Skip to main content
Nature Portfolio logoLink to Nature Portfolio
. 2024 Feb 19;9(3):727–736. doi: 10.1038/s41564-024-01613-0

Vitamin A deficiency impairs neutrophil-mediated control of Salmonella via SLC11A1 in mice

Kristen L Lokken-Toyli 1,#, Vladimir E Diaz-Ochoa 1,#, Lizbeth Camacho 1, Annica R Stull-Lane 1, Amber E R Van Hecke 1, Jason P Mooney 1, Ariel D Muñoz 1, Gregory T Walker 1, Daniela Hampel 2,3, Xiaowen Jiang 2, Jasmine C Labuda 4, Claire E Depew 4, Stephen J McSorley 4, Charles B Stephensen 2,3, Renée M Tsolis 1,
PMCID: PMC10914596  PMID: 38374245

Abstract

In sub-Saharan Africa, multidrug-resistant non-typhoidal Salmonella serovars are a common cause of fatal bloodstream infection. Malnutrition is a predisposing factor, but the underlying mechanisms are unknown. Here we show that vitamin A deficiency, one of the most prevalent micronutrient deficits afflicting African children, increases susceptibility to disseminated non-typhoidal Salmonella disease in mice and impairs terminal neutrophil maturation. Immature neutrophils had reduced expression of Slc11a1, a gene that encodes a metal ion transporter generally thought to restrict pathogen growth in macrophages. Adoptive transfer of SLC11A1-proficient neutrophils, but not SLC11A1-deficient neutrophils, reduced systemic Salmonella burden in Slc11a1−/− mice or mice with vitamin A deficiency. Loss of terminal granulopoiesis regulator CCAAT/enhancer-binding protein ϵ (C/EBPϵ) also decreased neutrophil-mediated control of Salmonella, but not that mediated by peritoneal macrophages. Susceptibility to infection increased in Cebpe−/− Slc11a1+/+ mice compared with wild-type controls, in an Slc11a1-expression-dependent manner. These data suggest that SLC11A1 deficiency impairs Salmonella control in part by blunting neutrophil-mediated defence.

Subject terms: Bacterial infection, Infection


Vitamin A deficiency exacerbates invasive non-typhoidal Salmonella infection in mice, revealing a restrictive role for SLC11A1 in neutrophils.

Main

Non-typhoidal Salmonella serovars, such as Salmonella enterica serovar (S.) Typhimurium, cause a self-limited gastroenteritis in individuals with an intact immune system. However, individuals with immunocompromising conditions such as HIV, chronic granulomatous disease, cancer chemotherapy and sickle disease are at elevated risk of developing life-threatening disseminated infections111, in which symptoms of diarrhoea are commonly absent1214. One condition predisposing children in sub-Saharan Africa to bloodstream infection with non-typhoidal Salmonella serovars is malnutrition6,7,9,1518, but how malnutrition impairs control of disseminated bacterial infections is poorly understood. As vitamin A deficiency (VAD) is one of the most prevalent micronutrient deficiencies in sub-Saharan Africa, with an estimated 48% of children under 5 years of age affected19, we investigated the role of VAD in the control of systemic S. Typhimurium infection in mice. We found that VAD impaired infection-induced development of neutrophils, known as granulopoiesis. This reduction in neutrophil granulopoiesis resulted in a population of immature neutrophils in infected tissues that were deficient in killing Salmonella. Expression of Slc11a1 was significantly reduced in these immature neutrophils. SLC11A1, also known as NRAMP1, is a metal transporter known to restrict growth of intracellular pathogens via nutritional immunity in macrophages. In this Article, we show that mice deficient in the transcription factor CCAAT/enhancer-binding protein ϵ (C/EBPϵ), which express SLC11A1 in macrophages, but not neutrophils, had an impaired ability to control S. Typhimurium infection. Furthermore, adoptive transfer of SLC11A1-functional neutrophils to mice expressing a non-functional Slc11a1D169 allele improved the ability of these mice to control systemic S. Typhimurium infection. Together, these results show that SLC11A1 function in neutrophils contributes to controlling disseminated S. Typhimurium infection, thereby identifying a previously unappreciated role of SLC11A1 in neutrophil-mediated host defence.

Results

VAD diminishes resistance to invasive Salmonella infection

We used a mouse model to determine whether VAD impairs control of systemic infection with S. Typhimurium strain JK1128 (ref. 20; Fig. 1a), a strain belonging to the ST313 lineage currently circulating in sub-Saharan Africa21. VAD was induced in Slc11a1+/+ C57BL/6J mice, which are genetically resistant to S. Typhimurium infection22. Mice with VAD (hereafter VAD mice) had depleted hepatic retinol stores, compared with conventionally raised control mice (Fig. 1b). S. Typhimurium infection resulted in greater weight loss (Extended Data Fig. 1a) and more than 100-fold higher bacterial burden in the spleen (Fig. 1c) and blood (Fig. 1d) of VAD mice compared with control mice. The increased susceptibility of VAD mice was evident by the first day of S. Typhimurium infection (Fig. 1c,d), pointing to an innate immune defect as a possible driver of increased systemic pathogen burden. Treatment with the vitamin A supplement retinyl palmitate before S. Typhimurium infection restored control of systemic pathogen growth. While vitamin A supplementation had no effect on bacterial numbers recovered from control mice, the treatment restored liver retinol levels (Extended Data Fig. 1b) and significantly (P < 0.05) improved the ability of VAD mice to control bacterial burden in the spleen (Fig. 1c) and blood (Fig. 1d). Collectively, these data indicated that VAD led to a prominent, but reversible, impairment of the host’s innate ability to control disseminated S. Typhimurium infection.

Fig. 1. VAD increases systemic S. Typhimurium colonization and results in the accumulation of immature neutrophils in the spleen.

Fig. 1

a, Generation of VAD mice and experimental design. b, Hepatic retinol concentration in control mice (n = 6), VAD mice (n = 8), and control (n = 6) and VAD (n = 12) Slc11a1+/+ mice infected with S. Typhimurium, 3 days after infection. Statistical significance was determined on log-transformed values using one-way ANOVA with a post hoc Tukey test. c,d, S. Typhimurium colonization (CFU) of the spleen (c) and blood (d) at 1 day, 2 days and 3 days after infection of control (n = 5, n = 5, n = 7) and VAD (n = 5, n = 7, n = 9) Slc11a1+/+ mice, and control (n = 6) and VAD Slc11a1+/+ mice (n = 9) pretreated intragastrically with retinyl palmitate. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. e, Representative contour plots of splenic neutrophil frequency in male mock-infected control and VAD Slc11a1+/+ mice. Insets: gates used to quantify CD11b+ Ly6G+ cells. f, Frequency of splenic neutrophils in the CD11b+ population from control (n = 6, n = 6) and VAD (n = 6, n = 5) Slc11a1+/+ mice mock infected and infected with S. Typhimurium (1 day). Statistical significance was determined on arc-sin-transformed values using an unpaired, two-tailed Student’s t-test. g, Representative contour plots of splenic neutrophil frequency in male control and VAD Slc11a1+/+ mice infected with S. Typhimurium (1 day). h, Median fluorescence intensity (MFI) of surface Ly6G on splenic neutrophils of control (n = 6, n = 6) and VAD (n = 6, n = 5) Slc11a1+/+ mice mock infected and infected with S. Typhimurium (1 day). i, Side scatter area of splenic neutrophils from control (1 day, n = 6; 2 days, n = 5) and VAD (1 day, n = 5; 2 days, n = 7) Slc11a1+/+ mice mock infected (n = 6) and infected (n = 6) with S. Typhimurium. In h and i, statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. j, Representative contour plots of splenic neutrophil frequency of male control and VAD Slc11a1+/+ mice infected with S. Typhimurium and pretreated intragastrically with PBS or retinyl palmitate. k,l, MFI of surface Ly6G (k) and frequency (l) of splenic neutrophils from control and VAD Slc11a1+/+ mice infected with S. Typhimurium and pretreated intragastrically with PBS (n = 6, n = 5) or retinyl palmitate (n = 6, n = 9). Statistical significance was determined on log- or arc-sin-transformed values using one-way ANOVA with a post hoc Tukey test. All data represent individual mice with mean ± s.e.m. and are collected from one experiment. NS, not significant; STm, S. Typhiumurium; SSC-A, side scatter area.

Source data

Extended Data Fig. 1. Recruitment of immature neutrophils to the spleen.

Extended Data Fig. 1

a, Average percent weight change at 1- and 3-days post- S. Typhimurium infection of control (n = 6; n = 7) and VAD (n = 5; n = 9) Slc11a1+/+ mice. Data collected from one experiment. b, Hepatic retinol concentration in control and VAD Slc11a1+/+ mice treated intragastrically (IG) with PBS (n = 6; n = 6) or retinyl palmitate (n = 6; n = 9). Statistical significance was determined on log-transformed values using a one-way analysis of variance (ANOVA) with a post-hoc Tukey test. NS, not significant. Data are collected from one experiment. c, Expression of Kc in splenic tissue of mock-infected (n = 6 each) and S. Typhimurium-infected control (1 d n = 6; 3 d n = 7) and VAD (1 d n = 5; 3 d n = 9) Slc11a1+/+ mice. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t test. NS, not significant. Data are collected from one experiment. d-e, Production of IL-6 (d) or TNFα (e) by control (n = 5) and VAD (n = 6) Slc11a1+/+ mice 2 h after IP injection with 20 µg LPS. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t test. NS, not significant. Data are collected from one experiment. f-g, Representative contour plots of splenic neutrophil frequency (singlet live CD4-CD8a-CD19-B220-CD11b + Ly6G + ) from mock-infected female Slc11a1+/+ mice fed control or VAD diets (f) or Slc11a1+/+ mice infected for 1d with S. Typhimurium (g). h, Representative contour plots of splenic neutrophil frequency (singlet live CD4-CD8a-CD19-B220-CD11b + Ly6G+) from female S. Typhimurium-infected (3d) control and VAD Slc11a1+/+ mice pretreated with either PBS or retinyl palmitate (600 IU delivered IG) at 7d and 3d before S. Typhimurium infection. i, Gating strategy for analysis of bone marrow and spleen single cell suspensions. After doublet elimination, live cells were gated and CD4-CD8a-CD19-B220- Ter119-, for bone marrow analysis, and CD4-CD8a-CD19-B220- for spleen analysis, were analyzed for CD11b and Ly6G expression. Neutrophils were defined as CD11b + Ly6G + . All data represent individual mice with the mean ± SEM.

Source data

We have recently shown that malaria increases the risk of S. Typhimurium bacteraemia by blunting expression of neutrophil chemoattractants and reducing neutrophil recruitment during S. Typhimurium infection23. By contrast, in the spleen of VAD mice, S. Typhimurium infection triggered higher transcript levels of Kc (encoding KC, or keratinocyte-derived cytokine) compared with control mice (Extended Data Fig. 1c), which suggested that VAD did not impair control of disseminated S. Typhimurium infection by blunting the expression of the neutrophil chemoattractant KC. Furthermore, VAD mice also produced interleukin-6 (IL-6) and tumour necrosis factor-α (TNF-α) in an equivalent manner to mice receiving a control diet in response to lipopolysaccharide (LPS) injection, further showing their ability to respond to bacterial ligands (Extended Data Fig. 1d,e).

In the absence of infection, the splenic phagocyte population (CD4 CD8a CD19 B220 CD11b+ splenocytes) of VAD mice contained a significantly (P < 0.05) larger proportion of neutrophils (CD4 CD8a CD19 B220 CD11b+ Ly6G+ splenocytes) compared with control mice (Fig. 1e,f and Extended Data Fig. 1f). Furthermore, during S. Typhimurium infection, the abundance of infiltrating neutrophils was significantly (P < 0.05) increased in VAD mice compared with controls (Fig. 1f,g and Extended Data Fig. 1e). Collectively, these data suggested that unlike malaria, VAD did not increase susceptibility to S. Typhimurium infection by impairing neutrophil recruitment.

Interestingly, while surface expression of lymphocyte antigen 6 complex locus G6D (Ly6G) was not affected by vitamin A status in uninfected mice, neutrophils in the spleen of VAD mice infected with S. Typhimurium exhibited significantly lower median Ly6G fluorescence intensity and reduced side scatter (a measure of granularity) than neutrophils in the spleen of control mice infected with S. Typhimurium (Fig. 1h,i). Retinyl palmitate treatment before S. Typhimurium infection restored median Ly6G fluorescence intensity in VAD mice (Fig. 1j,k) and reduced the abundance of neutrophils in VAD mice to levels in control mice (Fig. 1l). As both median Ly6G fluorescence intensity and granule development increase as neutrophils mature24, these results raised the possibility that VAD might weaken immunity by compromising neutrophil maturation during S. Typhimurium infection.

Impairment of infection-induced granulopoiesis in VAD mice

During bacterial infection, the host responds by rapidly mobilizing and increasing de novo production of neutrophils in the bone marrow to levels beyond steady-state conditions, a process termed emergency granulopoiesis25. We thus wanted to determine whether VAD would impair infection-driven granulopoiesis in the bone marrow. In the absence of infection, the bone marrow of VAD and control mice contained similar numbers of neutrophils (Fig. 2a and Extended Data Fig. 2a) of comparable maturity, as indicated by similar median Ly6G fluorescence intensities (Fig. 2b), suggesting that steady-state granulopoiesis was not impaired during VAD. In contrast, after S. Typhimurium infection, the bone marrow of VAD mice contained lower numbers of neutrophils (Fig. 2a–d and Extended Data Fig. 2a) than that of control mice. Furthermore, bone marrow neutrophils from VAD mice infected with S. Typhimurium exhibited significantly (P < 0.05) lower median Ly6G fluorescence intensity (Fig. 2b,c,e) and granularity (Fig. 2f,g) than those from controls. Supplementation with retinol (as retinyl palmitate) restored numbers (Fig. 2c,d) as well as median Ly6G fluorescence intensity (Fig. 2e) and granularity (Fig. 2g) of neutrophils in the bone marrow of VAD mice infected with S. Typhimurium, suggesting that VAD impaired infection-driven granulopoiesis. Neutrophils in the bone marrow of VAD mice infected with S. Typhimurium showed significantly reduced granularity (determined by side scatter, Fig. 2f), indicative of impaired granule formation, which was restored to control levels by retinyl palmitate supplementation (Fig. 2g). Neutrophil development is characterized by a sequential formation of distinct granule subsets, which proceeds through the formation of azurophil granules (during the promyelocyte stage), specific granules (during the myelocyte and metamyelocyte stages) and gelatinase granules (during band and segmented stages)26. While expression of Mpo, encoding the azurophil granule protein myeloperoxidase, remained unchanged (Fig. 2h), transcript levels of Ltf, encoding the specific granule protein lactoferrin (Fig. 2i), and Mmp9, encoding the gelatinase granule protein matrix metalloproteinase 9 (Fig. 2j), were significantly (P < 0.05) diminished in bone marrow neutrophils of VAD mice infected with S. Typhimurium compared with those of controls. Expression of both Ltf and Mmp9 could be restored to control levels by retinyl palmitate supplementation (Fig. 2i,j). Furthermore, bone marrow neutrophil lactoferrin levels were undetectable in four of six VAD mice infected with S. Typhimurium and were subsequently restored with previous retinyl palmitate supplementation (Extended Data Fig. 2b). Together, these results suggested that VAD inhibited early control of systemic S. Typhimurium infection by reducing terminal neutrophil differentiation. Interestingly, expression of Slc11a1, encoding an additional component of neutrophil gelatinase granules27, was significantly reduced in bone marrow neutrophils of VAD mice infected with S. Typhimurium compared with controls (Fig. 2k), whereas supplementation of VAD mice with retinyl palmitate before S. Typhimurium infection restored expression of Slc11a1 to control levels (Fig. 2k). Slc11a1 encodes a phagosomal transporter of Fe2+ and Mn2+, which has been proposed to reduce the availability of these metals, as well as that of Mg2+, to Salmonella28,29. Production of a non-functional SLC11A1G169D variant in mouse macrophages increases susceptibility to intracellular pathogens, such as S. Typhimurium30,31, presumably via withholding of divalent metals from the pathogen-containing phagosome32,33. However, while mature human neutrophils are known to produce high levels of SLC11A1 (ref. 34), its role in neutrophil function is not known. We thus wanted to investigate whether VAD impairs a hitherto unknown SLC11A1-dependent antimicrobial activity of neutrophils.

Fig. 2. VAD impairs granulopoiesis induced by systemic S. Typhimurium infection.

Fig. 2

a,b, Number of bone marrow polymorphonuclear neutrophils (PMN; singlet live CD4 CD8a CD19 B220 Ter119 CD11b+ Ly6G+) (a) and MFI of surface Ly6G (b) from control (n = 6, n = 6) and VAD (n = 6, n = 5) Slc11a1+/+ mice mock infected and infected with S. Typhimurium (1 day). Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. Data are collected from one experiment. c, Representative contour plots of bone marrow neutrophil frequency from male control and VAD Slc11a1+/+ mice infected with S. Typhimurium and pretreated intragastrically with PBS or retinyl palmitate. d,e, Number of bone marrow neutrophils (d) and MFI of surface Ly6G (e) from control and VAD Slc11a1+/+ mice infected with S. Typhimurium and pretreated intragastrically with PBS (n = 6, n = 6) or retinyl palmitate (n = 6, n = 9). Statistical significance was determined on log-transformed values using a one-way ANOVA with a post hoc Tukey test. Data are collected from one experiment. f, Side scatter area of bone marrow neutrophils (singlet live CD4 CD8a CD19 B220 Ter119 CD11b+ Ly6G+) from control (n = 6, n = 6) and VAD (n = 6, n = 5) Slc11a1+/+ mice mock infected and infected with S. Typhimurium (1 day). Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. Data are collected from one experiment. g, Side scatter area of bone marrow neutrophils from control and VAD Slc11a1+/+ mice infected with S. Typhimurium and pretreated intragastrically with PBS (n = 6, n = 6) or retinyl palmitate (n = 6, n = 9). Statistical significance was determined on log-transformed values using a one-way ANOVA with a post hoc Tukey test. Data are collected from one experiment. hk, Expression of myeloperoxidase (Mpo) (h), lactoferrin (Ltf) (i), matrix metallopeptidase 9 (Mmp9) (j) and Slc11a1 (k) in bone marrow neutrophils isolated from control and VAD Slc11a1+/+ mice infected with S. Typhimurium and pretreated intragastrically with PBS (n = 6, n = 6) or retinyl palmitate (n = 6, n = 7). Transcript numbers were normalized to 18S ribosomal RNA (18S). Statistical significance was determined on log-transformed values using a one-way ANOVA with a post hoc Tukey test. Data are collected from two independent experiments. l, Intracellular S. Typhimurium recovered 2 h after ex vivo infection of bone marrow PMN from control (n = 6) and VAD (n = 6) Slc11a1+/+ mice. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. Data were collected from one experiment. All data represent individual mice with mean ± s.e.m.

Source data

Extended Data Fig. 2. VAD impairs emergency granulopoiesis in response to S. Typhimurium infection.

Extended Data Fig. 2

a, Frequency of bone marrow neutrophils (singlet live CD4-CD8a-CD19-B220-Ter119-CD11b + Ly6G+) from control and VAD Slc11a1+/+ mice at 1d after S. Typhimurium infection (n = 6; n = 5) or mock treatment (n = 6; n = 6). Statistical significance was determined on arc-sin-transformed values using an unpaired, two-tailed Student’s t test. NS, not significant. Data are collected from one experiment. Lactoferrin levels (b) in bone marrow neutrophils isolated from PBS treated control (n = 6) and VAD (n = 6) Slc11a1+/+ mice, and retinyl palmitate treated VAD (n = 6) Slc11a1+/+ mice. Data are collected from two independent experiments. STD, protein standard. c, CFU of S. Typhimurium associated with a neutrophil enriched splenic cell suspension from control (n = 3) and VAD (n = 5) Slc11a1+/+ mice 3d post-infection. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t test. Data are collected from one experiment. d, Representative contour plot of neutrophils enriched from the spleen of S. Typhimurium infected control and VAD Slc11a1+/+ mice showing greater than 83% neutrophil purity (singlet live CD11b + Ly6G+). e, Representative images of Giemsa-stained Ly6G+ neutrophils enriched from the spleen of S. Typhimurium infected control and VAD Slc11a1+/+ mice. Scale bar = 50μm Each image represents one S. Typhimurium-infected control and VAD animal from one experiment. All data represent individual mice with the mean ± SEM.

Source data

Effect of VAD on S. Typhimurium infection requires SLC11A1

Neutrophils from VAD mice infected ex vivo (Fig. 2l) or enriched from VAD mice infected with S. Typhimurium (Fig. 3a and Extended Data Fig. 2c) contained significantly more bacteria compared with neutrophils from infected mice on a control diet, and pretreatment of mice with retinyl palmitate before S. Typhimurium infection significantly reduced intracellular bacteria within neutrophils of VAD mice (Fig. 3a). To exclude the possibility that contaminating macrophages in the neutrophil-enriched cell suspension contributed to the differences in bacterial numbers, we characterized the cell suspension using flow cytometry and cytospins. Flow cytometry analysis of the neutrophil-enriched population showed >83% of the singlet live splenic cells to be neutrophils (CD11b+ Ly6G+) in both control and VAD mice infected with S. Typhimurium (Extended Data Fig. 2d). Cytospin analysis showed the majority of cells with nuclei of band or segmented shape, a defining characteristic of neutrophils (Extended Data Fig. 2e). C57BL/6J mice carry an allele (Slc11a1D169) that renders SLC11A1 nonfunctional, while the mice used for this study carry a functional Slc11a1 allele (Slc11a1+/+)22. We therefore used these two strains of C57BL/6J mice to determine whether neutrophil expression of Slc11a1 impacted control of S. Typhimurium. Neutrophils enriched from Slc11a1D169/D169 mice infected with S. Typhimurium contained significantly higher bacterial numbers compared with those from Slc11a1+/+ controls, indicating that Slc11a1 expression in neutrophils enhanced resistance to S. Typhimurium (Fig. 3a). Neutrophils enriched from the bone marrow of uninfected Slc11a1D169/D169 mice and infected with S. Typhimurium ex vivo contained 100-fold greater numbers of S. Typhimurium compared with those from Slc11a1+/+ controls (Fig. 3b). Together, these results show that expression of a non-functional Slc11a1 allele impairs the ability of neutrophils to control systemic S. Typhimurium infection.

Fig. 3. Functional SLC11A1 contributes to neutrophil-mediated control of S. Typhimurium infection.

Fig. 3

a, CFU of S. Typhimurium associated with a neutrophil-enriched splenic cell suspension 3 days after infection from control and VAD Slc11a1+/+ mice pretreated intragastrically with PBS (n = 4, n = 3) or retinyl palmitate (n = 4, n = 4). Statistical significance was determined on log-transformed values using a one-way ANOVA with a post hoc Sidak test. Data were collected from one experiment. CFU of S. Typhimurium associated with a neutrophil-enriched splenic cell suspension 3 days after infection from control Slc11a1+/+ (n = 9) and Slc11a1D169/D169 (n = 9) mice. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. Data were collected from one experiment. b, Ex vivo killing of S. Typhimurium by bone marrow PMN from Slc11a1+/+ (n = 6) and Slc11a1D169/D169 (n = 6) mice. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. Data were collected from three independent experiments. c,d, S. Typhimurium colonization of the spleen (c) and liver (d) 3 days after oral administration (IG) of S. Typhimurium to control and VAD Slc11a1+/+ (n = 6, n = 6) and Slc11a1D169/D169 (n = 8, n = 8) mice. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. Data were collected from one experiment. e, S. Typhimurium colonization of the spleen 2 days after IP infection. Control and VAD male Slc11a1+/+ mice were treated intraperitoneally with a neutrophil-depleting antibody (αLy6G, n = 6, n = 7) or isotype control (n = 5, n = 5) 1 day before and 1 day after infection. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. Data were collected from two independent experiments. f,g, Colonization of the spleen (f) and blood (g) 3 days after IP infection of Slc11a1+/+ VAD male mice that received 3–4 × 106 bone marrow PMN from either Slc11a1D169/D169 (n = 6) or Slc11a1+/+ (n = 6) mice, or PBS (n = 4) administered intraperitoneally 1 day after S. Typhimurium infection. Statistical significance was determined on log-transformed values using an unpaired, one-tailed Student’s t-test. Data were collected from two independent experiments. All data represent individual mice with mean ± s.e.m.

Source data

The hypothesis that reduction of SLC11A1 synthesis in neutrophils is one of the mechanisms by which VAD impairs immunity against S. Typhimurium would predict that VAD does not alter control of S. Typhimurium infection in Slc11a1D169/D169 mice. To test this, we infected VAD mice and Slc11a1D169/D169 mice replete with vitamin A via the oral route and assessed systemic colonization 3 days after S. Typhimurium infection. VAD increased the bacterial burden in the spleen (Fig. 3c) and liver (Fig. 3d) of mice with an intact Slc11a1 allele, but not in Slc11a1D169/D169 mice. These results suggested that one mechanism by which VAD promoted invasive S. Typhimurium infection is a reduction in SLC11A1-mediated defences.

To determine directly whether reduced neutrophil function compromises host defence against S. Typhimurium infection during VAD, we restricted neutrophil extravasation by treatment with the Ly6G-specific monoclonal antibody 1A8 (ref. 35). Treatment with 1A8 significantly reduced neutrophil numbers in the spleen of both VAD and control mice compared with isotype controls (Extended Data Fig. 3b,c). Neutrophil depletion significantly increased recovery of S. Typhimurium from the spleen and liver of control mice (Fig. 3e and Extended Data Fig. 3d), suggesting that neutrophils were important for controlling S. Typhimurium infection in animals replete with vitamin A. By contrast, neutrophil depletion did not alter S. Typhimurium numbers recovered from VAD mice (Fig. 3e and Extended Data Fig. 3d), indicating that neutrophils no longer contributed to protection during VAD. Strikingly, adoptive transfer of bone-marrow-derived neutrophils (Extended Data Fig. 3f) isolated from healthy Slc11a1+/+ mice to VAD mice infected with S. Typhimurium significantly reduced bacterial burden in the spleen (Fig. 3f) and blood (Fig. 3g) compared with VAD controls. In contrast, adoptive transfer of bone marrow neutrophils from healthy Slc11a1D169/D169 mice into infected VAD mice failed to restore control of S. Typhimurium growth at systemic sites (Fig. 3f,g and Extended Data Fig. 3b). Taken together, these results suggested that one of the mechanisms by which lack of vitamin A compromises control of disseminated S. Typhimurium infection is the generation of a population of SLC11A1-deficient neutrophils that are unable to clear bacteria at systemic sites.

Extended Data Fig. 3. SLC11A1 contributes to neutrophil-mediated control of infection.

Extended Data Fig. 3

a, Colonization of the liver at 3 d post IG infection of male VAD Slc11a1+/+ mice that received 3-4 × 106 bone marrow neutrophils from either Slc11a1D169/D169 (n = 6) or Slc11a1+/+ (n = 6) mice or PBS (n = 4) administered IP 1 d post-S. Typhimurium infection. Statistical significance was determined on log-transformed values using an unpaired, one-tailed Student’s t test. NS, not significant. Data are collected from two independent experiments. b, Number of splenic neutrophils (CD11b+Ly6Cmid) 2d post-S. Typhimurium infection from male control and VAD Slc11a1+/+ mice treated with a neutrophil tissue depleting antibody (anti-Ly6G; 1A8) (n = 6; n = 7) or IgG control antibody (n = 5; n = 5) administered one-day prior and after S. Typhimurium infection. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t test. Data are collected from two independent experiments. c, Gating strategy for analysis of spleen single cell suspensions after neutrophil depletion. After doublet elimination, live cells were gated and CD4-CD8a-CD19-B220- cells were analyzed for CD11b and Ly6C expression. Neutrophils were defined as CD11b+Ly6Cmid and monocytes were defined as CD11b+Ly6Chi. d, S. Typhimurium colonization of the liver 2 d post infection from control and VAD Slc11a1+/+ mice treated with a neutrophil depleting antibody (n = 6; n = 7) or isotype control (n = 5; n = 5) one day prior and after infection. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t test. NS, not significant. Data are collected from two independent experiments. e, Representative contour plots from flow cytometry analysis of neutrophil adoptive transfer showing 85% neutrophil purity (singlet live CD11b + Ly6G + ) from bone marrow isolation of healthy Slc11a1+/+ and Slc11a1D169/D169 donor mice. All data represent individual mice with the mean ± SEM.

Source data

SLC11A1 in neutrophils controls Salmonella infection

To determine whether SLC11A1 function in neutrophils contributes to control of systemic Salmonella infection, we performed adoptive transfer of bone marrow neutrophils isolated from healthy Slc11a1+/+ or Slc11a1D169/D169 mice to Slc11a1D169/D169 mice infected with S. Typhimurium. For these experiments, as neutrophils were transferred intraperitoneally, we changed the route of infection to the intragastric (IG) route to maximize the possibility that the transferred neutrophils would have to migrate to sites of infection to exert control of S. Typhimurium. Mice receiving Slc11a1+/+ neutrophils had significantly reduced bacterial burden in the spleen (Fig. 4a), blood (Fig. 4b) and liver (Extended Data Fig. 4a) compared with mice receiving Slc11a1D169/D169 neutrophils.

Fig. 4. Mice conditionally deficient in SLC11A1 expression in neutrophils have impaired control of systemic Salmonella infection.

Fig. 4

a,b, Colonization of the spleen (a) and blood (b) 3 days after IG infection of Slc11a1D169/D169 male mice that received 5 × 106 bone marrow PMN from either Slc11a1D169/D169 (n = 6) or Slc11a1+/+ (n = 5) mice or PBS (n = 5 or 4) administered intraperitoneally 1 day after S. Typhimurium infection. Statistical significance was determined on log-transformed values using an unpaired, one-tailed Student’s t-test. Data were collected from two independent experiments. c,d, Ex vivo killing of S. Typhimurium by bone marrow neutrophils (c) or elicited peritoneal macrophages (d) isolated from Slc11a1+/+ Cebpe+/+ (n = 3), Slc11a1+/+ Cebpe−/− (neutrophil-specific Slc11a1 deficiency; n = 3) and global Slc11a1-deficient, Slc11a1D169/D169 Cebpe+/+ (n = 3) and Slc11a1D169/D169 Cebpe/ (n = 9, n = 3) mice. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. Data were collected from three independent experiments, each performed with triplicate samples. e,f, S. Typhimurium colonization of the spleen (e) and blood (f) 3 days after IP infection of Slc11a1+/+ Cebpe+/+ (n = 15), Slc11a1+/+ Cebpe/(neutrophil-specific Slc11a1 deficiency; n = 16) and global Slc11a1-deficient, Slc11a1D169/D169 Cebpe+/+ (n = 11) and Slc11a1D169/D169 Cebpe/ (n = 4) mice. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t-test. Data were collected from one experiment. All data represent individual mice with mean ± s.e.m. g, Genotypes of mice used for panels cf and cell types with SLC11A1 deficiency. Figure g created with BioRender.com.

Source data

Extended Data Fig. 4. Expression and function of SLC11A1 in phagocytes.

Extended Data Fig. 4

a, Colonization of the liver at 3 d post IG infection of Slc11a1D169/D169 mice that received 5 × 106 bone marrow neutrophils from either Slc11a1D169/D169 (n = 6) or Slc11a1+/+ (n = 5) mice or PBS (n = 5) administered IP 1d post-S. Typhimurium infection. Statistical significance was determined on log-transformed values using an unpaired, one-tailed Student’s t test. Data are collected from two independent experiments. b, c, Expression of Slc11a1 in macrophages (b) or neutrophils (c) derived from bone marrow of C/EBP epsilon-deficient mice (n = 2; n = 3) or littermate controls (n = 2; n = 3), as determined by qRT-PCR. Statistical significance was determined on log-transformed values using an unpaired, two-tailed Student’s t test. All data represent individual mice with the mean ± SEM.

Source data

A possible contributor to reduced Slc11a1 expression in neutrophils of VAD mice is that C/EBPϵ, which directs the terminal stages of granulopoiesis, is induced by retinoic acid36. To further study the role of neutrophil Slc11a1 in the control of Salmonella infection by neutrophils, we crossed a defective allele of Cebpe37, encoding C/EBPϵ, onto our Slc11a1+/+ background mice. As Slc11a1 is expressed only in mature neutrophils38, C/EBPϵ-deficient neutrophils lack Slc11a1 expression (Extended Data Fig. 4b,c). We therefore hypothesized that mice resulting from this cross have SLC11A1 functional macrophages, but SLC11A1-deficient neutrophils. In an Slc11a1+/+ background, deficiency of Cebpe reduced the ability of neutrophils to kill S. Typhimurium ex vivo (Fig. 4c). By contrast, on an Slc11a1-deficient background (Slc11a1D169/D169), no effect of Cebpe deficiency on bactericidal activity was observed. Collectively, these data suggested that neutrophils from Slc11a1+/+ Cebpe−/− mice were impaired in SLC11A1-mediated control of Salmonella infection. This SLC11A1-dependent effect of Cebpe deficiency on the control of intracellular Salmonella replication ex vivo was not observed in thioglycolate-elicited peritoneal macrophages (Fig. 4d), showing that C/EBPϵ deficiency does not affect the ability of these macrophages to control Salmonella infection. Using mice with different combinations of Cebpe and Slc11a1 alleles, we then assessed the contribution of SLC11A1 in neutrophils to controlling systemic S. Typhimurium infection (Fig. 4e,f). In mice with functional SLC11A1, deficiency of C/EBPϵ compromised control of Salmonella in the spleen (Fig. 4e) and blood (Fig. 4f), while in the SLC11A1-deficient background, C/EBPϵ deficiency had a much reduced effect on systemic control of Salmonella. The finding that mice (that is, Slc11a1+/+ Cebpe−/−) exhibiting impaired Slc11a1-dependent host control in neutrophils (Fig. 4c) but not in macrophages (Fig. 4d) exhibited impaired control of systemic Salmonella infection (Fig. 4e,f) provided compelling support for the idea that neutrophils contribute to SLC11A1-mediated control of an intracellular bacterial pathogen.

Discussion

Vitamin A has long been appreciated to play a role in immunity to infection39. Its active metabolite, retinoic acid, is essential for mucosal immunity in the intestine, including induction of adaptive immunity via recruitment of B and T cells4042 and influencing the lineage development of mucosal T cells4245 to modulate inflammatory responses. This study revealed a requirement of dietary vitamin A for expression of Slc11a1 during terminal development of neutrophils. This is consistent with the known role of retinoic acid in the expression of Cebpe, which encodes a transcription factor required for terminal neutrophil differentiation36. Considering the broad role of retinoic acid in host physiology and transcriptional regulation, however, it is likely that additional effects of VAD on the immune system remain to be identified.

The function of SLC11A1 has been studied in macrophages, in which it mediates nutritional immunity to vacuolar pathogens via metal withholding, thereby limiting intracellular pathogen replication33,46. Here we show that an SLC11A1-dependent antimicrobial activity of neutrophils is required for controlling systemic S. Typhimurium infection. S. Typhimurium resides within macrophages during its growth in the liver and spleen, but some macrophages are killed, leading to extracellular release of the pathogen, making it susceptible to neutrophil attack47. The idea that an antimicrobial activity of neutrophils is necessary to eliminate extracellular S. Typhimurium is further supported by electron microscopic analysis of infected tissue in neutropenic mice48. Therefore, our results are consistent with the idea that SLC11A1 is important for both macrophage- and neutrophil-mediated control of S. Typhimurium infection. However, these findings raise the question whether the mechanism of SLC11A1-mediated host defence is the same in both macrophages and neutrophils. SLC11A1-dependent metal withholding would be expected to be bacteriostatic. SLC11A1 is found in the phagolysosomal membrane and mediates extrusion of divalent metals from the bacteria-containing phagosome of macrophages. While it has long been assumed that transport of iron and manganese out of the phagosome by SLC11A1 starves bacteria of these essential metal cofactors and prevents their intracellular replication, recent work suggests that SLC11A1 may actually limit bacterial access to a different metal cofactor, magnesium29. In neutrophils, SLC11A1 appears to be important in maximizing bactericidal activity, but it is unclear how its expression and activity promote bacterial killing by these cells, and future work is needed to address this question.

The finding that SLC11A1 supports neutrophil-mediated host defences has important implications for immunity to infection. Most mouse models of disease use C57BL/6 mice that carry the deficient Slc11a1D169 allele because of the broad availability of genetic tools for this background. However, while SLC11A1 has been linked genetically to multiple human autoimmune and infectious diseases, studies of its function have been limited primarily to restriction of intramacrophage pathogens. The role of SLC11A1 for neutrophil antibacterial function shown here suggests that it may be important in other infectious and inflammatory diseases in which neutrophil activity plays a pivotal role.

Methods

Mouse strains

All procedures were performed with 8–10-week-old C57BL/6 Slc11a1+/+, Slc11a1D169/D169, Slc11a1+/+ Cepbe+/+, Slc11a1+/+ Cepbe−/−, Slc11aD169/D169 Cepbe+/+ or Slc11aD169/D169 Cepbe/ mice. Male and female mice were used for each experiment unless otherwise specified in the figure legend. Slc11a1+/+ mice were obtained from G. Barton22, rederived into the barrier facility at UC Davis, backcrossed once with C57BL/6J mice and then bred and maintained under specific pathogen-free conditions by the UC Davis Teaching and Research Animal Care Service. Specific pathogen-free Slc11a1D169/D169 mice were purchased from The Jackson Laboratory (Bar Harbor, Maine). In addition, timed-pregnant female Slc11a1D169/D169 mice were purchased from The Jackson Laboratory and the pups were raised in the barrier facility at UC Davis to obtain VAD Slc11a1D169/D169 mice. Cebpe mice37 were provided by H. Phillip Koeffler and were backcrossed onto C57BL/6J and C57BL/6J-Slc11a1+/+ mice. All mice were held in microisolator cages with sterile ALPHA-dri bedding and received irradiated rodent feed and sterile drinking water ad libitum. The UC Davis Institutional Animal Care and Use Committee approved all animal experiments described in this paper under protocols 22492 and 23360.

VAD mice and mice with sufficient vitamin A

Starting at 14 days of gestation, dams were fed a VAD diet (0 IU vitamin A kg−1). At weaning, mice were either placed on a diet replete with vitamin A (4,000 IU vitamin A kg−1) or maintained on the VAD diet. All diets were semi-purified and casein based. A custom VAD diet (TD.88407) and a vitamin A control diet with added orange food colouring (TD.09062) were prepared and pelleted by Envigo Teklad Diets. For vitamin A supplementation, VAD and control mice were treated with either 0.1 ml of sterile phosphate-buffered saline (PBS) or 600 IU retinyl palmitate (Nutrisorb A, Interplexus) in 0.1 ml of PBS by oral gavage at 7 and 3 days before infection with S. Typhimurium. For vitamin A treatment, VAD and control mice were treated with either 0.1 ml of sterile PBS or 600 IU retinyl palmitate in 0.1 ml of PBS by oral gavage starting 1 day after S. Typhimurium infection.

Measurement of hepatic vitamin A levels

About 20 mg (control) to 50 mg (VAD) of the liver were homogenized with 100 mg sodium sulfate. The homogenate was transferred into a 7 ml glass vial and mixed with 350 µl ethanol, containing 0.1% butylated hydroxytoluol, for protein precipitation. After 100 µl of potassium hydroxide (KOH, 30% in deionized water) and 50 µl pyrogallol (10% in ethanol) were added, the samples were mixed for 15 s and incubated for 60 min at 60 °C to release the retinol from its retinyl esters. After the samples were cooled on ice, 3 ml hexane, 1 ml tocol (internal standard; 1 µg ml−1 in hexane) and 700 µl deionized water were added, mixed vigorously for 30 s and centrifuged for 2 min at 1,800 rpm for phase separation. The upper, organic phase was transferred into a fresh 7 ml glass vial and evaporated to dryness under a gentle nitrogen stream. The residue was reconstituted in 100 µl (VAD liver) or 200 µl (control liver) of acetonitrile before analysis. The analysis was carried out using an Agilent 1100 HPLC system equipped with a diode array detector (Agilent) controlled by OpenLABS ChemStation software (Rev A.01.04, Agilent). Samples were kept at 10 °C, and 10 µl was injected onto a Spherisorb ODS2 column, 125 × 3 mm, 3 µ (Waters) protected by a BDS-hypersil-C18 guard column, 20 × 3 mm, 3 µ (Thermo Scientific) at 15 °C. Acetonitrile, dichloromethane and methanol (7/2/1, v/v/v, all HPLC grade) served as isocratic mobile phase at a flow rate of 0.6 ml min−1 for 6 min. The detector was set at 325 nm for retinol and 295 nm for tocol, and quantification was carried out by ratio response to the internal standard.

LPS challenge

Lipopolysaccharide from E. coli 0111:B4 strain (Invivogen catalogue code tlrl-eblps) was diluted in sterile, 0.9% sodium chloride, and 20 µg per mouse was administered intraperitoneally in a final volume of 100 µl. Male and female mice on control (n = 5) or VAD (n = 6) diets were killed 2 h after injection. Blood samples were collected in K2 ethylenediaminetetraacetic acid (EDTA) tubes, and plasma was collected and stored at −80 °C until further analysis. Cytokine levels were assessed with enzyme-linked immunosorbent assays for TNF-α (BioLegend catalogue number 430904) and IL-6 (Invitrogen catalogue number 88-7064).

S. Typhimurium

A derivative of the S. Typhimurium clinical isolate D23580 NalR (gyrA S83F) pSLT-14028s::tetRA, designated JK1128, was provided by F. Fang and was used for animal infection studies20. Mice received either 0.1 ml of sterile PBS or 1 × 103 colony-forming units (CFU) diluted in PBS by IP injection. For oral infection, mice received either 0.1 ml of Luria–Bertani (LB) broth or 1 × 109 CFU diluted in LB broth by IG gavage. Inocula were cultured for 16–18 h aerobically at 37 °C. To determine tissue loads of viable S. Typhimurium, liver and spleen tissues were homogenized in PBS using an Ultra Turrax T25 basic mixer (IKA). Blood was collected by cardiac puncture with heparinized needles; plasma was removed and then incubated with 120 μl of 1% Triton X-100 in PBS for 10 min at room temperature. Homogenates were serially diluted and plated on LB agar plates containing 100 mg l−1 nalidixic acid (Sigma). After overnight growth at 37 °C, CFU g−1 or CFU ml−1 was calculated.

RNA extraction, reverse-transcription PCR and real-time PCR

For whole-tissue RNA extractions, samples were snap-frozen in liquid nitrogen at time of necropsy and stored at −80 °C. RNA isolation from purified bone marrow neutrophils was performed on the same day. RNA was extracted from samples using Tri-Reagent (Molecular Research Center) according to the manufacturer’s instructions. All RNA samples were treated with DNase I (Ambion) to remove genomic DNA contamination. For quantification of messenger RNA (mRNA) levels in spleen tissue, 1 μg of total RNA from each sample was reverse transcribed in a 50 μl volume (TaqMan reverse transcription (RT) reagent; Applied Biosystems), and 4 μl of the resulting complementary DNA (cDNA) was used for each real-time reaction. For mRNA quantification from purified bone marrow neutrophils, 0.8 μg of total RNA from each sample was reverse transcribed in a 50 μl volume (TaqMan RT reagent; Applied Biosystems) and 4 μl of the resulting cDNA was used for each real-time reaction. Real-time PCR was performed using the primers listed in Table 1, SYBR green (Applied Biosystems) and ViiA 7 Real-Time PCR System (Applied Biosystems). Target gene transcription of each sample was normalized to the respective levels of β-actin (ACTB) or 18S rRNA, and absolute quantification was determined using gene-specific plasmid standards in each run.

Table 1.

Quantitative real-time PCR primers used in this study

Target gene Method Sequences (5′–3′)
Actb Absolute copies CCAGGGAGGAAGAGGATGCGG
GCTGAGAGGGAAATCGTGCGTG
Cxcl1 (Kc) Absolute copies GCTTGCCTTGACCCTGAAGCTC
TGTTGTCAGAAGCCAGCGTTCAC
Cxcl2 (Mip2) Absolute copies CGCCCAGACAGAAGTCATAGCCAC
TCCTTTCCAGGTCAGTTAGCCTTGC
18S rRNA Absolute copies GGCCGTTCTTAGTTGGTGGAGCG
CTGAACGCCACTTGTCCCTC
Mpo Absolute copies GGAAGGAGACCTAGAGGTTGG
TAGCACAGGAAGGCCAATG
Mmp9 Absolute copies ACGACATAGACGGCATCCA
TGTCGGCTGTGGTTCAGTT
Ltf Absolute copies TGCTTGCTAACCAGACCAGA
ACCAATACACAGGGCACAGA
Csf3r Absolute copies CTGATCTTCTTGCTACTCCCCA
GGTGTAGTTCAAGTGAGGCAG
Slc11a1 Absolute copies TACCAGCAAACCAATGAGGA
CCTGGGGAAGATCTTAGCATAGT

Western blot

Protein was extracted from bone marrow neutrophils of control and VAD mice using Tri-Reagent (Molecular Research Center) according to the manufacturer’s instructions. The concentration of bone marrow neutrophil protein was measured using a modified Bradford assay. Briefly, samples were diluted in 0.15 M NaCl and 1 ml of Bradford substrate (0.1 mg ml−1 Coomassie Brilliant Blue G-250, 5% ethanol and 10% of 85% (w/v) phosphoric acid) was added to 100 μl of either sample of standard. A 10 μg sample of protein was separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane (Millipore). A blocking solution of 2.5% non-fat dried milk and 0.1% Tween 20 (Bio-Rad) in PBS was used. For lactoferrin detection, a 1:200 dilution of the primary antibody (lactoferrin (H-65) rabbit polyclonal IgG, catalogue number sc-25622, Santa Cruz Biotechnology) in blocking solution was added to the membrane. As a loading control, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected at a 1:5,000 dilution of the primary antibody (GAPDH rabbit mAb, clone 14C10, catalogue number 2118S, Cell Signaling) in blocking solution. A goat anti-rabbit horseradish peroxidase conjugated secondary antibody (Bio-Rad) was diluted 1:3,000 in blocking buffer and applied to the membrane. All antibodies were validated by the manufacturers. Protein bands were visualized by chemiluminescence (SuperSignal West Femto Maximum Sensitivity Substrate, ThermoFisher Scientific) using a BioSpectrum (UVP) imaging system. Raw images were processed using Photoshop CS2 (Adobe Systems) to uniformly adjust brightness.

Isolation of neutrophils from mouse bone marrow

Bone marrow fractionation was performed using a modification of the density gradient centrifugation method previously described49. Briefly, bone marrow was flushed from the femora and tibiae with 10 ml of sterile PBS and passed through an 18-gauge needle to disrupt larger bone marrow clumps. Cells were centrifuged at 300 × g for 7 min at 4 °C. Red blood cells were lysed by resuspending a cell pellet in 0.2% NaCl for 20 s followed by the addition of 1.6% NaCl. Cells were centrifuged at 300 × g for 7 min at 4 °C, washed with 2 mM EDTA in PBS and filtered through a 40 μm filter. Using a 15 ml conical tube, 3 ml of Histopaque 1119 (density 1.119 g ml−1, Sigma-Aldrich) was overlaid with 3 ml of Histopaque 1077 (density 1.077 g ml−1, Sigma-Aldrich). Bone marrow cells were resuspended in 1 ml of ice-cold PBS and laid over the Histopaque gradient. Samples were centrifuged for 30 min at 700 × g at 25 °C without a break. Neutrophils were collected at the interface of the Histopaque 1119 and Histopaque 1077 layers and then washed twice with PBS and used for further experiments. The composition of the cell population was confirmed using microscopy to have neutrophil morphology as determined by Giemsa staining.

Spleen neutrophil enrichment

Neutrophils were enriched from the spleen of mice infected with S. Typhimurium using the EasySep Mouse Neutrophil Enrichment Kit (STEMCELL Technologies) according to the manufacturer’s protocol. Briefly, spleens were removed aseptically and smashed using a syringe plunger to produce a single-cell suspension. Red blood cells were lysed by the addition of ACK lysing buffer (Lonza). Cells were centrifuged at 600 × g for 10 min at 4 °C, washed twice with Dulbecco’s PBS (dPBS) and filtered using a 70 mm filter. Neutrophils were enriched by immunomagnetic negative selection. For S. Typhimurium counts, purified neutrophils were enumerated from each sample and neutrophils were lysed with 1% Triton X-100 in PBS or radioimmunoprecipitation assay buffer for 10 min at room temperature. The suspension was serially diluted and plated on LB agar plates containing 100 mg l−1 nalidixic acid (Sigma-Aldrich). After overnight growth at 37 °C, bacterial counts were calculated as CFU per 105 or CFU per 5 × 105 neutrophils.

Flow cytometry

Flow cytometry analysis was performed for the detection of neutrophils in the spleen and bone marrow of control and VAD mice mock infected and infected with S. Typhimurium. Single-cell suspensions of spleen and bone marrow tissue were obtained as described previously. Cells were resuspended in 2 ml of dPBS and stained with an Aqua Live/Dead cell discriminator (Invitrogen) according to the manufacturer’s protocol. After Live/Dead staining, cells were washed with dPBS and resuspended in 50 μl of PBS containing 1% bovine serum albumin and 2 mM EDTA (fluorescence-activated cell sorter (FACS) buffer). Cells were stained with an Fc receptor blocking antibody, anti-CD16/32 (93) (eBioscience), for 5 min at 4°C and then stained for 20 min at 4°C with a cocktail of anti-B220 (RA3-6B2) PerCp-Cy5.5, anti-CD19 (6D5) PerCp-Cy5.5, anti-CD8a (53–6.7) PerCyp-Cy5.5, anti-CD4 (RM4-5) PerCp-Cy5.5, anti-CD11b (M1/70) PE-Cy7, anti-Ly6G (1A8) APC and anti-Ly6C (HK1.4) Pacific Blue (all BioLegend). In addition, for bone marrow samples, an anti-Ter119 (TER-119) PerCp-Cy5.5 (BioLegend) was added. All antibodies were validated by the manufacturers. Cells were washed twice in FACS buffer, fixed with BD Cytofix (BD Biosciences) for 30 min at 4 °C and resuspended in FACS buffer. For quantification of cell populations, 50 μl of SPHERO AccuCount Fluorescent Particles 10.1 μm (Spherotech) was added to each sample before analysis. Calculation of absolute counts was performed according to the manufacturer’s protocol. Flow cytometry analysis was performed using a BD (Becton Dickinson) LSRII, and 1.0 × 106 events were collected per mouse. Data were analysed using FlowJo software (BD Biosciences), and gates were based on fluorescence-minus-one controls.

ELISA

The levels of IL-6 and TNF-α in serum samples from control and VAD mice were determined by enzyme-linked immunosorbent assay (ELISA) (R&D Systems), according to the manufacturer’s instructions. The ELISA test was read at 450 nm with an ELISA microplate reader (Bio-Rad Model 680). Data points are the averages of duplicate dilutions.

In vivo depletion of neutrophils

For neutrophil depletion experiments, control and VAD male mice were injected intraperitoneally 1 day before and after S. Typhimurium infection with either 500 μg of rat anti-mouse Ly6G monoclonal antibody, clone 1A8 (BioXCell), or 500 μg of rat IgG2a isotype control, clone 2A3 (BioXCell), diluted in 0.2 ml of dPBS. Neutrophil depletion in the tissue was confirmed by flow cytometry as described previously.

Adoptive transfer

Bone marrow neutrophils were isolated from male and female 8–12-week-old, healthy C57BL/6 Slc11a1+/+ mice using the protocol described above. Once collected, neutrophils were washed twice with dPBS, counted and suspended in dPBS at a concentration of 1.5–2 × 107 cells ml−1. Male VAD mice were inoculated intragastrically 1 day after S. Typhimurium infection with either 0.2 ml of the neutrophil suspension (total of 3–4 × 106 neutrophils per mouse) or 0.2 ml of dPBS. Animals were necropsied 3 days after S. Typhimurium infection to assess bacteriology.

Statistical analysis

The statistical significance of differences between groups was determined by a one- or two-tailed Student’s t-test, or one-way analysis of variance (ANOVA) with a post hoc Tukey or Sidak’s test on logarithmically or arc-sin-transformed data. A P value of 0.05 or less was considered to be significant. Animals were excluded if they were not confirmed to be infected after intraperitoneal (IP) administration of S. Typhimurium. Data points that were identified as outliers were excluded based on the ROUT method. No statistical methods were used to predetermine sample sizes, but our sample sizes are similar to those reported in previous publications23. GraphPad Prism 6 was used to perform analyses (GraphPad).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Supplementary information

Supplementary Information (962.1KB, pdf)

Extended Data Fig. 2b uncropped western blots.

Reporting Summary (2.5MB, pdf)

Source data

Source Data Fig. 1 (47.1KB, xlsx)

Source data for all figure panels.

Source Data Fig. 2 (42.6KB, xlsx)

Source data for all figure panels.

Source Data Fig. 3 (38.8KB, xlsx)

Source data for all figure panels.

Source Data Fig. 4 (38.8KB, xlsx)

Source data for all figure panels.

Source Data Extended Data Fig. 1 (42.7KB, xlsx)

Source data for all figure panels.

Source Data Extended Data Fig. 2 (31.2KB, xlsx)

Source data for all figure panels.

Source Data Extended Data Fig. 3 (32.4KB, xlsx)

Source data for all figure panels.

Source Data Extended Data Fig. 4 (33.3KB, xlsx)

Source data for all figure panels.

Acknowledgements

This work was supported by USPHS grants AI098078 and AI149632. K.L.L.-T. was supported by American Heart Association Predoctoral Fellowship 15PRE21420011. V.E.D.-O. was supported by a University of California Chancellor’s Fellowship. K.L.L.-T., G.T.W., C.E.D. and L.C. were supported by USPHS grant T32AI060555. Flow cytometry was performed in a facility supported by Facilities Improvement grant RR12088-01. We would like to thank M. Winter, B. Young, T. Kerrinnes, F. Faber and C. Lopez for experimental support, and A. Bäumler for helpful discussions during the course of this work. USDA is an equal-opportunity employer and provider.

Extended data

Author contributions

K.L.L.-T., V.E.D.O., L.C., A.R.S.-L., A.E.R.V.H., X.J., C.E.D., J.C.L. and D.H. performed and analysed the experiments. J.P.M., G.T.W. and A.D.M. performed the experiments. K.L.L.-T., V.E.D.O., C.B.S., S.J.M. and R.M.T. were responsible for the overall study design and for writing the paper. All authors read and approved the paper.

Peer review

Peer review information

Nature Microbiology thanks the anonymous reviewers for their contribution to the peer review of this work.

Data availability

All data supporting the findings of this study are available within the article and its Supplementary Information. Additional data supporting the findings in this study are available from the corresponding author upon request. Source data are provided with this paper.

Code availability

No code was used to analyse any of the data in this paper.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Kristen L. Lokken-Toyli, Vladimir E. Diaz-Ochoa.

Extended data

is available for this paper at 10.1038/s41564-024-01613-0.

Supplementary information

The online version contains supplementary material available at 10.1038/s41564-024-01613-0.

References

  • 1.Han T, Sokal JE, Neter E. Salmonellosis in disseminated malignant diseases. A seven-year review (1959–1965) N. Engl. J. Med. 1967;276:1045–1052. doi: 10.1056/NEJM196705112761901. [DOI] [PubMed] [Google Scholar]
  • 2.Levine WC, Buehler JW, Bean NH, Tauxe RV. Epidemiology of non-typhoidal Salmonella bacteremia during the human immunodeficiency virus epidemic. J. Infect. Dis. 1991;164:81–87. doi: 10.1093/infdis/164.1.81. [DOI] [PubMed] [Google Scholar]
  • 3.Winkelstein JA, et al. Chronic granulomatous disease. Report on a national registry of 368 patients. Medicine. 2000;79:155–169. doi: 10.1097/00005792-200005000-00003. [DOI] [PubMed] [Google Scholar]
  • 4.Wright J, Thomas P, Serjeant GR. Septicemia caused by Salmonella infection: an overlooked complication of sickle cell disease. J. Pediatr. 1997;130:394–399. doi: 10.1016/S0022-3476(97)70201-4. [DOI] [PubMed] [Google Scholar]
  • 5.Ao, T. T. et al. Global burden of invasive non-typhoidal Salmonella disease, 2010. Emerg. Infect. Dis. 10.3201/eid2106.140999 (2015). [DOI] [PMC free article] [PubMed]
  • 6.Berkley JA, et al. Bacteremia among children admitted to a rural hospital in Kenya. N. Engl. J. Med. 2005;352:39–47. doi: 10.1056/NEJMoa040275. [DOI] [PubMed] [Google Scholar]
  • 7.Feasey NA, Dougan G, Kingsley RA, Heyderman RS, Gordon MA. Invasive non-typhoidal salmonella disease: an emerging and neglected tropical disease in Africa. Lancet. 2012;379:2489–2499. doi: 10.1016/S0140-6736(11)61752-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Feasey NA, et al. Three epidemics of invasive multidrug-resistant salmonella bloodstream infection in Blantyre, Malawi, 1998–2014. Clin. Infect. Dis. 2015;61:S363–S371. doi: 10.1093/cid/civ691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Nielsen MV, et al. Incidence and characteristics of bacteremia among children in rural Ghana. PLoS ONE. 2012;7:e44063. doi: 10.1371/journal.pone.0044063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Reddy EA, Shaw AV, Crump JA. Community-acquired bloodstream infections in Africa: a systematic review and meta-analysis. Lancet Infect. Dis. 2010;10:417–432. doi: 10.1016/S1473-3099(10)70072-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Sigauque B, et al. Community-acquired bacteremia among children admitted to a rural hospital in Mozambique. Pediatr. Infect. Dis. J. 2009;28:108–113. doi: 10.1097/INF.0b013e318187a87d. [DOI] [PubMed] [Google Scholar]
  • 12.De Wit S, Taelman H, Van de Perre P, Rouvroy D, Clumeck N. Salmonella bacteremia in African patients with human immunodeficiency virus infection. Eur. J. Clin. Microbiol. Infect. Dis. 1988;7:45–47. doi: 10.1007/BF01962170. [DOI] [PubMed] [Google Scholar]
  • 13.Gordon MA, et al. Non-typhoidal salmonella bacteraemia among HIV-infected Malawian adults: high mortality and frequent recrudescence. AIDS. 2002;16:1633–1641. doi: 10.1097/00002030-200208160-00009. [DOI] [PubMed] [Google Scholar]
  • 14.Brown M, Eykyn SJ. Non-typhoidal Salmonella bacteraemia without gastroenteritis: a marker of underlying immunosuppression. Review of cases at St. Thomas' Hospital 1970–1999. J. Infect. 2000;41:256–259. doi: 10.1053/jinf.2000.0750. [DOI] [PubMed] [Google Scholar]
  • 15.Babirekere-Iriso E, Musoke P, Kekitiinwa A. Bacteraemia in severely malnourished children in an HIV-endemic setting. Ann. Trop. Paediatr. 2006;26:319–328. doi: 10.1179/146532806X152845. [DOI] [PubMed] [Google Scholar]
  • 16.Bachou H, Tylleskar T, Kaddu-Mulindwa DH, Tumwine JK. Bacteraemia among severely malnourished children infected and uninfected with the human immunodeficiency virus-1 in Kampala, Uganda. BMC Infect. Dis. 2006;6:160. doi: 10.1186/1471-2334-6-160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Walsh AL, Phiri AJ, Graham SM, Molyneux EM, Molyneux ME. Bacteremia in febrile Malawian children: clinical and microbiologic features. Pediatr. Infect. Dis. J. 2000;19:312–318. doi: 10.1097/00006454-200004000-00010. [DOI] [PubMed] [Google Scholar]
  • 18.Brent AJ, et al. Incidence of clinically significant bacteraemia in children who present to hospital in Kenya: community-based observational study. Lancet. 2006;367:482–488. doi: 10.1016/S0140-6736(06)68180-4. [DOI] [PubMed] [Google Scholar]
  • 19.Stevens GA, et al. Trends and mortality effects of vitamin A deficiency in children in 138 low-income and middle-income countries between 1991 and 2013: a pooled analysis of population-based surveys. Lancet Glob. Health. 2015;3:e528–e536. doi: 10.1016/S2214-109X(15)00039-X. [DOI] [PubMed] [Google Scholar]
  • 20.Singletary LA, et al. Loss of multicellular behavior in epidemic African non-typhoidal Salmonella enterica serovar Typhimurium ST313 strain D23580. mBio. 2016;7:e02265. doi: 10.1128/mBio.02265-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kingsley RA, et al. Epidemic multiple-drug resistant Salmonella Typhimurium causing invasive disease in sub-Saharan Africa have a distinct genotype. Genome Res. 2009;19:2279–2287. doi: 10.1101/gr.091017.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Arpaia N, et al. TLR signaling is required for Salmonella Typhimurium virulence. Cell. 2011;144:675–688. doi: 10.1016/j.cell.2011.01.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lokken KL, et al. Malaria parasite infection compromises control of concurrent systemic non-typhoidal salmonella infection via IL-10-mediated alteration of myeloid cell function. PLoS Pathog. 2014;10:e1004049. doi: 10.1371/journal.ppat.1004049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hestdal K, et al. Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J. Immunol. 1991;147:22–28. doi: 10.4049/jimmunol.147.1.22. [DOI] [PubMed] [Google Scholar]
  • 25.Manz MG, Boettcher S. Emergency granulopoiesis. Nat. Rev. Immunol. 2014;14:302–314. doi: 10.1038/nri3660. [DOI] [PubMed] [Google Scholar]
  • 26.Cowland JB, Borregaard N. Granulopoiesis and granules of human neutrophils. Immunol. Rev. 2016;273:11–28. doi: 10.1111/imr.12440. [DOI] [PubMed] [Google Scholar]
  • 27.Canonne-Hergaux F, et al. Expression and subcellular localization of NRAMP1 in human neutrophil granules. Blood. 2002;100:268–275. doi: 10.1182/blood.V100.1.268. [DOI] [PubMed] [Google Scholar]
  • 28.Haschka D, Hoffmann A, Weiss G. Iron in immune cell function and host defense. Semin. Cell Dev. Biol. 2021;115:27–36. doi: 10.1016/j.semcdb.2020.12.005. [DOI] [PubMed] [Google Scholar]
  • 29.Cunrath O, Bumann D. Host resistance factor SLC11A1 restricts Salmonella growth through magnesium deprivation. Science. 2019;366:995–999. doi: 10.1126/science.aax7898. [DOI] [PubMed] [Google Scholar]
  • 30.Harrington KA, Hormaeche CE. Expression of the innate resistance gene Ity in mouse Kupffer cells infected with Salmonella Typhimurium in vitro. Micro. Pathog. 1986;1:269–274. doi: 10.1016/0882-4010(86)90051-3. [DOI] [PubMed] [Google Scholar]
  • 31.Lissner CR, Swanson RN, O'Brien AD. Genetic control of the innate resistance of mice to Salmonella Typhimurium: expression of the Ity gene in peritoneal and splenic macrophages isolated in vitro. J. Immunol. 1983;131:3006–3013. doi: 10.4049/jimmunol.131.6.3006. [DOI] [PubMed] [Google Scholar]
  • 32.Vidal S, et al. The Ity/Lsh/Bcg locus: natural resistance to infection with intracellular parasites is abrogated by disruption of the Nramp1 gene. J. Exp. Med. 1995;182:655–666. doi: 10.1084/jem.182.3.655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wessling-Resnick M. Nramp1 and other transporters involved in metal withholding during infection. J. Biol. Chem. 2015;290:18984–18990. doi: 10.1074/jbc.R115.643973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Cellier M, et al. Expression of the human NRAMP1 gene in professional primary phagocytes: studies in blood cells and in HL-60 promyelocytic leukemia. J. Leukoc. Biol. 1997;61:96–105. doi: 10.1002/jlb.61.1.96. [DOI] [PubMed] [Google Scholar]
  • 35.Daley JM, Thomay AA, Connolly MD, Reichner JS, Albina JE. Use of Ly6G-specific monoclonal antibody to deplete neutrophils in mice. J. Leukoc. Biol. 2008;83:64–70. doi: 10.1189/jlb.0407247. [DOI] [PubMed] [Google Scholar]
  • 36.Chih DY, Chumakov AM, Park DJ, Silla AG, Koeffler HP. Modulation of mRNA expression of a novel human myeloid-selective CCAAT/enhancer binding protein gene (C/EBP epsilon) Blood. 1997;90:2987–2994. doi: 10.1182/blood.V90.8.2987. [DOI] [PubMed] [Google Scholar]
  • 37.Yamanaka R, et al. Impaired granulopoiesis, myelodysplasia, and early lethality in CCAAT/enhancer binding protein epsilon-deficient mice. Proc. Natl Acad. Sci. USA. 1997;94:13187–13192. doi: 10.1073/pnas.94.24.13187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Evrard M, et al. Developmental analysis of bone marrow neutrophils reveals populations specialized in expansion, trafficking, and effector functions. Immunity. 2018;48:364–379.e8. doi: 10.1016/j.immuni.2018.02.002. [DOI] [PubMed] [Google Scholar]
  • 39.Green HN, Mellanby E. Vitamin A as an anti-infective agent. Br. Med. J. 1928;2:691–696. doi: 10.1136/bmj.2.3537.691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Mora JR, et al. Generation of gut-homing IgA-secreting B cells by intestinal dendritic cells. Science. 2006;314:1157–1160. doi: 10.1126/science.1132742. [DOI] [PubMed] [Google Scholar]
  • 41.Iwata M, et al. Retinoic acid imprints gut-homing specificity on T cells. Immunity. 2004;21:527–538. doi: 10.1016/j.immuni.2004.08.011. [DOI] [PubMed] [Google Scholar]
  • 42.Bang YJ, et al. Serum amyloid A delivers retinol to intestinal myeloid cells to promote adaptive immunity. Science. 2021;373:eabf9232. doi: 10.1126/science.abf9232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Mucida D, et al. Reciprocal TH17 and regulatory T cell differentiation mediated by retinoic acid. Science. 2007;317:256–260. doi: 10.1126/science.1145697. [DOI] [PubMed] [Google Scholar]
  • 44.Brown CC, et al. Retinoic acid is essential for Th1 cell lineage stability and prevents transition to a Th17 cell program. Immunity. 2015;42:499–511. doi: 10.1016/j.immuni.2015.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Gattu S, et al. Epithelial retinoic acid receptor beta regulates serum amyloid A expression and vitamin A-dependent intestinal immunity. Proc. Natl Acad. Sci. USA. 2019;116:10911–10916. doi: 10.1073/pnas.1812069116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Fritsche G, Nairz M, Libby SJ, Fang FC, Weiss G. Slc11a1 (Nramp1) impairs growth of Salmonella enterica serovar Typhimurium in macrophages via stimulation of lipocalin-2 expression. J. Leukoc. Biol. 2012;92:353–359. doi: 10.1189/jlb.1111554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Miao EA, et al. Caspase-1-induced pyroptosis is an innate immune effector mechanism against intracellular bacteria. Nat. Immunol. 2010;11:1136–1142. doi: 10.1038/ni.1960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Conlan JW. Neutrophils prevent extracellular colonization of the liver microvasculature by Salmonella Typhimurium. Infect. Immun. 1996;64:1043–1047. doi: 10.1128/iai.64.3.1043-1047.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Swamydas, M. & Lionakis, M. S. Isolation, purification and labeling of mouse bone marrow neutrophils for functional studies and adoptive transfer experiments. J. Vis. Exp.10.3791/50586 (2013). [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information (962.1KB, pdf)

Extended Data Fig. 2b uncropped western blots.

Reporting Summary (2.5MB, pdf)
Source Data Fig. 1 (47.1KB, xlsx)

Source data for all figure panels.

Source Data Fig. 2 (42.6KB, xlsx)

Source data for all figure panels.

Source Data Fig. 3 (38.8KB, xlsx)

Source data for all figure panels.

Source Data Fig. 4 (38.8KB, xlsx)

Source data for all figure panels.

Source Data Extended Data Fig. 1 (42.7KB, xlsx)

Source data for all figure panels.

Source Data Extended Data Fig. 2 (31.2KB, xlsx)

Source data for all figure panels.

Source Data Extended Data Fig. 3 (32.4KB, xlsx)

Source data for all figure panels.

Source Data Extended Data Fig. 4 (33.3KB, xlsx)

Source data for all figure panels.

Data Availability Statement

All data supporting the findings of this study are available within the article and its Supplementary Information. Additional data supporting the findings in this study are available from the corresponding author upon request. Source data are provided with this paper.

No code was used to analyse any of the data in this paper.


Articles from Nature Microbiology are provided here courtesy of Nature Publishing Group

RESOURCES