Skip to main content
NCBI home page
MicrobiologyOpen logoLink to MicrobiologyOpen
. 2024 Mar 5;13(2):e1402. doi: 10.1002/mbo3.1402

Complete nucleotide sequence and comparative genomic analysis of microcin B17 plasmid pMccB17

Mayokun Ajeigbe 1, Stephen Childs 2, Timothy A Paget 3, Lewis E H Bingle 1,✉
PMCID: PMC10912980  PMID: 38440924

Abstract

We present a comprehensive sequence and bioinformatic analysis of the prototypical microcin plasmid, pMccb17, which includes a definitive sequence for the microcin operon, mcb. Microcin B17 (MccB17) is a ribosomally synthesized and posttranslationally modified peptide produced by Escherichia coli. It inhibits bacterial DNA gyrase similarly to quinolone antibiotics. The mcb operon, which consists of seven genes encoding biosynthetic and immunity/export functions, was originally located on the low copy number IncFII plasmid pMccB17 in the Escherichia coli strain LP17. It was later transferred to E. coli K‐12 through conjugation. In this study, the plasmid was extracted from the E. coli K‐12 strain RYC1000 [pMccB17] and sequenced twice using an Illumina short‐read method. The first sequencing was conducted with the host bacterial chromosome, and the plasmid DNA was then purified and sequenced separately. After assembly into a single contig, polymerase chain reaction primers were designed to close the single remaining gap via Sanger sequencing. The resulting complete circular DNA sequence is 69,190 bp long and includes 81 predicted genes. These genes were initially identified by Prokka and subsequently manually reannotated using BLAST. The plasmid was assigned to the F2:A‐:B‐ replicon type with a MOBF12 group conjugation system. A comparison with other IncFII plasmids revealed a large proportion of shared genes, particularly in the conjugative plasmid backbone. However, unlike many contemporary IncFII plasmids, pMccB17 lacks transposable elements and antibiotic resistance genes. In addition to the mcb operon, this plasmid carries 25 genes of unknown function.

Keywords: Enterobacteriaceae, genome, microcin, plasmid

We have determined the complete sequence of plasmid pMccB17 (isolated in 1977), which carries the prototypical microcin operon mcb. The plasmid is 69,190 bp and assigned to the IncFII group of F2:A‐:B‐ replicon type with a conjugation system from the MOBF12 group. While the mcb operon is the major noteworthy feature, pMccB17 is unlike many contemporary IncFII plasmids in that it lacks transposable elements and antibiotic resistance genes.

graphic file with name MBO3-13-e1402-g001.jpg

1. INTRODUCTION

Microcin B17 (MccB17), is a small (3093 Da), ribosomally synthesized and posttranslationally modified peptide (RiPP) that is produced by Escherichia coli (Arnison et al., 2013; Duquesne et al., 2007). This antimicrobial natural product inhibits the class II topoisomerase DNA gyrase in a similar way to quinolone antibiotics while differing slightly in that MccB17 targets gyrase subunit B, whereas quinolones bind gyrase subunit A (Heddle et al., 2001; Pierrat & Maxwell, 2003). Biosynthesis of MccB17 is carried out by the products of 7 genes (mcbA–G) that encode precursor peptide, synthase, immunity, and export functions and are arranged in an operon found on the plasmid pMccB17 (Garrido et al., 1988; Genilloud et al., 1989; Yorgey et al., 1994). The 69 amino acid promicrocin (precursor peptide) McbA is posttranslationally modified by the synthetase complex McbBCD, resulting in the formation of heterocycles (thiazole and oxazole) in the sequence. This modified peptide sequence is exported from the host cytoplasm by an efflux pump encoded by mcbE and mcbF. The last gene, mcbG (the product of which binds to the host DNA gyrase), together with mcbE and mcbF functions to offer immunity to the host cell (Collin et al., 2013). MccB17 is one of the best‐studied microcins and is gaining recognition as a promising template for developing new antibacterial agents (Collin & Maxwell, 2019; Ghilarov et al., 2019; Withanage et al., 2013)

Conjugative plasmid pMccB17, previously known as pRYC17, was originally found in E. coli strain LP17 isolated from the intestinal tract of a healthy newborn at Hospital La Paz, Spain, and transferred by conjugation to E. coli K‐12 (Baquero et al., 1978). This is a low copy number plasmid (approximately two copies per chromosome) belonging to the IncFII group that includes the archetypes R100 and R1. Plasmid pMccB17 is not known to possess any conventional antibiotic resistance markers and its size was previously estimated as 70 kb (San Millan et al., 1985).

Here we report the complete sequence of pMccB17, with some comparative genomic analysis. This sequence provides an insight into the biology of a prototypical microcin plasmid and a definitive sequence for the mcb microcin operon

2. MATERIALS AND METHODS

2.1. Bacterial strains and plasmids

The E. coli K‐12 strains ZK0005 (RYC1000 [pMccB17]) and ZK359 (MC4100 [pPY113]) were provided by Professor Roberto Kolter of Harvard Medical School.

2.2. DNA purification

Bacterial genomic DNA was isolated from strain ZK0005 as part of the initial DNA sequencing process as follows (this was carried out by microbesNG, details below). Cells were lysed in TE buffer containing lysozyme (final concentration 0.1 mg/mL) and RNase A (0.1 mg/mL) with incubation for 25 min at 37°C. Proteinase K (0.1 mg/mL) and sodium dodecyl sulfate (final concentration 0.5% v/v) were then added and this mixture was incubated for 5 min at 65°C. Genomic DNA was purified using an equal volume of solid‐phase reversible immobilization beads and resuspended in elution buffer (EB;10 mM Tris‐HCl, pH 8.5).

Plasmid DNA (pMccB17) was isolated from strain ZK0005 by alkaline lysis followed by anion‐exchange chromatography (Plasmid Midi kit, Qiagen) according to the manufacturer's recommendations for “very low‐copy” plasmids. DNA was eluted in EB buffer as above.

Plasmid DNA (pPY113) was isolated by alkaline lysis followed by chromatography using a silica matrix (Monarch Plasmid Miniprep Kit, New England Biolabs. DNA was eluted in DNA elution buffer (10 mM Tris‐HCl, 0.1 mM EDTA, pH 8.5).

2.3. DNA sequencing

Plasmid pMccB17 was sequenced twice using an Illumina short‐read next‐generation method by microbesNG (http://www.microbesng.com). First, the plasmid was sequenced together with the E. coli host bacterial chromosome; subsequently, plasmid DNA was purified as described above and sequenced separately. Genomic DNA libraries were prepared using the Nextera XT Library Prep Kit (Illumina) following the manufacturer's protocol with the following modifications: input DNA was increased twofold and polymerase chain reaction (PCR) elongation time was increased to 45 s. DNA quantification and library preparation were carried out on a Hamilton Microlab STAR automated liquid handling system (Hamilton Bonaduz AG). Libraries were sequenced on an Illumina NovaSeq. 6000 (Illumina) using a 250 bp paired‐end protocol. Reads were adapter trimmed using Trimmomatic version 0.30 (Bolger et al., 2014), with a sliding window quality cutoff of Q15. De novo assembly was performed on samples using SPAdes version 3.7 (Bankevich et al., 2012) and contigs were annotated using Prokka version 1.11 (Seemann, 2014).

Plasmid pPY113 was sequenced using a nanopore platform (PromethION with v14 chemistry and R10.4.1. flow cells; Oxford Nanopore Technologies). Sequencing and annotation were performed by Plasmidsaurus.

Sanger DNA sequencing of PCR amplicons, for plasmid genome finishing/gap resolution, was carried out by DBS Genomics (Durham University, UK).

2.4. Plasmid sequence gap closing

PCR Primers were designed to amplify across gaps in the draft sequence, and the corresponding oligonucleotides were synthesized by Integrated DNA Technologies (Appendix Table A1). PCR amplification used ImmoMix (Bioline) or Q5 High Fidelity (New England Biolabs) PCR master mixes, following the manufacturer's recommendations. Thermal cycling was carried out in a T100 thermal cycler (BioRad) and amplified products were electrophoresed in 1% agarose gels at 6 V/cm for 1 h, stained with GelRed, and visualized using a ChemiDoc XRS+ imaging system (BioRad). Products of the expected sizes were excised, and gel‐purified using Monarch DNA Gel Extraction Kit (NEB) and then sequenced (Sanger method, as above).

2.5. Annotation of pMccB17

The draft genome sequence was annotated automatically by MicrobesNG using Prokka 1.11 (Seemann, 2014). These annotations were manually checked using BLASTn (Zhang et al., 2000) and BLASTp (Altschul, 1997) retaining the default parameters. Coding sequences (CDSs) without proper annotation were manually assigned one where possible, using the BLAST result as a guide and Artemis to edit the annotation (Berriman, 2003; Rutherford et al., 2000).

2.6. pMccB17 plasmid replicon and conjugation system typing

Replicon typing was carried out using the IncF RST (replicon sequence typing) scheme, as implemented by pubMLST (https://pubmlst.org/plasmid/; Jolley et al., 2018) and pMLST (https://cge.cbs.dtu.dk/services/pMLST/; Carattoli et al., 2014). Initial classification of the relaxase was carried out using MOBscan (https://castillo.dicom.unican.es/mobscan/; Garcillán‐Barcia et al., 2020) and manually refined by pairwise comparisons with selected relaxase proteins using EMBOSS Needle (https://www.ebi.ac.uk/Tools/psa/emboss_needle/; Needleman & Wunsch, 1970).

2.7. Phylogenetic tree building

The phylogenetic tree of ParB‐fusion (Pbf) protein homologs was built using a maximum‐likelihood method as implemented by MEGA X (Kumar et al., 2018). The tree used the LG + G model (Le & Gascuel, 2008) for amino acid substitution.

2.8. Identification of resistance genes, insertion sequence, and virulence factors

Identification of resistance genes was performed by submitting the complete plasmid nucleotide sequence to the ResFinder web server (https://cge.cbs.dtu.dk//services/ResFinder/; Zankari et al., 2012). The nucleotide sequence was also submitted to the IS‐Finder web server (https://www.issaga.biotoul.fr/; Varani et al., 2011), and VFDB web server (https://www.mgc.ac.cn/VFs/; Liu et al., 2019) to identify insertion sequences and virulence factors, respectively.

3. RESULTS AND DISCUSSION

3.1. Plasmid pMccB17 genome assembly

Draft genomes were obtained using a short‐read, high coverage (Illumina) approach as described in Methods. Plasmid contigs from the draft genome were scaffolded as follows. Two contigs, 1.27 and 1.52, from the first draft sequence (of plasmid and chromosomal DNA), were discovered to have standard plasmid‐related features by manually examining the genome sequence. Contig 1.27 (60,265 bp) had 71 genes including the MccB17 operon, conjugative transfer system, replicon system, and some plasmid maintenance genes (stbA, stbB, parE), whereas contig 1.52 (8894 bp) had 12 genes, half of which have plasmid maintenance related functions, that is, ssb, pbf, psiA, psiB, and hok/sok. Contig 2.1, the first contig in the second draft sequence (from purified plasmid DNA), contained all the genes present in contigs 1.27 and 1.52, and when the three contigs were aligned using Artemis Comparison Tool (Carver et al., 2005, 2008), it was evident that contigs 1.27 and 1.52 make up contig 2.1. The ends of contig 2.1 were found to be within a CDS, gene_81, found in contig 1.27. PCR primers were designed to flank gaps in the plasmid sequence and were employed to close these gaps by PCR amplification followed by Sanger sequencing of the amplicons.

Finally, 114 nucleotides missing from contig 2.1 were added manually using Artemis, resulting in a complete circular genome sequence for pMccB17. This sequence was submitted to GenBank (accession number ON989342).

3.2. Plasmid replicon and conjugation system typing

The replicon sequence type was assigned using the IncF RST scheme as implemented by pubMLST and pMLST, indicating a FAB type of F2:A‐:B‐; so pMccB17 has an FII replicon (allele 2) without additional FIA or FIB replicons (Villa et al., 2010). Initial classification of the relaxase using MOBscan assigned it to the MOBF family. The first 300 N‐terminal amino acids of the TraI relaxase/helicase protein (that is, the relaxase domain) were then compared in a pairwise manner with archetypal IncF plasmid relaxases. The pMccB17 relaxase domain was 99.3% identical to that of the IncFII plasmid R100 (GenBank: NC_002134) and 91.3% identical to that of F plasmid (GenBank: NC_002483), placing it in the MOBF121 type (Garcillán‐Barcia et al., 2011), or group A according to a recent phylogeny of IncF relaxases (Fernandez‐Lopez et al., 2016).

3.3. Plasmid pMccB17 genome analysis overview

pMccB17 is a circular IncFII plasmid (69,190 bp) with an average GC content of 51% and 83 CDS (Figure 1 and Appendix Table A2). This plasmid encodes MccB17, having the MccB17 operon. The tra region (traMJYALEKBPVCWUNFQHGSTDIX and trbDICEABF) encodes conjugative transfer functions and takes up about half of the plasmid backbone. pMccB17 encodes two types of toxin–antitoxin (TA)/plasmid addiction system, for eliminating plasmid‐free segregants. A type I hok/Sok system is located downstream of psiA and a type II system encoding ParDE is encoded downstream of the replication gene repA. The plasmid has no known antibiotic resistance genes, virulence factors, or transposable elements, according to ResFinder, IS‐Finder, and VFDB web servers, respectively.

Figure 1.

Figure 1

Open in a new tab

Circular Map of pMccB17. The outer ring shows the size of the plasmid, each tick representing 4 kb. The microcin operon is shown in brown, plasmid maintenance systems are shown in yellow, the replicon is shown in pink the conjugative transfer system is represented in blue, hypothetical proteins are shown in turquoise, origins of replication are in green and the 149 bp direct repeats are shown in red. Analysis based on the complete sequence as submitted to Genbank (ON989342). Diagram generated using DNAplotter (Carver et al., 2009).

3.4. MccB17 operon

The mcb operon, consisting of genes mcbABCDEFG encoding biosynthetic and immunity functions for MccB17, is located between gene_14 (encoding a hypothetical protein) and fdtC (encoding an acetyltransferase). The nucleotide and amino acids sequences of genes in the mcb operon of pMccB17 (ON989342) were compared with some historical published sequences (Table 1). The M24253 (Genbank) sequence, derived by Sanger sequencing of a cloned DNA fragment of pMccB17, provided the first available sequence of mcbA, mcbB, mcbC, and mcbD (Genilloud et al., 1989). The X07875 (Genbank) sequence, also obtained via Sanger sequencing of a cloned fragment of pMccB17, includes the remaining three genes mcbE, mcbF, and mcbG (Garrido et al., 1988). The ON989342 sequence should in theory be identical to the M24253 and X07875 sequences and the plasmid pMccB17 as sequenced here was provided by one of the publishing authors (Roberto Kolter) of the historical sequences (Garrido et al., 1988; Genilloud et al., 1989). The FM877811 sequence provides a complete mcb operon sequence and was selected because of this. This is not the original mcb operon, rather it is from the whole genome sequence of E. coli strain L1000, isolated from human feces, and appears to be chromosomal rather than plasmid‐borne (Zihler et al., 2009). Nucleotide sequences of mcbA, mcbC, mcbE, and mcbG were 100% identical to those in the historical sequences M24253 and X07875. However, mcbB and mcbD each differed by a single base pair from M24253, resulting in a single nonconservative amino acid substitution in each case (the amino acid in our sequence is shown first): S117C for McbB and R171T for McbD. Our McbB and McbD sequences also differed from FM877811 by a single (but different) substitution in each case: E198D and A113T respectively. As sequenced here, mcbF was annotated as 732 bp versus 744 bp in the historical X07875 sequence, reflecting a frameshift towards the 3′ end of the latter gene due to the C at position 688 of the new sequence is missing from X07875. There are also five substitutions in the sequence 5′ of this indel and overall this gene and hence the encoded McbF protein has the greatest difference from historical published sequences for the mcb operon (Table 1).

Table 1.

Comparison of the proteins encoded in the mcb operon of pMccB17 (ON989342) with selected published mcb operon sequences.

Protein Predicted function Number of amino acids (% identity to ON989342)
GB:ON989342 GB:FM877811 GB:M24253 GB:X07875
McbA Microcin precursor 69 69 (100) 69 (100) −
McbB Microcin B synthase enzyme complex 295 295 (99.7) 295 (99.7) −
McbC 272 272 (100) 272 (100) −
McbD 396 396 (99.7) 396 (99.7) −
McbE Self‐immunity and export 241 241 (100) − 241 (100)
McbF Self‐immunity and export 243 243 (100) − 247 (91.5)
McbG Self‐immunity 187 187 (99.5) − 187 (100)
Open in a new tab

We do not believe that the RYC1000 [pMccB17]) strain sequenced here has been passaged extensively since it was derived from the original capture of pMccB17 by conjugation into BM21 (Baquero et al., 1978). Due to the time elapsed, we are unable to confirm how many passages the pMccB17 plasmid has undergone between the original sequencing and our sequencing reported here. It is possible that the differences we observed, compared to the original sequences, are due to mutations accumulated during passage. However, we hypothesized that the differences observed were due to Sanger sequencing errors in the historical sequences i.e. that our pMccB17 sequence is correct. To confirm the mcb operon sequence presented here, we obtained pPY113 another clone of the mcb operon that was independently derived from the parental BM21 [pMccB17] strain, and sequenced it using an orthogonal high‐coverage long‐read approach (Yorgey et al., 1994). The resulting pPY113 plasmid sequence (Genbank: OR091272) is identical to our sequence of pMccB17 throughout the shared mcb operon sequences. Hence, we believe that it is unlikely that these differences reflect mutations accumulated by our pMccB17 strain and much more likely that they are due to inaccuracies in Sanger sequencing, which is a relatively error‐prone process.

3.5. Direct repeats

In the process of aligning contigs 1.27 and 1.52 with contig 2.1, to ascertain the complete plasmid sequence, we discovered a 149 bp direct repeat in contig 2.1 (Appendix Figure A1). This 149 bp sequence is repeated twice (8639 bp apart) in the sequence of pMccB17. These repeats are identical and each has an intragenic location: one is located between yffA and ydaB, whereas the other is located between hok/sok and yubO. These repeats have 12 genes in between them, including ssb, pbf, psiAB, and the hok/sok TA system. This approximately corresponds to the plasmid leading region as originally defined for F plasmid (Loh et al., 1989). A large perfect palindrome [5′‐CAAAATTTTTTACC]CAAAACCC[GGTAAAAAATTTTG‐3′] is present at the center of this sequence, with some imperfectly palindromic sequences to either side (Appendix Figure A1). This may result in the formation of functional secondary structures, in either single‐stranded DNA produced during conjugation or mRNA produced during transcription.

Searches using BLASTn against the nucleotide collection (nr/nt) database at NCBI revealed that the repeated sequence is present in IncF plasmids of Gammaproteobacteria, mainly from the Enterobacterales, In 20 plasmids examined, having query coverage and identity of 100%, copy number ranged from 1 to 3 and all were members of the IncF family. The exact function of these repeated sequences is unknown, but several genes are commonly flanked by these repeats, including ssb, pbf (see below), and psiAB.

3.6. Pbf protein

Upstream of psiB is a gene encoding 652 amino acids that we have annotated as “pbf” (for ParB fusion) as it features a ParB‐like N‐terminal domain joined to a C‐terminal region that does not include any known conserved domain. A BLASTp search of its amino acids against the nonredundant protein sequences (nr) database at NCBI confirmed that its N‐terminal region (the first 250 amino acids) contains a conserved domain, annotated as “ParB/RepB/Spo0J family partition protein.” Thus, Pbf is evolutionarily, if not functionally, related to proteins that (via interactions with an NTPase partner ParA and a centromere‐like partition site on the DNA, parS) are involved in the active partitioning of bacterial chromosomes and low copy‐number plasmids (McLean & Le, 2023; Appendix Figure A2). The classical plasmid F carries a homologous gene (orf652 which is 94% identical to pbf) and the similarity of the encoded protein to ParB was first described by Manwaring et al. (1999).

4. CONCLUSIONS

Plasmid pMccB17 seems a typical member of the IncFII family, apart from its carriage of the MccB17 biosynthetic gene cluster mcb. This plasmid does not carry any identifiable insertion sequence or other mobile genetic elements, nor does it encode any known antibiotic resistance genes (apart from those conferring immunity to MccB17) or pathogenicity factors. We have reported here a complete and accurate sequence of the mcb operon, which will be useful for future studies and manipulation of the biosynthetic pathway for this prototypical RiPP.

AUTHOR CONTRIBUTIONS

Mayokun Ajeigbe: Conceptualization (equal), writing—original draft (lead), formal analysis (lead), writing—review and editing (equal). Stephen Childs: Conceptualization (equal), writing—review and editing (equal). Timothy Paget: conceptualization (equal), writing—review and editing (equal). Lewis Bingle: Conceptualization (lead), formal analysis (supporting), writing—review and editing (equal).

CONFLICT OF INTEREST STATEMENT

The authors declare no conflict of interest.

ETHICS STATEMENT

None required.

ACKNOWLEDGMENTS

The authors would like to thank Professor Roberto Kolter and Dr Nicolas Lyons of Harvard Medical School for supplying pMccB17 DNA and for helpful discussion. Genome sequencing was provided by MicrobesNG (http://www.microbesng.uk), supported by the BBSRC (grant number BB/L024209/1). We are grateful to Dr Linda Henry and Mrs Kayleigh Ironside for technical assistance, and to Dr Callum Cooper and Dr Jon Marles‐Wright for their useful comments.

1.

Table A1.

Primer sequences for gap‐closing PCR amplifications between contigs of pMccB17.

Gaps 5′ Forward 3′ 5′ Reverse 3′ Annealing temperature (°C) and PCR system
Contig 1.27 CTGATACAGCCACAACCTGC GTTTGAGAACCTTCGCCGC 65, Q5 Master Mix
Contig 1.52 CTGATACAGCCACAACCTGC CTGTTTGAGAACCTTCGCCG 65, Q5 Master Mix
Contig 2.1 AGAAATACCGGATTCAGTCCG GAAATCAGGACTGTCCTGGC 50‐60, ImmoMix
Open in a new tab

Abbreviation: PCR, polymerase chain reaction.

Figure A1.

Figure A1

Open in a new tab

Direct repeat sequence from pMccB17. This sequence occurs twice in the pMccB17 genome. (a) The 149 bp repeated sequence. The two arms of a large perfect palindrome at the center of the sequence have been underlined. (b) Predicted secondary structure formed by RNA encoded by this sequence (initial ΔG = −67.80). A highly similar structure was predicted for ssDNA (dG = −35.09). These structures were predicted using mfold version 3.6, with default parameters, as implemented by the UNAFold Web Server (Zuker, 2003; www.unafold.org).

Figure A2.

Figure A2

Open in a new tab

Phylogenetic analysis of ParB family proteins. Pbf proteins are highlighted in red. The clades are named in this order: name of the ParB family protein, two letters representing the organism it is found, plasmid it is found in (only in Pbf), and plasmid incompatibility group (only in Pbf). EC = Escherichia coli; SE = Salmonella enterica; S = Salmonella; PA = Pseudomonas aeruginosa; Ssp. = Streptomyces sp.; ED = Enterococcus durans; TT = Thermus thermophilus; BS = Bacillus subtilis; EPp1 = Escherichia phage P1; SF = Shigella flexneri; CB = Coxiella burnetii; DR = Deinococcus radiodurans; VC = Vibrio cholerae; NM = Neisseria meningitidis; PP = Pseudomonas putida. The evolutionary history was inferred by using the Maximum Likelihood method and the Le_Gascuel (L + G) model. The tree with the highest log likelihood (−5208.41) is shown. The percentage of trees in which the associated taxa clustered together is shown below the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor‐Join and BioNJ algorithms to a matrix of pairwise distances estimated using a JTT model and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories ( + G, parameter = 3.2901)). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. All positions with less than 95% site coverage were eliminated, that is, fewer than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position (partial deletion option). There were a total of 169 positions in the final data set. Evolutionary analyses were conducted in MEGA X.

Table A2.

CDS identified in pMccB17.

CDS Position (bp) Protein function
ycfA 49. .819 Hypothetical protein
klcA 1235. .1660 Antirestriction protein
gene_78 1707. .2129 Hypothetical protein
yffA 2126. .2317 Hypothetical protein
ydaB 3355. .3585 Hypothetical protein
ydbA 3637. .4998 Hypothetical protein
rsmA 5045. .5608 Ribosomal RNA small subunit methyltransferase A
gene_73 5608. .5874 Hypothetical protein
ssb 6517. .7056 Plasmid‐derived single‐stranded DNA‐binding protein
yubL 7118. .7351 Hypothetical protein
pbf 7416. .9374 ParB fusion protein
psiB 9429. .9863 Plasmid SOS inhibition protein B
psiA 9860. .10579 Plasmid SOS inhibition protein A
sok Complement (10748. .10813) Antisense RNA of hok transcripts
mok 10801. .11013 Modulation of hok protein
hok 10859. .11017 Postsegregation killing protein
yubO 11944. .12231 Hypothetical protein
yubP 12350. .13171 Hypothetical protein
iagB Complement (13466. .13975) Invasion protein
traM 14391. .14774 Relaxosome protein
traJ 14968. .15639 Conjugal transfer transcriptional regulator
traY 15776. .16003 Relaxosome protein TraY
traA 16036. .16395 Pilin TraA
traL 16410. .16721 Peripheral membrane protein TraL
traE 16743. .17309 Bacterial sex pilus assembly and synthesis proteins TraE
traK 17296. .18024 Pilus assembly TraK
traB 18024. .19475 Involved in F pilus assembly
traP 19465. .20031 Conjugation protein
trbD 19970. .20341 Conjugal transfer protein TrbD
gene_53 20334. .20843 Hypothetical protein
traV 20836. .21348 Conjugative transfer system lipoprotein
yafA 21697. .22110 Hypothetical protein
yfhA 22103. .22576 Hypothetical protein
orfH 22657. .22875 Hypothetical protein
orfI 22903. .23250 Hypothetical protein
traC 23376. .26006 Conjugative transfer ATPase
trbI 26003. .26389 Type‐F conjugative transfer system protein
traW 26386. .27018 Type‐F conjugative transfer system protein
traU 27015. .28007 Conjugal DNA transfer protein
ygeA 28034. .28342 Hypothetical protein
gene_42 28405. .28923 Hypothetical protein
trbC 28950. .29588 Type‐F conjugative transfer system pilin assembly protein
gene_40 29585. .29956 Hypothetical protein
hnh 29981. .30403 Hnh nuclease
traN 30400. .32250 Type‐F conjugative transfer system mating‐pair stabilization protein
trbE 32277. .32534 Type IV conjugative transfer system protein
traF 32527. .33270 Type‐F conjugative transfer system pilin assembly protein
trbA 33284. .33628 Conjugal transfer repressor
traQ 33747. .34031 Type‐F conjugative transfer system pilin chaperone
trbB 34018. .34563 Type‐F conjugative transfer system pilin assembly thiol‐disulfide isomerase
trbF 34821. .35213 Plasmid mobilization
traH 35200. .36573 Type IV conjugative transfer system protein
traG 36570. .39395 Mating pair stabilization protein
traS 39392. .39901 Conjugal transfer entry exclusion protein
traT 39915. .40646 Lipoprotein TraT
gene_27 40849. .41586 Hypothetical protein
traD 41637. .43835 Type IV conjugative transfer system, coupling protein TraD
traI 43835. .49105 Conjugative transfer relaxase protein
traX 49125. .49871 Type‐F conjugative transfer system pilin acetylase
gene_23 49930. .50790 2,6‐dihydropseudooxynicotine hydrolase
finO 50893. .51453 Fertility inhibition protein
gene_21 51598. .51840 Hypothetical protein
nuc 52039. .52500 Thermonuclease nuc
gene_19 52794. .53384 Hypothetical protein
repA2 53624. .53881 Replication regulatory protein
copA Complement (54012. .54104) Leader peptide regulator for RepA expression
repA6 54116. .54190
repA 54183. .55040 Plasmid replication initiator
relB/parD 56110. .56373 Toxin‐antitoxin system
relE/parE 56363. .56662 Toxin‐antitoxin system
gene_14 Complement (56698. .57363) Hypothetical protein
mcbG Complement (57933. .58496) Microcin B17 immunity protein, McbG
mcbF Complement (58500. .59231) Microcin B17 export protein, McbF
mcbE Complement (59228. .59953) Microcin B17 export protein, McbE
mcbD Complement (59963. .61153) Microcin B17 synthetase complex protein, McbD
mcbC Complement (61134. .61952) Microcin B17 synthetase complex protein, McbC
mcbB Complement (61954. .62841) Microcin B17 synthetase complex protein, McbB
mcbA Complement (62868. .63077) Microcin B17 precursor peptide
fdtC 63607. .64059 dTDP‐3‐amino‐3,6‐dideoxy‐alpha‐d‐galactopyranose 3‐N‐acetyltransferase
stbB Complement (64462. .64815) Type IV partitioning system
stbA Complement (64815. .65777) Type IV partitioning system
gene_3 66289. .67215 Hypothetical protein
yhdJ 67600. .68283 DNA adenine methyltransferase YhdJ
gene_1 68284. .68505 Hypothetical protein
Gene_81 68519. .68950 Hypothetical protein
Open in a new tab

Abbreviation: CDS, coding sequence.

Ajeigbe, M. , Childs, S. , Paget, T. A. , & Bingle, L. E. H. (2024). Complete nucleotide sequence and comparative genomic analysis of microcin B17 plasmid pMccB17. MicrobiologyOpen, 13, e1402. 10.1002/mbo3.1402

DATA AVAILABILITY STATEMENT

Plasmid genome sequences are available in GenBank with the following accession numbers: pMccB17, ON989342: https://www.ncbi.nlm.nih.gov/nuccore/ON989342; and pPY113, OR091272: https://www.ncbi.nlm.nih.gov/nuccore/OR091272

REFERENCES

  1. Altschul, S. (1997). Gapped BLAST and PSI‐BLAST: a new generation of protein database search programs. Nucleic Acids Research, 25(17), 3389–3402. 10.1093/nar/25.17.3389 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arnison, P. G. , Bibb, M. J. , Bierbaum, G. , Bowers, A. A. , Bugni, T. S. , Bulaj, G. , Camarero, J. A. , Campopiano, D. J. , Challis, G. L. , Clardy, J. , Cotter, P. D. , Craik, D. J. , Dawson, M. , Dittmann, E. , Donadio, S. , Dorrestein, P. C. , Entian, K. D. , Fischbach, M. A. , Garavelli, J. S. , … van der Donk, W. A. (2013). Ribosomally synthesized and post‐translationally modified peptide natural products: Overview and recommendations for a universal nomenclature. Natural Products Reports, 30(1), 108–160. 10.1039/C2NP20085F [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bankevich, A. , Nurk, S. , Antipov, D. , Gurevich, A. A. , Dvorkin, M. , Kulikov, A. S. , Lesin, V. M. , Nikolenko, S. I. , Pham, S. , Prjibelski, A. D. , Pyshkin, A. V. , Sirotkin, A. V. , Vyahhi, N. , Tesler, G. , Alekseyev, M. A. , & Pevzner, P. A. (2012). SPAdes: a new genome assembly algorithm and its applications to single‐cell sequencing. Journal of Computational Biology, 19(5), 455–477. 10.1089/cmb.2012.0021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Baquero, F. , Bouanchaud, D. , Martinez‐Perez, M. C. , & Fernandez, C. (1978). Microcin plasmids: A group of extrachromosomal elements coding for low‐molecular‐weight antibiotics in Escherichia coli . Journal of Bacteriology, 135(2), 342–347. 10.1128/jb.135.2.342-347.1978 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Berriman, M. (2003). Viewing and annotating sequence data with Artemis. Briefings in Bioinformatics, 4(2), 124–132. 10.1093/bib/4.2.124 [DOI] [PubMed] [Google Scholar]
  6. Bolger, A. M. , Lohse, M. , & Usadel, B. (2014). Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics, 30, 2114–2120. 10.1093/bioinformatics/btu170 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Carattoli, A. , Zankari, E. , García‐Fernández, A. , Voldby Larsen, M. , Lund, O. , Villa, L. , Møller Aarestrup, F. , & Hasman, H. (2014). In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrobial Agents and Chemotherapy, 58, 3895–3903. 10.1128/AAC.02412-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Carver, T. , Berriman, M. , Tivey, A. , Patel, C. , Böhme, U. , Barrell, B. G. , Parkhill, J. , & Rajandream, M. A. (2008). Artemis and ACT: Viewing, annotating and comparing sequences stored in a relational database. Bioinformatics, 24(23), 2672–2676. 10.1093/bioinformatics/btn529 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Carver, T. , Thomson, N. , Bleasby, A. , Berriman, M. , & Parkhill, J. (2009). DNAPlotter: Circular and linear interactive genome visualization. Bioinformatics, 25(1), 119–120. 10.1093/bioinformatics/btn578 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Carver, T. J. , Rutherford, K. M. , Berriman, M. , Rajandream, M. A. , Barrell, B. G. , & Parkhill, J. (2005). ACT: The Artemis comparison tool. Bioinformatics, 21(16), 3422–3423. 10.1093/bioinformatics/bti553 [DOI] [PubMed] [Google Scholar]
  11. Collin, F. , & Maxwell, A. (2019). The microbial toxin microcin B17: Prospects for the development of new antibacterial agents. Journal of Molecular Biology, 431(18), 3400–3426. 10.1016/j.jmb.2019.05.050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Collin, F. , Thompson, R. E. , Jolliffe, K. A. , Payne, R. J. , & Maxwell, A. (2013). Fragments of the bacterial toxin microcin B17 as gyrase poisons. PloS one, 8(4), e61459. 10.1371/journal.pone.0061459 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Duquesne, S. , Destoumieux‐Garzón, D. , Peduzzi, J. , & Rebuffat, S. (2007). Microcins, gene‐encoded antibacterial peptides from enterobacteria. Natural Product Reports, 24(4), 708–734. 10.1039/b516237h [DOI] [PubMed] [Google Scholar]
  14. Fernandez‐Lopez, R. , de Toro, M. , Moncalian, G. , Garcillan‐Barcia, M. P. , & de la Cruz, F. (2016). Comparative genomics of the conjugation region of F‐like plasmids: Five shades of F. Frontiers in Molecular Biosciences, 3, 71. 10.3389/fmolb.2016.00071 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Garcillán‐Barcia, M. P. , Alvarado, A. , & de la Cruz, F. (2011). Identification of bacterial plasmids based on mobility and plasmid population biology. FEMS Microbiology Reviews, 35, 936–956. 10.1111/j.1574-6976.2011.00291.x [DOI] [PubMed] [Google Scholar]
  16. Garcillán‐Barcia, M. P. , Redondo‐Salvo, S. , Vielva, L. , & de la Cruz, F. (2020). MOBscan: Automated Annotation of MOB Relaxases. In: de la Cruz F., (Ed.), Horizontal Gene Transfer: Methods and Protocols, Methods in Molecular Biology (pp. 295–308). Springer. 10.1007/978-1-4939-9877-7_21 [DOI] [PubMed] [Google Scholar]
  17. Garrido, M. C. , Herrero, M. , Kolter, R. , & Moreno, F. (1988). The export of the DNA replication inhibitor microcin B17 provides immunity for the host cell. The EMBO Journal, 7(6), 1853–1862. 10.1002/j.1460-2075.1988.tb03018.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Genilloud, O. , Moreno, F. , & Kolter, R. (1989). DNA sequence, products, and transcriptional pattern of the genes involved in production of the DNA replication inhibitor microcin B17. Journal of Bacteriology, 171(2), 1126–1135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ghilarov, D. , Stevenson, C. E. M. , Travin, D. Y. , Piskunova, J. , Serebryakova, M. , Maxwell, A. , Lawson, D. M. , & Severinov, K. (2019). Architecture of microcin B17 synthetase: An octameric protein complex converting a ribosomally synthesized peptide into a DNA gyrase poison. Molecular Cell, 73(4), 749–762.e5. 10.1016/j.molcel.2018.11.032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Heddle, J. G. , Blance, S. J. , Zamble, D. B. , Hollfelder, F. , Miller, D. A. , Wentzell, L. M. , Walsh, C. T. , & Maxwell, A. (2001). The antibiotic microcin B17 is a DNA gyrase poison: Characterisation of the mode of inhibition. Journal of Molecular Biology, 307(5), 1223–1234. 10.1006/jmbi.2001.4562 [DOI] [PubMed] [Google Scholar]
  21. Jolley, K. A. , Bray, J. E. , & Maiden, M. C. J. (2018). Open‐access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Research, 3, 124. 10.12688/wellcomeopenres.14826.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kumar, S. , Stecher, G. , Li, M. , Knyaz, C. , & Tamura, K. (2018). MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35(6), 1547–1549. 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Le, S. Q. , & Gascuel, O. (2008). An improved general amino acid replacement matrix. Molecular Biology and Evolution, 25(7), 1307–1320. 10.1093/molbev/msn067 [DOI] [PubMed] [Google Scholar]
  24. Liu, B. , Zheng, D. , Jin, Q. , Chen, L. , & Yang, J. (2019). VFDB 2019: A comparative pathogenomic platform with an interactive web interface. Nucleic Acids Research, 47(D1), D687–D692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Loh, S. , Cram, D. , & Skurray, R. (1989). Nucleotide sequence of the leading region adjacent to the origin of transfer on plasmid F and its conservation among conjugative plasmids. Molecular and General Genetics, 219(1–2), 177–186. 10.1007/BF00261174 [DOI] [PubMed] [Google Scholar]
  26. Manwaring, N. P. , Skurray, R. A. , & Firth, N. (1999). Nucleotide sequence of the F plasmid leading region. Plasmid, 41(3), 219–225. 10.1006/plas.1999.1390 [DOI] [PubMed] [Google Scholar]
  27. Needleman, S. B. , & Wunsch, C. D. (1970). A general method applicable to the search for similarities in the amino acid sequence of two proteins. Journal of Molecular Biology, 48, 443–453. 10.1016/0022-2836(70)90057-4 [DOI] [PubMed] [Google Scholar]
  28. McLean, T. C. , & Le, T. B. (2023). CTP switches in ParABS‐mediated bacterial chromosome segregation and beyond. Current Opinion in Microbiology, 73, 102289. 10.1016/j.mib.2023.102289 [DOI] [PubMed] [Google Scholar]
  29. Pierrat, O. A. , & Maxwell, A. (2003). The action of the bacterial toxin microcin B17. Journal of Biological Chemistry, 278(37), 35016–35023. 10.1074/jbc.M304516200 [DOI] [PubMed] [Google Scholar]
  30. Rutherford, K. , Parkhill, J. , Crook, J. , Horsnell, T. , Rice, P. , Rajandream, M. A. , & Barrell, B. (2000). Artemis: Sequence visualization and annotation. Bioinformatics, 16(10), 944–945. 10.1093/bioinformatics/16.10.944 [DOI] [PubMed] [Google Scholar]
  31. San Millan, J. L. , Hernandez‐Chico, C. , Pereda, P. , & Moreno, F. (1985). Cloning and mapping of the genetic determinants for microcin B17 production and immunity. Journal of Bacteriology, 163(1), 275–281. 10.1128/jb.163.1.275-281.1985 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Seemann, T. (2014). Prokka: Rapid prokaryotic genome annotation. Bioinformatics, 30(14), 2068–2069. 10.1093/bioinformatics/btu153 [DOI] [PubMed] [Google Scholar]
  33. Varani, A. M. , Siguier, P. , Gourbeyre, E. , Charneau, V. , & Chandler, M. (2011). ISsaga is an ensemble of web‐based methods for high throughput identification and semi‐automatic annotation of insertion sequences in prokaryotic genomes. Genome Biology, 12(3), R30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Villa, L. , García‐Fernández, A. , Fortini, D. , & Carattoli, A. (2010). Replicon sequence typing of IncF plasmids carrying virulence and resistance determinants. Journal of Antimicrobial Chemotherapy, 65, 2518–2529. 10.1093/jac/dkq347 [DOI] [PubMed] [Google Scholar]
  35. Withanage, S. , Masschelein, J. , & Pinheiro, V. B. (2013). Escherichia coli Microcin B17 as a chassis for the development of novel antimicrobial peptides. 10.1101/2023.08.29.555279. [DOI]
  36. Yorgey, P. , Lee, J. , Kördel, J. , Vivas, E. , Warner, P. , Jebaratnam, D. , & Kolter, R. (1994). Posttranslational modifications in microcin B17 define an additional class of DNA gyrase inhibitor. Proceedings of the National Academy of Sciences, 91(10), 4519–4523. 10.1073/pnas.91.10.4519 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zankari, E. , Hasman, H. , Cosentino, S. , Vestergaard, M. , Rasmussen, S. , Lund, O. , Aarestrup, F. M. , & Larsen, M. V. (2012). Identification of acquired antimicrobial resistance genes. Journal of Antimicrobial Chemotherapy, 67(11), 2640–2644. 10.1093/jac/dks261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhang, Z. , Schwartz, S. , Wagner, L. , & Miller, W. (2000). A greedy algorithm for aligning DNA sequences. Journal of Computational Biology, 7(1–2), 203–214. 10.1089/10665270050081478 [DOI] [PubMed] [Google Scholar]
  39. Zihler, A. , Le Blay, G. , de Wouters, T. , Lacroix, C. , Braegger, C. P. , Lehner, A. , Tischler, P. , Rattei, T. , Hächler, H. , & Stephan, R. (2009). In vitro inhibition activity of different bacteriocin producing Escherichia coli against Salmonella strains isolated from clinical cases. Letters in Applied Microbiology, 49(1), 31–38. 10.1111/j.1472-765X.2009.02614.x [DOI] [PubMed] [Google Scholar]
  40. Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research, 31(13), 3406–3415. 10.1093/nar/gkg595 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Plasmid genome sequences are available in GenBank with the following accession numbers: pMccB17, ON989342: https://www.ncbi.nlm.nih.gov/nuccore/ON989342; and pPY113, OR091272: https://www.ncbi.nlm.nih.gov/nuccore/OR091272

Articles from MicrobiologyOpen are provided here courtesy of Wiley

RESOURCES