealing temperatures for ompC (Salmonella): 95°C for 2 min x 1 cycle, 95°C for 30 s x 35 cycles, 62°C for 30 s x 35 cycles, 72°C for 45 s x 35 cycles, 72°C for 5 min x 1 cycle, an8d an infinite hold at 4°C. Likewise, PCR was performed for 16srRNA and mapA (C. jejuni) using the following annealing temperatures: 95°C for 2 min x 1 cycle, 95°C for 30 s x 35 cycles, 51°C for 30 s x 35 cycles, 72°C for 45 s x 35 cycles, 72°C for 5 min x 1 cycle, and an infinite hold at 4°C.

Gel-Electrophoresis and Amplicon Visualization

A 1.5 or 2% agarose gel was prepared for presumptive Salmonella and C. jejuni samples, respectively. Tris-acetate-EDTA (TAE) buffer (Sigma-Aldrich Solutions, Milwaukee, WI) was mixed with agarose in a sterile beaker, covered, and microwaved until agarose was dissolved entirely (∼30 s). Once the agarose was dissolved and the solution had cooled slightly, 0.1% DNA stain (Gel Green, CA) was added. The agarose solution was then poured into molds that contained wells to house DNA samples. Molds were set to solidify for at least 1 h. before performing gel electrophoresis. Inserted into individual wells for every trial were 2 µl of the negative and positive controls (respective to the gene tested), 100 bp DNA ladder, and the experimental samples. Once all wells were filled, the gel mold was subjected to electrophoresis (Bio-Rad, Hercules, CA) at 110V for 30 min. Amplicons were visualized under UV light. Amplicon sizes of samples were compared to reference samples (negative control, positive control, DNA ladder) to confirm the presence or absence of Salmonella and C. jejuni.

Data Analysis

One-way analysis of variance (ANOVA) and the Tukey HSD test were used to analyze differences in microbial counts between MPPU process steps. The level of significance was set at α = 0.05. Statistical analysis was performed using JMP 17.0 Pro (SAS Institute, Cary, NC).

RESULTS AND DISCUSSION

Total APCs and Generic E. coli on Broiler Carcasses During MPPU Processing

Cell counts of APCs and generic E. coli on broiler carcasses after scalding, eviscerating, and chilling from MPPU processing are shown in Table 1. Overall, APCs and E. coli were 4.21 and 3.77 log10CFU/mL for all samples, respectively. Evisceration of carcasses resulted in slightly lower, but not significant APCs (4.07 log10CFU/mL, P = 0.15) and similar E. coli (3.77 log10CFU/mL, P = 0.09) counts than post-scalded samples. Similarly, Thames and associates (2022) reported a nonsignificant decrease in aerobic bacteria between scalded and eviscerated broiler carcass samples (Thames et al., 2022). However, results from a commercial poultry processing plant study showed that aerobic bacteria significantly decreased (P < 0.05) by 1.3 log10CFU/mL from the scalding to evisceration steps (Lillard, 1989), which was not a greater reduction of total aerobic bacteria (0.14 log10CFU/mL, P = 0.15) than in this study. One explanation for the higher reductions of APCs and E. coli after evisceration reported by Lillard (1989) could be because 10 to 40 rinses were applied to the broiler carcasses. A study using similar hard scalding-immersion methods (60°C) for 150 s, which is 90s longer than the present study, reported significant reductions in generic E. coli (Notermans and Kampelmacher, 1975).

Table 1.

Mean of Aerobic Coliforms and Escherichia coli on broiler chicken carcasses after MPPU processing.

Processing steps Aerobic coliforms (log10CFU/ml) Aerobic coliform SD P-value Generic Escherichia coli (log10CFU/mL) Generic Escherichia coliSD P-value
Scalded 4.21 a ± 0.47 0.15 3.77 a ± 0.45 0.09
Eviscerated 4.07 a ± 0.37 0.15 3.71 a ± 0.46 0.09
W Chilled1 4.05 a ± 0.41 0.10 3.46 ab ± 0.49 0.05
CW Chilled2 3.91 a ± 0.43 0.10 3.13 b ± 0.47 0.03
Open in a new tab

Values in the same column (within processing steps) that are not followed by the same letter are significantly different (P < 0.05).

1

Water only.

2

Water with 5 ppm Cl2.

In contrast, Althaus et al. (2017), used a 2-step scalding method on broiler carcasses at temperatures of 52.4 (120s) and 52.5°C (75s), which caused the reduction of APCs and E. coli to double compared to the post evisceration samples. Factors that could impact the number of APCs and E. coli on processed broiler carcasses include scalding temperature and time. The current study used immersion scalding in a single tank which has been shown to increase microbial contamination compared to multi-tank and spray methods (Lillard, 1973; Mulder et al., 1978; Dickens et al., 1999). However, having multi-tank and spray scalders may be impractical for local, small-quantity processors. In small-farm processing, broilers are reported to be scalded in immersion tanks for either 50 to 64°C for 60 to 120s (Sukumaran et al., 2022). The current results show that the temperature and duration of scalding are important contamination mitigation steps. However, if scalding is done improperly, it can also cause broiler carcasses to develop an unappealing appearance. Scalding carcasses at temperatures lower than 60°C (soft to medium scalding) decreased plucking efficiency, whereas scalding temperatures at 60 to 70°C for 60s caused carcasses to have a cooked appearance (Sukumaran et al., 2022). Furthermore, temperatures lower than 50°C are associated with increased microbial contamination (Sukumaran et al., 2022). In the present study, scalding carcasses at 63°C for 60 s (hard scalding) did not cause carcasses to develop an undesirable appearance, but APCs and E. coli counts were 4.21 and 3.77 log10CFU/mL, respectively.

In this study, prior to immersion chilling, chicken samples were rinsed in running tap water to remove visible debris. Some studies have reported that washing carcasses after evisceration and before chilling reduced APCs and E. coli, especially if brushes and Cl2 are added into the washing process. Washing broiler carcasses with 2 ppm Cl2 or less with high pressure has resulted in 1.1 to 1.3 log10CFU reductions of APCs and E. coli on broiler carcasses (Whyte et al., 2001; Berrang and Bailey, 2009; Giombelli and Gloria, 2014; Projahn et al., 2018). In this study, carcasses chilled in the CW immersion tank overall achieved a non-significant APCs reduction of 0.30 log10CFU/ml (P = 0.10) and a significant E. coli reduction (P = 0.03) of 0.64 log10CFU/mL compared to post-scalded samples (Table 1). Without adding Cl2, the W chilling caused a nonsignificant (P > 0.05) reduction of 0.16 (P = 0.10) and 0.31 (P = 0.05) (log10CFU/ml for APCs and E. coli, respectively. These results compare to previous studies that showed immersion chilling in water only is less effective at reducing APCs and E. coli on broiler carcasses compared with chilling in water containing Cl2. Results from similar studies also showed that using only 2 ppm of Cl2 water reduced an additional 0.23 log CFU of E. coli compared with the water only treatment (Berrang and Dickens, 2000; Souza et al., 2012). Previous commercial broiler processing studies using higher amounts of Cl2 (20, 35, 50, and 500 ppm) caused significant reductions in coliforms and E. coli (Lillard, 1990; Bartenfeld et al., 2014). Additionally, concentrations of Cl2 at 35 ppm extended the shelf life of broiler carcasses by approximately 11 and 4 days compared to water only and 24 ppm of Cl2, respectively (Lillard, 1990). However, large Cl2 concentrations (≥ 500 ppm) in chill waters could cause undesirable appearances on broiler carcasses when compared with ≤ 35 ppm Cl2 and ozone treatments (Yang et al., 2001; Trindade et al., 2012; Bartenfeld et al., 2014). In the current study, 5ppm Cl2 caused only non-significant reductions, but did not cause any physical degradation to the carcasses.

Populations of APCs and Generic E. coli in Chilling Water

Cell populations of APCs and generic E. coli in chill water samples are shown in Table 2. As was found in bacteria enumeration on chilled carcasses, CW samples were slightly, but not significantly lower in bacteria compared to the W samples (P = 0.07). Overall, CW resulted in nonsignificantly lower APCs (3.55 vs. 3.32 log10CFU/mL, P = 0.10) and E. coli counts (2.90 vs 3.24 log10CFU/mL, P = 0.06). A study using higher concentrations of Cl2, found that treating chill water with 20 and 34 ppm Cl2 reduced coliforms greater than 1 log CFU/mL and reduced Salmonella in chill water by more than 50% (Lillard, 1980). Counter-current flow chilling systems have been suggested to be more effective in reducing microbial contamination than static immersion chilling even without antimicrobials because the counter flow of water mechanically reduces bacteria from carcasses while constantly adding fresh water (Souza et al., 2012). However, this study used a single static immersion chiller because expensive, mechanical chillers may not be feasible for local, small-quantity chicken processors, which means temperature control and sanitizer concentrations are even more crucial in preventing microbial cross-contamination in that circumstance (Souza et al., 2012). In this study, chill water temperatures increased up to 2.7°C after 24 h., despite reducing the chill water temperature to 1.5 to 1.9°C before placing them in the over-night cooler. The bacterial reduction on broiler carcasses and in chill water could have been impacted by the Cl2 level used in the current study. The USDA-FSIS states that 20 to 50 ppm of Cl2 can be added to chill water (United States Department of Agriculture Food Safety and Inspection Service, 2014). This study tested 5 ppm of Cl2 only because chlorinated water is typically not utilized by small-scale local broiler processors.

Table 2.

Mean of APCs and Escherichia coli in broiler carcass chill waters.

Chill water Aerobic coliforms (log10CFU/mL) Aerobic coliform SD P-value Generic Escherichia coli (log10CFU/mL) Generic Escherichia coli SD P-value
W1 3.55 a ± 0.25 0.13 3.24 a ± 0.27 0.06
CW2 3.32 a ± 0.28 0.10 2.90 a ± 0.22 0.06
Open in a new tab

Values in the same column (within processing steps) that are not followed by the same letter are significantly different (P < 0.05).

1

Water only.

2

Water with 5 ppm Cl2.

Frequency of Salmonella on Broiler Carcasses After Processing

The presence and absence of Salmonella on broiler carcasses after scalding, evisceration, and final chilling steps were tested using PCR for the ompC gene. This method has been used to detect Salmonella on poultry carcasses in numerous studies (de Freitas et al., 2010; Vichaibun and Kanchanaphum, 2020; Xin et al., 2021). The PCR test results are shown in Table 3. The frequency of Salmonella on processed broiler carcasses more than doubled from 15.63 to 34.38% (P = 0.03) after scalding and eviscerating, respectively, which confirmed that the evisceration step increases the risk of cross-contamination. The increase in Salmonella frequency (18.75%) from the scalding to evisceration steps was observed in other broiler carcass processing studies (Rivera-Pérez et al., 2014; Park et al., 2015). In contrast, one study showed that S. Typhimurium was higher (4 carcasses) on pre-evisceration than post evisceration (0 carcasses) samples (Carramiñana et al., 1997). In the current study, only 5 samples were positive for Salmonella after scalding carcasses at 63°C for 60 s. Previous commercial processing studies disagree on whether soft or hard scalding works better to reduce microbial contamination while maintaining the final product's integrity (Slavik et al., 1995; Yang et al., 2001). A previous study using similar scalding temperatures showed that 60°C decreased S. Typhimurium to undetectable levels within 60s, which was 1.5 log CFU/cm2 more than the carcasses scalded at 50°C (Yang et al., 2001). Another study indicated that 56°C was more effective at reducing Salmonella on chicken than 60°C after 60 s (Slavik et al., 1995). Unlike previous studies, Salmonella was not completely undetected after hard scalding 60 s in this study.

Table 3.

PCR detection and frequency of Salmonella and Campylobacter spp. on broiler chicken carcasses after MPPU processing.

Processing steps Salmonella (%)
 Campylobacter (%)
Frequency P-value Frequency P-value
Scalded 5/32 (15.63) a 0.01 4/32 (12.50) a 0.09
Eviscerated 11/32 (34.38) b 0.03 2/32 (6.25) ab 0.07
W Chilled1 0/16 (0) c < 0.01 3/16(18.75) ab 0/16 (0) c 0.07
CW Chilled2 1/16 (6.25) c < 0.01 < 0.01
Open in a new tab

Values in the same column (within processing steps) that are not followed by the same letter are significantly different (P < 0.05).

1

Water only.

2

Water with 5 ppm Cl2.

Similar to previous findings showed that defeathering increased contamination of E. coli, coliforms as well as Salmonella on whole broiler carcasses (Rivera-Pérez et al., 2014). In the current study, defeathering was completed immediately after scalding by an automatic system which could explain why postscalded samples were higher in Salmonella. Previous studies have also linked spray washing to a 1.2 to 1.5 log/CFU/carcass increase of Salmonella compared to the scalding and evisceration steps (Rivera-Pérez et al., 2014). The results of this study agree with prior experiments that evisceration followed by rinsing may have increased Salmonella concentrations (5 vs. 11 positive samples (P = 0.03) on broiler carcasses.

In this study, chilled carcass samples that were positive for Salmonella using modified FDA-BAM methods were also confirmed using the PCR protocol as described in de Freitas et al., (2010). Results showed that all 16 W broiler carcass samples were negative for Salmonella and only 1 of 16 CW chilled samples (6.25%) were positive (P < 0.01). Results after using water only, 20 ppm, and 50 ppm Cl2 in chill immersion tanks showed that Salmonella reduction was 0, 10, or >80% on broiler carcasses, respectively (Yang et al., 2001; Bourassa et al., 2015). Studies that used greater concentrations of Cl2 in chilling water (10–50 ppm) have shown that Cl2 was consumed (reduced to 0 ppm) by organic material in chill water within 60 s, thereby reducing the antimicrobial efficacy of the chill water (Yang et al., 2001; Souza et al., 2012). However, this study showed that carcass chill water with 0 and 5 ppm Cl2 effectively reduced Salmonella from 80 to 100%. In addition, Salmonella was only detected on 1 carcass processed by the MPPU after chilling. Similarly, Killinger et al. (2010) reported that no Salmonella was detected in pasture-raised broiler carcasses after processing using a pilot-scale MPPU. Trimble et al. (2013) also found that all 50 broiler carcasses processed in a pilot MPPU at University of Arkansas were negative for Salmonella. The absence of Salmonella on broiler carcasses in this study and the previously mentioned MPPU studies compared to industrial processing samples could be due to smaller sample sizes (32-100 samples), less frequent use of university pilot-scale MPPU facilities and application of standard cleaning and sanitation procedures. Additionally, farmers’ market microbial analysis studies have found that 12 to 28% of poultry sold were positive for Salmonella whereas 32 to 90% of samples contained Campylobacter, which indicates a lower prevalence for Salmonella compared with Campylobacter on broilers from small-farm processors (McCrea et al., 2006; Scheinberg et al., 2013).

Frequency of C. jejuni on Broiler Carcasses After Processing

The frequency of C. jejuni found using the PCR method is shown in Table 2. C. jejuni were detected on 4 of 32 (12.5%), 2 of 32 (6.25%, P = 0.07), and 3 of 16 (18.8%, P = 0.07) broiler carcasses after scalding, evisceration, and W chilling, respectively (Table 3). No positive C. jejuni samples were found in CW chilled carcasses (P < 0.01) (Table 3). In previous studies, real time PCR using the 16s rRNA and mapA gene were effective detection methods for C. jejuni on broiler carcasses (Ivanova et al., 2014; Vizzini et al., 2021). Unlike our Salmonella PCR findings, C. jejuni frequency decreased after evisceration compared to post-scalded samples. The results from our study disagree with several previous reports that C. jejuni either increased or did not change after carcass scalding and evisceration (Berghaus et al., 2013; Pacholewicz et al., 2015; Althaus et al., 2017; Huang et al., 2017). A previous study concluded that de-feathering after scalding but preceding evisceration, caused an increase of Campylobacter cross-contamination due to the temperature fluctuations that occur after scalding. The authors hypothesized that chicken follicles open and close when exposed to heat and cold, thus releasing and trapping bacteria in the follicles and pores of carcasses (Thomas et al., 2013; Hakeem and Lu, 2021). Additionally, scalding has been shown to liquefy lipids which resolidify after chilling, creating a protective film that harbors bacteria in channels of the chicken skin post-processing (Thomas et al., 2013; Hakeem and Lu, 2021).

Most studies are in agreement with the current findings that chilling in chlorinated water reduced C. jejuni on broiler carcasses compared with post-scalded carcasses (Rosenquist et al., 2006; Berghaus et al., 2013; Pacholewicz et al., 2015; Huang et al., 2017). Guerin et al. (2010) reported that the post evisceration steps such as chilling may be the most important critical control point in the processing to control Campylobacter on broiler carcasses because immersion chilling can lead to cross-contamination. Campylobacter was 20% higher on broiler carcasses after chilling compared to evisceration samples demonstrating cross-contamination in chill water (Ivanova et al., 2014). In our study, 3 W-chilled carcass samples were positive for Campylobacter whereas no CW chilled carcass samples were positive for Campylobacter. Other studies using immersion chilling with water only reduced Campylobacter jejuni up to 90.63% (Gumhalter et al., 2003) and immersion chilling with the addition of 20 to 50 ppm reduced Campylobacter spp. by 1.7 log10 CFU/g (Stern and Robach, 2003) and 3.8 CFU/ mL (Berrang and Dickens, 2000).

Yang et al., 2001 reported that C. jejuni on broiler carcass skins were not significantly affected (5 log CFU/mL reduction) until carcasses were chilled in 50 ppm Cl2 for 1 h (Yang et al., 2001). Results from this study showed that Campylobacter was more chill resistant in W compared to Salmonella (18.75 vs 0%), which was similar to a previous conclusion that C. jejuni was more heat sensitive yet more resistant to chilling than S. Typhimurium (Yang et al., 2001). However, a similar MPPU broiler processing study conducted in the summer using 50 samples per processing step, resulted in considerably higher amounts of Campylobacter spp. (100% of samples) on broiler carcasses than the current study (Trimble et al., 2013). In contrast, the current study was conducted in the winter using only 32 broiler carcasses per processing step, which indicates that both the season when broilers are processed, and the amount processed at one time may significantly impact the microbial cross-contamination on carcasses.

The cleanliness of the farm and processing facilities may also play a significant role in prevention of microbial cross-contamination on products. The WVU poultry farm where this research was conducted is subject to meticulous cleaning and sanitizing processes. The facility where broilers are processed for consumption are cleaned before and after processing. The bench tops, sinks, equipment, tools, and floors are cleaned with warm water and soap and sanitized using a 200 ppm bleach solution. The processing facilities are typically on an intermittent basis. The cleanliness and frequency of use could in part explain the low amount of Campylobacter detected on samples compared to other studies (Trimble et al., 2013). Given these results, the WVU poultry farm operational practices may serve as a good example for small-farm processors in this state. An outreach training program to teach such poultry production and processing methods is needed.

Results of this study indicate that the evisceration step is an important critical control point to control cross-contamination of bacteria. Proper chilling is also a crucial microbial mitigation step in MPPU processing. The addition of 5ppm Cl2 in chill water significantly reduced E. coli, Salmonella spp., and Campylobacter spp. on chilled broiler carcasses, but that reduction did not differ significantly from water chilling alone. However, water chilling alone and the addition of 5ppm Cl2 in chill water did not significantly reduce aerobic coliforms Therefore, the current study identified critical cross-contamination points in the MPPU processing. More MPPU processing studies are needed to examine what post-evisceration wash methods and chill-water sanitizers are most effective at preventing cross-contamination, while preserving the integrity of the final product.

ACKNOWLEDGMENTS

This work is supported by the United States Department of Agriculture-National Institute of Food and Agriculture (NIFA), the West Virginia Agricultural and Forestry Experiment Station Hatch Grant (Grant # WVA00684 and WVA00736) and supported by the USDA-NIFA-AFRI-Critical Agricultural Research and Extension (CARE) Program (Award#2022-68008-37104).

DISCLOSURES

All authors declare that they have no conflicts of interest.

REFERENCES

  1. Althaus D., Zweifel C., Stephan R. Analysis of a poultry slaughter process: influence of process stages on the microbiological contamination of broiler carcasses. Ital. J. Food Saf. 2017;6:7097. doi: 10.4081/ijfs.2017.7097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bartenfeld L.N., Fletcher D.L., Northcutt J.K., Bourassa D.V., Cox N.A., Buhr R.J. The effect of high-level chlorine carcass drench on the recovery of Salmonella and enumeration of bacteria from broiler carcasses. Poult. Sci. 2014;93:2893–2899. doi: 10.3382/ps.2014-04051. [DOI] [PubMed] [Google Scholar]
  3. Berghaus R.D., Thayer S.G., Law B.F., Mild R.M., Hofacre C.L., Singer R.S. Enumeration of Salmonella and Campylobacter spp. in environmental farm samples and processing plant carcass rinses from commercial broiler chicken flocks. Appl. Environ. Microbiol. 2013;79:4106–4114. doi: 10.1128/AEM.00836-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Berrang M.E., Bailey J.S. On-line brush and spray washers to lower numbers of Campylobacter and Escherichia coli and presence of Salmonella on broiler carcasses during processing. J. Appl. Poult. Res. 2009;18:74–78. [Google Scholar]
  5. Berrang M.E., Dickens J.A. Presence and level of Campylobacter spp. on broiler carcasses throughout the processing plant. J. Appl. Poult. Res. 2000;9:43–47. [Google Scholar]
  6. Boney J.W., Moritz J.S. Phytase dose effects in practically formulated diets that vary in ingredient composition on feed manufacturing and broiler performance. J. Appl. Poult. Res. 2017;26:273–285. [Google Scholar]
  7. Bourassa D.V., Holmes J.M., Cason J.A., Cox N.A., Rigsby L.L., Buhr R.J. Prevalence and serogroup diversity of Salmonella for broiler neck skin, whole carcass rinse, and whole carcass enrichment sampling methodologies following air or immersion chilling. J. Food Prot. 2015;78:1938–1944. doi: 10.4315/0362-028X.JFP-15-189. [DOI] [PubMed] [Google Scholar]
  8. Carramiñana J.J., Yangüela J., Blanco D., Rota C., Agustin A.I., Ariño A., Herrera A. Salmonella incidence and distribution of serotypes throughout processing in a Spanish poultry slaughterhouse. J. Food Prot. 1997;60:1312–1317. doi: 10.4315/0362-028X-60.11.1312. [DOI] [PubMed] [Google Scholar]
  9. Centers for Disease Control and Prevention. 2019a. Escherichia coli O157:H7 infections linked to costco rotisserie chicken salad. Accessed July 2023. https://www.cdc.gov/ecoli/2015/o157h7-11-15/index.html.
  10. Centers for Disease Control and Prevention. 2019b. Reports of Salmonella outbreak investigations from 2018. Accessed July 2023. https://www.cdc.gov/salmonella/outbreaks-2018.html.
  11. Centers for Disease Control and Prevention. 2022. Chicken and food poisoning. Accessed July 2023. https://www.cdc.gov/foodsafety/chicken.html
  12. Chai S.J., Cole D., Nisler A., Mahon B.E. Poultry: the most common food in outbreaks with known pathogens, United States, 1998-2012. Epidemiol. Infect. 2017;145:316–325. doi: 10.1017/S0950268816002375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Denis M., Soumet C., Rivoal K., Ermel G., Blivet D., Salvat G., Colin P. Development of a m-PCR assay for simultaneous identification of Campylobacter jejuni and C. coli. Lett. Appl. Microbiol. 1999;29:406–410. doi: 10.1046/j.1472-765x.1999.00658.x. [DOI] [PubMed] [Google Scholar]
  14. Dickens J., Buhr R., Cason J. Subcutaneous temperature profile, skin appearance, and picking efficiency of immersion and spray scalded broiler carcasses. Poult. Sci. 1999;78:595–599. doi: 10.1093/ps/78.4.595. [DOI] [PubMed] [Google Scholar]
  15. de Freitas C.G., Santana A.P., da Silva P.H.C., Gonçalves V.S.P., de A. F. Barros M., Torres F.A.G., Murata L.S., Perecmanis S. PCR multiplex for detection of Salmonella Enteritidis, and Typhimurium and occurrence in poultry meat. Int. J. Food Microbiol. 2010;139:15–22. doi: 10.1016/j.ijfoodmicro.2010.02.007. [DOI] [PubMed] [Google Scholar]
  16. Giombelli A., Gloria M.B.A. Prevalence of Salmonella and Campylobacter on broiler chickens from farm to slaughter and efficiency of methods to remove visible fecal contamination. J. Food Prot. 2014;77:1851–1859. doi: 10.4315/0362-028X.JFP-14-200. [DOI] [PubMed] [Google Scholar]
  17. Guerin M.T., Sir C., Sargeant J.M., Waddell L., O'Connor A.M., Wills R.W., Bailey R.H., Byrd J.A. The change in prevalence of Campylobacter on chicken carcasses during processing: a systematic review. Poult. Sci. 2010;89:1070–1084. doi: 10.3382/ps.2009-00213. [DOI] [PubMed] [Google Scholar]
  18. Gumhalter K., Medic H., Vidacek S., Petrak T., Botka K. Bacterial population in counter flow and parallel flow water chilling of poultry meat. Eur. Food Res. Technol. 2003;217:412–415. [Google Scholar]
  19. Hakeem M.J., Lu X. Survival and Control of Campylobacter in poultry production environment. Front. Cell Infect. Microbiol. 2021;10 doi: 10.3389/fcimb.2020.615049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Huang J., Zang X., Zhai W., Guan C., Lei T., Jiao X. Quantitative analysis of Campylobacter spp. contamination in chicken slaughtering lines by “label tracking method” in Eastern China. Food Control. 2017;80:67–73. [Google Scholar]
  21. Inglis G.D., Kalischuk L.D. Direct Quantification of Campylobacter jejuni and Campylobacter lanienae in feces of cattle by real-time quantitative PCR. Appl. Environ. Microbiol. 2004;70:2296–2306. doi: 10.1128/AEM.70.4.2296-2306.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ivanova M., Singh R., Dharmasena M., Gong C., Krastanov A., Jiang X. Rapid identification of Campylobacter jejuni from poultry carcasses and slaughtering environment samples by real-time PCR. Poult. Sci. 2014;93:1587–1597. doi: 10.3382/ps.2013-03736. [DOI] [PubMed] [Google Scholar]
  23. Jawad A.A.-K., Al-Charrakh A.H. Outer membrane protein C (ompC) Gene as the target for diagnosis of Salmonella Species isolated from human and animal sources. Avicenna J. Med. Biotechnol. 2016;8:42–45. [PMC free article] [PubMed] [Google Scholar]
  24. Jha R., Kumar A., Saxena A., Tamuly S., Saxena M.K. Cloning, sequencing and In Silico analysis of Omp C of Salmonella Typhimurium. ISRN. Vet. Sci. 2012;2012 doi: 10.5402/2012/512848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jones, L. 2020. Poultry trailer. West Virginia Farmers Market Association. Accessed July 2023. https://wvfarmers.org/poultry-trailer/
  26. Killinger K.M., Kannan A., Bary A.I., Cogger C.G. Validation of a 2 percent lactic acid antimicrobial rinse for mobile poultry slaughter operations. J. Food Prot. 2010;73:2079–2083. doi: 10.4315/0362-028x-73.11.2079. [DOI] [PubMed] [Google Scholar]
  27. Li K., Lemonakis L., Glover B., Moritz J., Shen C. Impact of built-up-litter and commercial antimicrobials on Salmonella and Campylobacter contamination of broiler carcasses processed at a pilot mobile poultry-processing unit. Front. Vet. Sci. 2017;4:1–8. doi: 10.3389/fvets.2017.00088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lianou A., Panagou E.Z., Nychas G.-J.E. Meat safety—foodborne pathogens and other biological issues. Lawrie´s Meat Sci. 2017:521–552. [Google Scholar]
  29. Lillard H.S. Contamination of blood system and edible parts of poultry with Clostridium perfringens during water scalding. J. Food Sci. 1973;38:151–154. [Google Scholar]
  30. Lillard H.S. Effect on broiler carcasses and water of treating chiller water with chlorine or chlorine dioxide. Poult. Sci. 1980;59:1761–1766. [Google Scholar]
  31. Lillard H.S. Incidence and recovery of Salmonellae and other bacteria from commercially processed poultry carcasses at selected pre- and post-evisceration steps. J. Food Prot. 1989;52:88–91. doi: 10.4315/0362-028X-52.2.88. [DOI] [PubMed] [Google Scholar]
  32. Lillard H.S. The impact of commercial processing procedures on the bacterial contamination and cross-contamination of broiler carcasses. J. Food Prot. 1990;53:202–205. doi: 10.4315/0362-028X-53.3.202. [DOI] [PubMed] [Google Scholar]
  33. Mancinelli A.C., Dal Bosco A., Mattioli S., Ranucci D., Castellini C. Mobile poultry processing unit as a resource for small poultry farms: planning and economic efficiency, animal welfare, meat quality and sanitary implications. Animals (Basel) 2018;8:229. doi: 10.3390/ani8120229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Martínez-Flores I., Cano R., Bustamante V.H., Calva E., Puente J.L. The ompB operon partially determines differential expression of OmpC in Salmonella Typhi and Escherichia coli. J. Bacteriol. 1999;181:556–562. doi: 10.1128/jb.181.2.556-562.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Marus, J.R. Outbreak of listeriosis likely associated with prepackaged caramel apples — United States, 2019. Morb. Mortal Wkly. Rep. 68. Accessed July 2023. https://www.cdc.gov/mmwr/volumes/68/wr/mm6803a5.htm. [DOI] [PubMed]
  36. McCrea B.A., Tonooka K.H., VanWorth C., Atwill E.R., Schrader J.S., Boggs C.L. Prevalence of Campylobacter and Salmonella Species on farm, after transport, and at processing in specialty market poultry. Poult. Sci. 2006;85:136–143. doi: 10.1093/ps/85.1.136. [DOI] [PubMed] [Google Scholar]
  37. Mulder R.W.A.W., Dorresteijn L.W.J., Van Der Broek J. Cross-contamination during the scalding and plucking of broilers. Br. Poult. Sci. 1978;19:61–70. [Google Scholar]
  38. National Chicken Council . 2022. Per Capita Consumption of Poultry and Livestock, 1965 to Forecast 2022, in Pounds.https://www.nationalchickencouncil.org/about-the-industry/statistics/per-capita-consumption-of-poultry-and-livestock-1965-to-estimated-2012-in-pounds/ Accessed July 2023. [Google Scholar]
  39. Notermans S., Kampelmacher E.H. Heat destruction of some bacterial strains attached to broiler skin. Br. Poult. Sci. 1975;16:351–361. doi: 10.1080/00071667508416199. [DOI] [PubMed] [Google Scholar]
  40. Pacholewicz E., Swart A., Schipper M., Gortemaker B.G.M., Wagenaar J.A., Havelaar A.H., Lipman L.J.A. A Comparison of Fluctuations of Campylobacter and Escherichia coli concentrations on broiler chicken carcasses during processing in two slaughterhouses. Int. J. Food Microbiol. 2015;205:119–127. doi: 10.1016/j.ijfoodmicro.2015.04.006. [DOI] [PubMed] [Google Scholar]
  41. Painter J.A., Hoekstra R.M., Ayers T., Tauxe R.V., Braden C.R., Angulo F.J., Griffin P.M. Attribution of foodborne illnesses, hospitalizations, and deaths to food commodities by using outbreak data, United States, 1998–2008. Emerg. Infect. Dis. 2013;19:407–415. doi: 10.3201/eid1903.111866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Park H.-J., Chon J.-W., Lim J.-S., Seo K.-H., Kim Y.-J., Heo E.-J., Wee S.-H., Sung K., Moon J.-S. Prevalence analysis and molecular characterization of Salmonella at different processing steps in broiler slaughter plants in South Korea. J. Food Sci. 2015;80:M2822–M2826. doi: 10.1111/1750-3841.13106. [DOI] [PubMed] [Google Scholar]
  43. Projahn M., Pacholewicz E., Becker E., Correia-Carreira G., Bandick N., Kaesbohrer A. Reviewing interventions against enterobacteriaceae in broiler processing: using old techniques for meeting the new challenges of ESBL E. coli. Biomed. Res. Int. 2018;2018 doi: 10.1155/2018/7309346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Puente J.L., Flores V., Fernández M., Fuchs Y., Calva E. Isolation of an ompC-like outer membrane protein gene from Salmonella Typhi. Gene. 1987;61:75–83. doi: 10.1016/0378-1119(87)90366-0. [DOI] [PubMed] [Google Scholar]
  45. Puente J.L., Juárez D., Bobadilla M., Arias C.F., Calva E. The Salmonella ompC gene: structure and use as a carrier for heterologous sequences. Gene. 1995;156:1–9. doi: 10.1016/0378-1119(94)00883-t. [DOI] [PubMed] [Google Scholar]
  46. Rivera-Pérez W., Barquero-Calvo E., Zamora-Sanabria R. Salmonella contamination risk points in broiler carcasses during slaughter line processing. J. Food Prot. 2014;77:2031–2034. doi: 10.4315/0362-028X.JFP-14-052. [DOI] [PubMed] [Google Scholar]
  47. Rosenquist H., Sommer H.M., Nielsen N.L., Christensen B.B. The effect of slaughter operations on the contamination of chicken carcasses with thermotolerant Campylobacter. Int. J. Food Microbiol. 2006;108:226–232. doi: 10.1016/j.ijfoodmicro.2005.12.007. [DOI] [PubMed] [Google Scholar]
  48. Scheinberg J., Radhakrishna R., Cutter C. Food safety knowledge, behavior, and attitudes of vendors of poultry products sold at Pennsylvania farmers’ markets. J. of Ext. 2013;51:1–9. [Google Scholar]
  49. Slavik M.F., Kim J.-W., Walker J.T. Reduction of Salmonella and Campylobacter on chicken carcasses by changing scalding temperature. J. Food Prot. 1995;58:689–691. doi: 10.4315/0362-028X-58.6.689. [DOI] [PubMed] [Google Scholar]
  50. Souza L.C.T., Pereira J.G., Spina T.L.B., Izidoro T.B., Oliveira A.C., Pinto J.P.A.N. Microbiological evaluation of chicken carcasses in an immersion chilling system with water renewal at 8 and 16 hours. J. Food Prot. 2012;75:973–975. doi: 10.4315/0362-028X.JFP-11-376. [DOI] [PubMed] [Google Scholar]
  51. Stern N.J., Robach M.C. Enumeration of Campylobacter spp. in broiler feces and in corresponding processed carcasses. J. Food Prot. 2003;66:1557–1563. doi: 10.4315/0362-028x-66.9.1557. [DOI] [PubMed] [Google Scholar]
  52. Sukumaran, A., C. Owens, C. Alvarado, and M. Schilling. 2022. Primary processing operations. Reference module in food science. Accessed July 2023. https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/scalding
  53. Thames H.T., Fancher C.A., Colvin M.G., McAnally M., Tucker E., Zhang L., Kiess A.S., Dinh T.T.N., Sukumaran A.T. Spoilage bacteria counts on broiler meat at different stages of commercial poultry processing plants that use peracetic acid. Animals (Basel) 2022;12:1439. doi: 10.3390/ani12111439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Thomas, K., R. Murray, L. Flockhart, K. Pintar, and F. Pollari. 2013. Estimates of the burden of foodborne illness in canada for 30 specified pathogens and unspecified agents, Circa 2006 | Foodborne Pathogens and Disease. Accessed July 2023. https://www.liebertpub.com/doi/full/10.1089/fpd.2012.1389 [DOI] [PMC free article] [PubMed]
  55. Trimble L.M., Alali W.Q., Gibson K.E., Ricke S.C., Crandall P., Jaroni D., Berrang M. Salmonella and Campylobacter prevalence and concentration on pasture-raised broilers processed on-farm, in a mobile processing unit, and at small USDA-inspected facilities. Food Control. 2013;34:177–182. [Google Scholar]
  56. Trindade M.A., Kushida M.M., Villanueva N.D.M., dos Santos Pereira D.U., Lins de Oliveira C.E. Comparison of ozone and chlorine in low concentrations as sanitizing agents of chicken carcasses in the water immersion chiller. J. Food Prot. 2012;75:1139–1143. doi: 10.4315/0362-028X.JFP-11-288. [DOI] [PubMed] [Google Scholar]
  57. United States Department of Agriculture. 2023. What is the most consumed meat in the world? Accessed July 2023. https://ask.usda.gov/s/article/What-is-the-most-consumed-meat-in-the-world.
  58. United States Department of Agriculture Economic Research Service. 2012. U.S. consumption of chicken. Accessed July 2023. https://ers.usda.gov/amber-waves/2012/september/us-consumption-of-chicken/.
  59. United States Department of Agriculture Food Safety and Inspection Service. 2014. FSIS Compliance Guide: Modernization of Poultry Slaughter Inspection: Chilling Requirements. Accessed July 2023. https://www.fsis.usda.gov/guidelines/2014-0014.
  60. United States Department of Agriculture Food Safety and Inspection Service. 2021. Isolation and identification of Campylobacter jejuni/coli/lari from poultry rinse, sponge and raw product samples. Accessed July 2023. https://www.fsis.usda.gov/sites/default/files/media_file/2021-06/MLG-41.pdf
  61. United States Food and Drug Administration. 2020. 2018 NARMS update: integrated report summary interactive version. Accessed May 2023. https://www.fda.gov/animal-veterinary/national-antimicrobial-resistance-monitoring-system/2018-narms-update-integrated-report-summary-interactive-version.
  62. Vichaibun V., Kanchanaphum P. Quantitative LAMP and PCR Detection of Salmonella in chicken samples collected from local markets around Pathum Thani province, Thailand. Int. J. Food Sci. 2020;9 doi: 10.1155/2020/8833173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Vizzini P., Vidic J., Manzano M. Enrichment Free qPCR for rapid identification and quantification of Campylobacter jejuni, C. coli, C. lari, and C. upsaliensis in chicken meat samples by a new couple of primers. Foods. 2021;10:2341. doi: 10.3390/foods10102341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Wessels K., Rip D., Gouws P. Salmonella in chicken meat: consumption, outbreaks, characteristics, current control methods and the potential of bacteriophage use. Foods. Foods. 2021;10:1742. doi: 10.3390/foods10081742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. West Virginia Department of Agriculture. 2020. West Virginia Annual Bulletin. Accessed July 2023.https://www.nass.usda.gov/Statistics_by_State/West_Virginia/Publications/Annual_Statistical_Bulletin/2020/Bulletin2020.pdf.
  66. West Virginia Department of Agriculture. 2021. Producer/Grower 20,000 Poultry Limit Exemption Requirements. Accessed July 2023. https://agriculture.wv.gov/wp-content/uploads/2021/01/20000-Bird-Exemption.pdf.
  67. Whyte P., Collins J.D., Mcgill K., Monahan C., O'mahony H. Quantitative investigation of the effects of chemical decontamination procedures on the microbiological status of broiler carcasses during processing. J. Food Prot. 2001;64:179–183. doi: 10.4315/0362-028x-64.2.179. [DOI] [PubMed] [Google Scholar]
  68. Xin S., Zhu H., Tao C., Zhang B., Yao L., Zhang Y., Afayibo D.J.A., Li T., Tian M., Qi J., Ding C., Yu S., Wang S. Rapid detection and differentiating of the predominant Salmonella serovars in chicken farm by TaqMan multiplex real-time PCR assay. Front. Cell. Infect. Microbiol. 2021;11 doi: 10.3389/fcimb.2021.759965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Yang H., Li Y., Johnson M.G. Survival and Death of Salmonella Typhimurium and Campylobacter jejuni in Processing Water and on Chicken Skin during Poultry Scalding and Chilling. J. Food Prot. 2001;64:770–776. doi: 10.4315/0362-028x-64.6.770. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES