Viremia and clinical manifestations in acute febrile patients of Chikungunya infection during the 2016 CHIKV outbreak in Delhi, India

Abstract

Background

Chikungunya virus (CHIKV) is an infectious agent that caused several outbreaks among different countries and affected approximately 1.3 million Indian populations. It is transmitted by Aedes mosquito–either A. albopictus or A. aegypti. Generally, the clinical manifestations of CHIKV infection involve high-grade fever, joint pain, skin rashes, headache, and myalgia. The present study aims to investigate the relationship between the CHIKV virus load and clinical symptoms of the CHIKV infection so that better patient management can be done in the background of the CHIKV outbreak as there is no licensed anti-viral drug and approved vaccines available against CHIKV.

Methods

CHIKV RTPCR positive samples (n = 18) (Acute febrile patients having D.O.F ≤ 7 days) were taken for the quantification of CHIKV viremia by Real-Time PCR. Clinical features of the febrile patients were recorded during the collection of blood samples.

Results

The log mean virus load of 18 RT-PCR-positive samples was 1.3 × 10⁶ copies/mL (1.21 × 10³–2.33 × 10⁸ copies/mL). Among the observed clinical features, the log mean virus load (CHIKV) of the patients without skin rash is higher than in the patients with skin rash (6.61 vs 5.5, P = 0.0435).

Conclusion

The conclusion of the study was that the patients with skin rashes had lower viral load and those without skin rashes had higher viral load.

1. Introduction

Chikungunya virus (CHIKV) is an infectious agent that caused several outbreaks among different countries in Southeast Asia, Africa, the Indian Ocean islands, and India and affected approximately 1.3 million Indian populations [1]. Amongst the several arboviral infections, CHIKV has the potential to re-emerge [2] and is considered a neglected tropical disease. CHIKV is a single-stranded RNA virus that belongs to the Alphavirus genus of the Togaviridae family [3]. It is transmitted by Aedes mosquito – either Aedes albopictus or Aedes aegypti [4]. Generally, the clinical manifestations of CHIKV infection involve high-grade fever, joint pain, skin rashes, headache, and myalgia [2,5]. There are approximately 50%–97% of individuals infected with the chikungunya virus develop clinical disease [6], [7], [8]. The most common clinical symptom observed in CHIKV infection is polyarthralgia [4]. Approximately in 50% of CHIKV-infected patients, skin rashes are reported in the acute phase [9].

The manifestation of clinical symptoms is the outcome of virus replication in host cells, the immune response generated in response to viremia, and interactions between virus and host factors depending on the duration of illness [10,11]. Severe CHIKV infection is associated with increased plasma levels of proinflammatory cytokines like IL-6, IL-12, and Interferon α [12,13]. In the case of humans, the plasma level of Interferon α is correlated with viral load. The viremic phase persists for 1-4 days [14] and after that seroconversion phase starts. Host innate immune responses are triggered by viral replication but virus spreads in several sites of replication like lymphoid organs, skin (rash), muscles, peripheral joints [15], [16], [17]. Replication of CHIKV in peripheral tissues results in a high viral load in plasma (>10⁹ virus particles/mL) [18]. There is no licensed antiviral drugs that can target the primary and secondary site of replication of CHIKV. During the CHIKV outbreak and in the area where viremia cannot be determined, in such conditions, clinical symptoms can be used as a marker for viremia to guide treatment. The present study aims to investigate the relationship between the CHIKV virus load and clinical symptoms of the CHIKV infection so that better patient management can be performed in the background of the CHIKV outbreak as there is no licensed antiviral drug and approved vaccines available against CHIKV.

2. Materials and methods

2.1. Sample collection

Blood samples of suspected Chikungunya febrile patients (D.O.F ≤7 days) were collected from HAH Centenary Hospital, Jamia Hamdard, Hamdard Nagar, New Delhi from August 2016 to November 2016 (n = 325) during CHIKV outbreak in Delhi. Out of 325, only 29 patients were CHIKV positive by RT-PCR. Moreover, All the samples included in this study are CHIKV IgM and CHIKV IgG negative. As, we were left with plasma of only 18 samples, so 18 samples were taken for estimation of chikungunya viral load.

2.2. RNA extraction and real time PCR

CHIKV was isolated from plasma samples by using a kit (Qiagen mini viral RNA, Cat. No 52906). A complementary DNA kit (RevertAid H Minus First Strand cDNA synthesis kit; Cat. No K1632)) was used to construct cDNA from isolated RNA. For the determination of CHIKV virus load in plasma, another commercially available kit (Maxima SYBR Green/ROX qPCR; Cat. No K0223) was used. A total of 20 µL reaction mixture was prepared, out of which 10 µL was RNA template and 10 µL compromised of other reaction components. The primers used for the PCR were designed with the help of software (Primer Express, Thermo Fisher Scientific, Waltham, MA, USA). Specific primers targeting 120 bp region of E1 envelope gene of CHIKV were used for amplification (Forward primer 5′-3′ TACAGCCCCATGGTACTGCA and reverse primer 5′-3′ CTGTACCGCAGCATTTCACG). Real-time PCR was performed at different thermal conditions of 95°C for 3 min, 95°C for 10 s, 55°C for 1 min, 65°C for 10 s, and 95°C for 10 min. The size of the amplification product was 120 bp. The CHIKV S27 strain (African prototype) was used as a positive control during the experiment. All the samples were run in duplicate. For construction of the standard curve, the control cDNA (865.3 ng/ul) was serially diluted 10-fold up to 6 dilutions and obtained cycle threshold (ct) values were plotted against log dilution of the DNA (Fig. 1). The copy numbers in test samples were determined from the intersection point on standard plot. For calculating genome copy number for standard, cDNA concentration was used and calculated by using online tool (https://eu.idtdna.com/pages/education/decoded/article/calculations-converting-from-nanograms-to-copy-number). The clinical symptoms of CHIKV-positive samples were recorded at the time of blood sample collection.

Fig. 1.

The standard curve was generated from the Cq values obtained against the known concentration of six-fold serially diluted CHIKV cDNA. The standard curve shows a correlation coefficient of 0.981 and efficiency = 127.6%).

2.3. Statistical analysis

Categorical variables were analyzed by chi-square test. p- values less than 0.05 were considered to be statistically significant. GraphPad Prism 8.4.3 was used for statistical analysis.

3. Results

3.1. Clinical features

Clinical features of CHIKV patients (n = 18) were recorded during the first 7 days of illness. Out of 18, 10 were males and 8 were females. The age of the patients varied from 19 to 54 years. The symptoms that were frequently observed in CHIKV patients were joint pain (94.44%), joint swelling (61.11%), headache (94.44%), and vomiting (55.56%). Other clinical symptoms include skin rash (38.89%), diarrhea (22.22%), abdominal pain (16.67%), Rhinitis (33.33) and cough (16.66%) (Table 1).

Table 1.

Demographic and clinical characteristics of CHIKV RT-PCR positive febrile patients (n = 18).

Characteristics	Number (n = 18)	Percentage (%)
Age median range in years	38 (19–54)
Male	10	55.56
Female	8	44.44
Rash	7	38.89
Joint Pain	17	94.44
Joint swelling	11	61.11
Headache	17	94.44
Vomiting	10	55.56
Diarrhea	4	22.22
Abdominal pain	3	16.67
Rhinitis	6	33.33
Cough	5	16.66

3.2. Viral load

RT-PCR positive samples (n = 18) were taken for the quantification of viral load in samples by SYBR- Green-based real-time RT-PCR assay. RNA templates from CHIKV S-27 strain was used as a positive control. Based on the standard curve plotted, the highest amount of viral load was detected in serum #11 with a quantity of genomic RNA of 2.33 × 10⁸ copies/mL (Table 2). The lowest number of viral genomic RNA copies was estimated to be 1.21 × 10³ copies/mL for serum #1 (Table 2).

Table 2.

Determination of Sera viral load from CHIKV RT-PCR positive samples (n = 18).

Patients’ serum specimen number	Patient sex	Patient age (yr)	Mean genomic RNA copy number (copies/mL)
#1	M	50	1.21 × 103
#2	F	52	5.28 × 104
#3	F	45	5.03 × 106
#4	F	21	5.42 × 105
#5	M	38	6.67 × 105
#6	M	28	5.01 × 107
#7	F	19	1.28 × 105
#8	F	30	1.08 × 107
#9	M	43	1.43 × 108
#10	M	31	1.36 × 106
#11	M	25	2.33 × 108
#12	F	50	9.55 × 107
#13	M	38	6.49 × 106
#14	M	40	5.32 × 103
#15	M	20	3.38 × 105
#16	F	54	3.48 × 106
#17	M	35	3.29 × 105
#18	M	24	1.45 × 104
Positive control	–	–	1.16 × 1012
Negative control	–	–	Undetermined

Note: The equation of the standard curve constructed for the SYBR Green real-time RT-PCR assay was R² value = 0.981, Efficiency = 127.6%).

CHIKV viral load of acute febrile patients (D.O.F:1-7 days) was estimated by qRT-PCR and the log mean virus load of 18 RT-PCR positive samples was 1.3 × 10⁶ copies/mL. Clinical symptoms were correlated with the CHIKV virus load. A significant difference in CHIKV virus load was found between patients with or without skin rash (P = 0.0435). The log mean CHIKV virus load of the patients without skin rashes is higher than in the patients with skin rashes (6.61 vs 5.15) (Fig. 2). On the other hand, a significant difference in CHIKV virus load was observed between subjects with or without headache (P = 0.033). The log mean CHIKV virus load of the subjects without headache is higher than the subjects with headache (8.06 vs 5.79) (Fig. 2).

Fig. 2.

Association of CHIKV viral load (n = 18) with different clinical features (rash, joint pain, joint swelling, headache, vomiting, diarrhea, abdominal pain, rhinitis and cough) where rash (P = 0.0435) and headache (P = 0.0331) were found statistically significant as compared to other clinical symptoms. P-value found statistically significant was marked by asterick.

4. Discussion

CHIKV infection is one of the mosquito-borne viral diseases and is considered to be a major public threat globally. It has re-emerged in different parts of the world and caused several outbreaks [19], [20], [21], [22]. CHIKV symptomatic patients are characterized by symptoms like high-grade fever, polyarthralgia, headache, myalgia, and Skin rash [23], [24], [25]. Clinical manifestations like arthralgia may be responsible for the increase in the duration of illness [26].

In this study, the most frequently observed clinical manifestations in acute febrile patients were joint pain and headache [10,14,27]. The clinical manifestations of CHIKV infection is the outcome of the cumulative effect of viral load and the host immune response against the virus by generating neutralizing antibodies [10].

In this study, among all the clinical features recorded, skin rash (P = 0.04) and headache (P = 0.03) varied with the differences in viral load. Interestingly, the patients who had no rashes had more chikungunya virus load as compared to patients that have rashes. This finding is in concordance with a report where skin rashes were negatively correlated with high CHIKV viral load [28]. It may appear that skin rash is experienced relatively more by CHIKV patients, during the seroconversion phase instead of the viremic phase of acute infection. A report showed a pictorial representation of the temporal expression of clinical symptoms of CHIKV-infected patients where skin rash is experienced after 4–5 days of onset of illness by the patients [11]. In one of the other studies on CHIKV patients, it was reported that clinical manifestations like skin rashes and itching appeared between 4 to 6 days of fever onset after the development of arthralgia and myalgia [27]. Also, joint pain was observed in almost all subjects and the mean viral load of patients having joint pain is 3.2 × 10⁷ copies/mL (n = 17) and it is generally high (>10⁵ Copies/mL) [28,29]. In a report it was observed that a high viral load was significantly associated with the development of arthritis [30].

In this study, it has been also observed that the patients who have no headache, had more chikungunya virus load as compared to subjects having a headache (8.06 vs 5.79). This finding is not aligned with a study where chikungunya-infected patients in Thai patients who have headaches had more virus load (P = 0.028) as compared to patients having no headache (6.83 vs 5.06) [30]. One of the possible reasons for this is due to the difference in the sample sizes, therefore our result did not align with this study. Limited data is available to show the relationship between clinical symptoms of CHIKV patients and viral load. More studies are required to make a conclusive remark.

5. Conclusions

In our study, to know the relationship between virus load and clinical features, we estimated the chikungunya virus load in acute febrile patients infected during the CHIKV outbreak in Delhi during 2016. It has been found that virus load might be an association with skin rashes. The patients having higher viral load had no rashes as compared to patients having rashes. It appears that this finding suggests skin rashes may be the indicator of the fading of the viremic phase Currently, in the light of little understanding of the pathogenesis and progression of the disease and lack of approved vaccine and licensed antiviral drug, our study highlighted that clinical symptoms and viral load of CHIKV may be helpful for clinical decision-making and available possible CHIKV management during the acute phase of infection during outbreak condition so that progression of the disease can be prevented timely.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors during the study period.

Author contributions

R.S. performed the experiments and analyzed the data and wrote the initial manuscript. V.J. and N.K. helped in sample collection. A.C., M.K., and A.K.P. helped in the clinical study design. S.R. reviewed the initial manuscript. N.K. and P.R. supervised the whole study including study design and final editing of the manuscript. All authors read and approved the final manuscript.