AgrA directly binds to the promoter of vraSR and downregulates its expression in Staphylococcus aureus

ABSTRACT

Staphylococcus aureus is an important human pathogen and vancomycin is widely used for the treatment of S. aureus infections. The global regulator agr is known as a well-described virulence regulator. Previous studies have found that agr-dysfunction strains are more likely to develop into vancomycin-resistant strains, but the mechanism for this phenomenon remains unknown. VraSR is a two-component regulatory system related to vancomycin resistance. In this study, we found that the expression levels of vraR were higher in agr-dysfunction clinical strains than in the agr-functional strains. We knocked out agr in a clinical strain, and quantitative reverse transcription PCR and β-galactosidase activity assays revealed that agr repressed transcription of vraR. After vancomycin exposures, population analysis revealed larger subpopulations displaying reduced susceptibility in agr knockout strain compared with wild-type strain, and this pattern was also observed in agr-dysfunction clinical strains compared with the agr-functional strains. Electrophoretic mobility experiment demonstrated binding of purified AgrA to the promoter region of vraR. In conclusion, our results indicated that the loss of agr function in S. aureus may contribute to the evolution of reduced vancomycin susceptibility through the downregulation of vraSR.

INTRODUCTION

Staphylococcus aureus as an opportunistic pathogen can cause many community-acquired and hospital-acquired infections, ranging from superficial skin abscesses to life-threatening bacteremia (1, 2). The diversity and severity of infections caused by S. aureus depend on the following: production of surface proteins that mediate bacterial adherence to host tissues; secretion of a series of extracellular toxins and enzymes that destruct host cells and tissues; avoidance of the host immune defense; and growth and spread of bacteria in host cells (3). The accessory gene regulator (agr) quorum sensing system has been shown to modulate the expression of aggressive virulence determinants in acute infection, and has a more complicated regulatory mechanism in chronic infection (4).

Vancomycin has been one of the most frequently used antibiotics for invasive S. aureus infections (5), especially methicillin-resistant S. aureus (MRSA) infections. In recent years, because of the widespread use of vancomycin, strains with reduced vancomycin sensitivity have emerged, including vancomycin-intermediate S. aureus (VISA), heterogeneous vancomycin-intermediate S. aureus (hVISA) and vancomycin-resistant S. aureus (VRSA) (6, 7). While it has been determined that VRSA is mainly caused by the acquisition of the vanA operon encoded on transposon Tn1546, the molecular mechanisms responsible for the reduced vancomycin susceptibility in VISA/hVISA are incompletely defined. Generally, VISA has been considered to evolve from vancomycin-susceptible S. aureus (VSSA) through intrinsic mutagenesis or altered expression levels of some genes (8). The vancomycin-resistance-associated sensor/regulator VraSR is one of the two-component systems (TCSs) that regulates the cell-wall stress response (9), studies confirmed that the expression of vraSR is upregulated in VISA compared with VSSA (10–12).

Previous studies reported that S. aureus strains with a loss of agr function are more likely to show reduced susceptibility to vancomycin (13–16), suggesting that there may be a relationship between agr and vancomycin susceptibility, but the mechanism remains unknown. In this study, we confirmed that agr knockout strain exhibited larger subpopulations displaying reduced vancomycin susceptibility after vancomycin exposure, which indicated that loss of agr may contribute to the evolution of reduced vancomycin susceptibility in S. aureus, and this effect may be achieved by AgrA protein directly binding to the promoter region of vraR and downregulating its expression.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth media

Escherichia coli strains were grown with shaking (220 rpm) in Luria-Bertani (LB) medium (Oxoid) or on LB agar at 37°C or 16°C. S. aureus strains were grown with shaking (220 rpm) in tryptic soy broth (TSB) medium (OXOID), Mueller-Hinton (MH) medium (Solarbio), or on tryptic soy agar at 37°C or at 42°C for allelic replacement. Plasmid pET28a was used to construct AgrA protein expression vector. Plasmid pOS1-lacZ was used to construct recombinant LacZ reporter vector. Plasmid pBTs (17) was used to obtain the knockout and complementation strains. When required, appropriate antibiotics were used at the following concentrations: for E. coli, ampicillin at 100 µg/mL and kanamycin at 50 µg/mL; for S. aureus, chloramphenicol at 15 µg/mL and anhydrotetracycline at 200 ng/mL for agr mutant and complementation strains construction.

Construction of agr mutant and complementation strains

High-fidelity enzyme PrimeStar Max Premix (TaKaRa) was used to amplify DNA fragments. For the knockout strain, upstream and downstream fragments were amplified with the paired primers agr-up-F/agr-up-R and agr-down-F/agr-down-R, respectively, then joined by SOE-PCR to form up-down fragments. For the complementation strain, DNA fragments were amplified with the primer pair Cagr-F/Cagr-R. The PCR products were digested with KpnI and SalI, and then ligated to the same sites in pBTs (17) using T4 ligase. The ligation products were first transformed into S. aureus RN4220 for modification and subsequently electroporated into corresponding strains. The allelic replacement used a previously described method (18).

Population analysis profiles

Modified population analysis profiles (PAPs) were performed as previously described (19). Briefly, the overnight cultures of strains were serially diluted by 10-fold in saline, plated onto brain heart infusion agar containing different concentrations of vancomycin. Colonies were counted after a 48-h incubation at 37°C. The results were presented as an average from three independent experiments.

Total RNA isolation, cDNA generation, and real-time quantitative reverse transcription-PCR

For RNA isolation, overnight cultures of S. aureus were diluted 1:100 in TSB and then grown to the indicated cell density until being collected. Total RNA was extracted with TRIzol (Invitrogen) according to the manufacturer’s instructions. Residual DNA was removed with gDNA wiper Mix (Vazyme). The cDNAs were synthesized from 100 ng total RNA using HiScript III qRT SuperMix (Vazyme), and quantitative reverse transcription-PCR (qRT-PCR) was performed with SYBR Premix Ex Taq (TaKaRa) using the QuantStudio5 (Thermo Fisher Scientific). The hu gene was used as an internal reference. Primer sequences are provided in Table 1. All qRT-PCR assays were repeated at least three times.

TABLE 1.

Primers used in this study^a

Strain or plasmid	Sequence (5′−3′)a	Application
agr-up-F	GCGggtaccAAGAGGTTGAACAAGCATTT	agr deletion
agr -up-R	GCAGCGATGGATTTTATTTT	agr deletion
agr -down-F	AAAATAAAATCCATCGCTGCGATGAATAATTAATTACTTTCAT	agr deletion
agr -down-R	ACGCgtcgacGTCATTGGAACTAATAGCAC	agr deletion
Cagr-F	GCGggtaccTTACATTTAACAGTTAAGTATTTATTTCCTACAGTT	agr complementation
Cagr-R	GCGgtcgacTTATTTTTTTTTAACGTTTCTCACCGATG	agr complementation
RT-vraSR-F	CTGAGTCGTCGCTTCTACACCATC	qRT-PCR
RT-vraSR-R	AATTGCCAAAGCCCATGAGTTGAAG	qRT-PCR
RT-hu-F	TGCTGGAACTTTACTTGCTGGGATATC	qRT-PCR and EMSA
RT-hu-F	GTTTCGGTAACTTTGAGGTACGTGAAC	qRT-PCR and EMSA
agrA-F	AAAggatccATGAA AATTT TCATT TGCGA	AgrA expression
agrA-R	AAActcgagTTATT TTTTT TTAAC GTTTC	AgrA expression
vraSR-p-F214	CCTATTCATATTGGTTTCGGAAC	EMSA
vraSR-p-F151-Biotin	TAAGTTTTAAAATACCAAATGCGCTATGT	EMSA
vraSR-p-R151	CCTATTCATATTGGTTTCGGAACTGT	EMSA
vraSR-p-F63	TTATAAAAGGTGATAGTTATGAACTATGTTGAAC	EMSA
vraSR-p-R-Biotin	TGTTGCTCTCAAAAACTGTTCAATA	EMSA
agr-p-F	TTACACCACTCTCCTCACT	EMSA
agr-p-R-Biotin	ATCAACTATTTTCCATCACATCT	EMSA
Pvra-F-EcoRI	CGgaattcAAATTGAAGAAGAATAGTTCAACATATACTAAGAC	pOS1-vra
Pvra-R-BamHI	CGggatccACGTTCAACATAGTTCATAACTATCAC	pOS1-vra

^a Lowercase letters: restriction endonuclease recognition sites.

Total protein extraction and western blotting

Collected S. aureus cells were washed and resuspended in 1 mL phosphate-buffered saline containing 1 mM phenylmethylsulfonyl fluoride, then lysed using the FastPrep-24 tissue and cell homogenizer (MP Biomedicals, Solon, OH). After centrifugation at 13,680 × g (10 min at 4°C), the supernatants were collected and total protein concentrations were quantified using bicinchoninic acid. The samples were adjusted to equal concentrations, separated by 12.5% SDS-PAGE and electrotransferred to a polyvinylidene difluoride membrane (Millipore). After blocking with 5% (wt/vol) nonfat milk in Tris-buffered saline containing 0.1% Tween 20 at room temperature for 1.5 h, the membrane was incubated with antibody at a 1:3,000 dilution. Bound antibody was detected using the goat anti-rabbit IgG conjugated to horseradish peroxidase (ABclonal) at a 1:5,000 dilution. The experiment was repeated at least three times, with similar results.

Expression and purification of AgrA

The agrA-F/ agrA-R primer pair, which contains BamHI and XhoI restriction sites, was used to amplify the agrA gene from template DNA. The fragments and pET28a plasmid were double digested by BamHI and XhoI enzymes. T4 ligase was used to ligate the above products, and the recombinant plasmid was transformed into E. coli DH5α, then transformed into E. coli BL21(DE3). The transformant was inoculated in LB medium (containing 50 µg/mL kanamycin) and grown on a shaker at 37°C until the OD₆₀₀ was approximately 0.4–0.6. Next, the cells were induced overnight with 0.2 mM isopropyl-β-D-1-thiogalactopyranoside at 16°C. The cells were collected by centrifugation and lysed by sonication in a lysis buffer (50 mM Tris-HCl, pH 8.0, 300 mM NaCl). Hexahistidine-tagged AgrA protein was purified using the His Bind Purification Kit (Millipore) according to the kit instructions.

Electrophoretic mobility shift assay

The 214-bp biotin-labeled vraR promoter probe was amplified from template DNA using the primer pair vraSR-p-F214/vraSR-p-R-Biotin, truncated biotin-labeled probes were amplified using the primer pairs vraSR-p-F151-Biotin/vraSR-p-R151 and vraSR-p-F63/vraSR-p-R-Biotin, respectively. The biotin-labeled probes were incubated with different volumes of AgrA protein in binding buffer at 25°C for 30 min. Next, the mixtures were electrophoresed in a 4% polyacrylamide gel and transferred to a nylon membrane (GE Health) in 0.5 × Tris-borate-EDTA buffer. The band shifts were detected using the Electrophoretic Mobility Shift Assay Kit (Beyotime) and imaged by a Tanon 5200 chemiluminescent imager. A 235-bp biotin-labeled agr promoter fragment amplified using the primer pair agr-p-F/agr-p-R-Biotin was served as a positive control. Unlabeled vraR promoter fragments were added to the labeled fragments at a ratio of approximately 100:1 as a specific competitor. The unlabeled DNA fragment of the hu ORF (98 bp) was amplified using the primer pair RT-hu-F/RT-hu-R, and added 100- to 200-fold as a nonspecific competitor.

Construction of the LacZ reporter vector

To construct the reporter vector pOS1-vra-LacZ, a fragment including the vraR promoter and the nucleotide sequence encoding the first six amino acids of the coding sequence was amplified from template genomic DNA using the primer pair Pvra-F/Pvra-R. The PCR product and pOS1-lacZ plasmid were digested with EcoRI and BamHI, then ligated using T4 DNA ligase to get the recombinant plasmid pOS1-vra-LacZ. The reporter plasmid was first transformed into S. aureus RN4220, and then corresponding strains.

β-galactosidase activity assay

Overnight cultures of strains were diluted 1:100 into TSB containing chloromycetin and grown to the indicated cell density until being collected. Cultures were collected by centrifugation with the volume V (in milliliters) of bacterial liquid recorded. The cells were resuspended with 100 µL ABT-LSA buffer (60 mM K₂HPO₄, 40 mM KH₂PO₄, 100 mM NaCl, 0.1% Triton X-100, and 50 µg/mL lysostaphin) and incubated at 37°C for 20 min. After lysis, 100 µL ABT buffer and 100 µL o-nitrophenyl-β-D-galactopyranoside (4 mg/mL) were added. The mixture was then incubated at 37°C until the solution turned yellow, following which 1 mL Na₂CO₃ (1 M) was added to terminate the reaction, and the reaction time T (in min) was noted. After centrifuged at 12,000 × g for 10 min, the absorbance of the supernatant was read at 420 nm. β-galactosidase units were calculated as the following formula: units = (1000 × OD₄₂₀)/(T × V × OD₆₀₀). The experiment was repeated at least three times.

Statistical analysis

F-tests were performed to compare the variances of two samples. Unpaired two-tailed t tests for equal or unequal variance were then performed to calculate the significance of differences (P values). A P value < 0.05 was considered statistically significant.

RESULTS

vraR is upregulated in clinical MRSA strains with agr dysfunction

vraSR is a known vancomycin-resistance-associated gene, since the agr-dysfunction strains are reported more easily to be induced into a vancomycin intermediate resistance phenotype, we compared the mRNA and protein expression levels of vraR in several agr-functional and agr-dysfunction clinical MRSA using qRT-PCR and western blotting. The clinical strains used are listed in Table S1, agr typing was performed as previously described (20). As shown in Fig. 1A, the relative abundance of vraR cDNA in the agr-dysfunction strains was higher than that in the agr-functional strains. Next, western blotting measurements of VraR production in total protein (Fig. 1B) showed higher production levels in agr-dysfunction strains than in agr-functional strains. Moreover, we grew and passaged these clinical strains in medium containing 0.5 µg/mL vancomycin for 48 h and 96 h, and then performed vancomycin population analyses (19). To exclude the occurrence of mutations under vancomycin pressure, the whole genomes of strain D1–D4 were sequenced before and after 96 h vancomycin exposure (BioProject ID: PRJNA1049026). Figure 2 shows that the agr-dysfunction strains were more likely to show decreased vancomycin susceptibility than agr-functional strains after vancomycin exposures. In summary, agr-dysfunction strains showed higher vraR expression levels, and exhibited larger subpopulations displaying reduced susceptibility when induced by vancomycin.

Fig 1.

Expression levels of vraR in agr-functional and agr-dysfunction clinical MRSA strains. (A) qRT-PCR analysis of vraR transcription levels (n = 4). (B) Western blotting analysis of VraR protein levels in the indicated strains. LC, loading control. Statistically significant differences calculated by the unpaired two-tailed Student’s t test are indicated: NS, not significant (P > 0.05); *P < 0.05; **P < 0.01; ***P < 0.001.

Fig 2.

Vancomycin population analysis of clinical MRSA strains. PAP of clinical strains before (A) and after vancomycin induction for 48 h (B) or 96 h (C). The agr-functional strains P1–P4 are shown in red and the agr-dysfunction strains D1–D4 are shown in blue. The concentration of vancomycin is 0.5 µg/mL, and all strains were passaged every 24 h.

vraR is upregulated in an agr knockout strain

To explore whether there was a relationship between agr and vraSR, we constructed an agr knockout strain in a clinical MRSA strain 03 and its complemented strain. As shown in Fig. 3A and B, qRT-PCR and western blotting measurements of the transcription and protein levels of vraR in these strains revealed that vraR was upregulated in the agr knockout. These results indicated that agr had an effect on the expression of vraR. To further understand this relationship, we next constructed the lacZ fusion reporter plasmid pOS1_vra and measured the β-galactosidase activities in the WT and agr knockout strains. The β-galactosidase activity in the agr knockout strain was significantly higher than that in the WT strain (Fig. 3C), suggesting that agr is a negative regulator of vraSR.

Fig 3.

Negative regulation of vraR by agr. (A) qRT-PCR analysis of vraR gene expression in WT, agr knockout and complementation strains. (B) Western blotting analysis of VraR protein levels in each strain. (C) The β-galactosidase activities of vraR promoter in the WT and agr knockout strains. (D) Modified vancomycin PAPs. The strains were pre-exposed by 0.5 µg/mL vancomycin for 24 h. Statistically significant differences calculated by the unpaired two-tailed Student’s t test are indicated: NS, not significant (P > 0.05); *P < 0.05; **P < 0.01; ***P < 0.001.

The upregulation of vraSR can confer strains a reduced level of vancomycin susceptibility (21–23). To verify that a change in vancomycin resistance occurred in the agr knockout strain, we measured the vancomycin MIC using the E-test method, but there was no difference between the WT and agr knockout strains (Fig. S1). Considering that the vancomycin susceptibility may decrease after vancomycin treatment, we grew the two strains in medium containing 0.5 µg/mL vancomycin for 24 h, then performed modified PAP. The agr knockout strain showed reduced susceptibility compared with the WT strain (Fig. 3D). This result indicated that the loss of agr may contribute to the evolution of reduced susceptibility of S. aureus when exposed to vancomycin, and this effect may be due to the upregulation of vraR.

AgrA protein directly binds to the promoter region of vraR

The Agr system has been recognized as a pivotal regulator of virulence factors. Furthermore, agr-dysfunction strains are reported more easily to develop vancomycin resistance, but the molecular mechanism is unknown (13, 14). There are two distinct manners of Agr-mediated regulation: indirectly, through the effector molecule RNAIII (24–26), or directly, via AgrA binding to target promoter regions (27).To investigate the mechanism underlying altered expression of vraR, we expressed and purified the AgrA protein, and performed the electrophoretic mobility shift assay (EMSA) with the full-length and truncated biotin-labeled promoter of vraR. As shown in Fig. 4A, AgrA protein retarded the mobility of the vraR promoter as well as its own promoter, which was used as a functional control. Next, the 214 bp vraR probe was divided into 151 bp and 63 bp fragments for EMSA to determine the binding region (Fig. 4B). The shifted band disappeared with the 151 bp probe, but persisted with the 63 bp probe, indicating that the protein binding site was located with the 63 bp probe (Fig. 4C). We analyzed and aligned the AgrA binding sequences reported in previous studies (24, 28, 29), and found a somewhat similar single sequence (5′-GATAGTTATG-3′) in the 63 bp probe. Taken together, our results indicated that AgrA protein regulates vraSR expression by directly binding to the vraSR promoter.

Fig 4.

Direct binding of AgrA to the vraR promoter region.(A) EMSA of purified AgrA with the biotin-labeled vraR promoter probe. The biotin-labeled agr promoter was used as functional control. Unlabeled probe was added as a specific competitor, and unlabeled fragment of the hu ORF region was added as a nonspecific competitor. (B) EMSA of AgrA with truncated vraR promoter probes. (C) Schematic diagram of the vraR promoter region. The start points of the truncated probes are marked by arrows. The whole-length probe was started from F214, the truncated 63-bp region was started from F63, and the truncated 151-bp region was between F214 and F63.

DISCUSSION

The 16 TCS of S. aureus can adapt bacteria to the environmental changes in the process of infection by altering the expression of genes involved in biofilm formation, adhesion, and those encoding extracellular enzymes. TCSs, such as AgrCA and SaeRS, have been reported to be the main factors regulating the expression of virulence factors, while VraSR, GraSR, BraRS, and WalKR are the main factors regulating bacterial drug resistance. The internal regulatory network mechanisms of S. aureus are very complex, TCSs can cross-talk to jointly regulate the adaptation of bacteria to the environment and maintain bacterial survival (30, 31).

Vancomycin is the first-choice drug for treatment of MRSA infections, the emergence of VISA/hVISA was of great concern, and has led to a large number of studies on the mechanism of vancomycin resistance in S. aureus (10). Transcriptomics analyses revealed that, compared with VSSA, VISA/hVISA strains have significant changes in the expression and activity of multiple genes, including vraSR, walKR, and graSR (9, 12, 32), and among these TCSs, VraSR is the most widely reported one that is clearly related to vancomycin resistance. Previous studies have reported that agr knockout strains were more likely to produce heterogeneous resistance to vancomycin than WT strains (13, 14, 16, 33), suggesting that there may be a relationship between agr and vancomycin resistance. Therefore, we speculated that agr may have a regulatory effect on VraSR. Herein, we collected several agr-functional and agr-dysfunction clinical MRSA strains and then compared the vraR mRNA and protein expression levels. We found that the vraR was upregulated in the agr-dysfunction strains compared with the agr-functional strains, which inspired us to conduct further research.

We knocked out the agr gene of a clinical MRSA strain 03, and found that the knockout strain exhibited significantly increased mRNA expression and protein production levels of vraR. Furthermore, the β-galactosidase activity of the lacZ reporter of vraR promoter showed a significant increase in the agr knockout strain. Moreover, we measured vancomycin susceptibility of WT and agr knockout strain. Although the agr knockout strain did not show an increased MIC value, the modified vancomycin PAPs revealed that it did present increased vancomycin resistant subpopulations, which was consistent with previous studies (13–16, 33). Overall, these results demonstrated that agr negatively regulates the promoter activity of vraR and downregulates its expression, which may leading the decreased susceptibility of vancomycin. But there has also been a contrary study (34), in which functional agr in USA100 isolates have a contribution to vancomycin heteroresistance. We detected the transcription levels of vraR in additional 15 agr-functional and agr-dysfunction clinical MRSA strains, and found that not all the agr-dysfunction strains showed the higher vraR transcription levels than agr-functional strains (Fig. S2). We speculate that the differences are probably due to the different genetic backgrounds of strains, and there may be multiple regulatory pathways involved in the interaction between agr and vraSR, the specific mechanism needs to be further explored.

The Agr system can regulate the expression of virulence genes and the formation of biofilms through the effector molecule RNAIII, and AgrA protein can also bind to the promoter of psm to upregulate its production in an RNAIII-independent manner (27). So we expressed and purified the AgrA protein. Through the EMSA experiment, we discovered that the AgrA protein is specifically bound to the promoter region of vraR in the 63-bp probe. The results of EMSA indicated that the observed downregulation of vraR was achieved by the direct binding of AgrA to vraR promoter.

VraSR is confirmed as a vancomycin resistance-associated TCS, and agr is generally known as a global regulator associated with virulence, although previous studies found that agr knockout and agr-dysfunction strains were more likely to develop vancomycin resistance (13–16), and clinical strains with low-level of vancomycin resistance usually exhibited attenuated virulence (8, 22, 35), the exact molecular mechanism for these phenomena remains unknown. Previously, we found that VraR directly bound to the region between P2 and P3 promoter of agr to downregulate its expression, leading to decreased expression levels of the virulence-associated genes (hla, hlb, coa, and others) (36). In this study, we discovered that agr can downregulate vraR through directly binding to the promoter region of vra operon, which may promote the development of vancomycin resistance. The inhibition of agr by VraR partly explains why virulence is often attenuated in low-level vancomycin-resistant strains, and the downregulation of vraSR by AgrA partly explains why clinical S. aureus strains with high virulence often show low-level vancomycin resistance (shown as Fig. 5). S. aureus produces various virulence and immune evasion factors to avoid the host immune response, and the host environment can impart selective pressure selecting for resistance and immune evasion, which may leading to persistent infections (37). It has been reported that agr-dysfunction strains were associated with persistent bacteremia (38, 39), the agr mutants can adapt well to host from colonization to infection (37), and VISA/hVISA strains often lead to prolonged infections (40). Since Agr system and VraSR are both involved in a complex regulatory network, we propose that the expression of them are generally maintained at normal levels, once treated with vancomycin, the upregulation of vraSR leads to the downregulation of agr, which may result in enhanced biofilm formation and evasion from host immune responses, making it challenging to eliminate S. aureus. Meanwhile, vraSR is further upregulated by the inhibited agr, which may promote the development of vancomycin resistance, thus leading to prolonged chronic infections through this mutual regulation. Our findings suggest a potential pathway wherein vraSR impacts virulence, and agr also plays a role in vancomycin resistance, thus providing a critical link between the virulence and vancomycin resistance of S. aureus.

Fig 5.

Schematic view of the mutual regulation of VraSR and Agr. VraR protein, activated under the pressure of vancomycin, directly binds to the region between the P2 and P3 promoters of the agr operon to inhibit its expression, thus decreasing the production of multiple virulence factors. In turn, AgrA protein directly binds to the promoter region of vraSR to downregulate its expression, which may impact the development of vancomycin resistance.

DATA AVAILABILITY

Sequencing data have been deposited in the NCBI database under BioProject accession number PRJNA1049026 and in the Sequence Read Archive (SRA).

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/aac.00893-23.

Supplemental figures and table. aac.00893-23-s0001.docx.

Fig. S1, Fig. S2, and Table S1.

Whole genome sequence of V-D1. aac.00893-23-s0002.txt.

FASTA Nucleic Acid file of V-D1.

Whole genome sequence of V-D2. aac.00893-23-s0003.txt.

FASTA Nucleic Acid file of V-D2.

Whole genome sequence of V-D3. aac.00893-23-s0004.txt.

FASTA Nucleic Acid file of V-D3.

Whole genome sequence of V-D4. aac.00893-23-s0005.txt.

FASTA Nucleic Acid file of V-D4.

Whole genome sequence of D1. aac.00893-23-s0006.txt.

FASTA Nucleic Acid file of D1.

Whole genome sequence of D2. aac.00893-23-s0007.txt.

FASTA Nucleic Acid file of D2.

Whole genome sequence of D3. aac.00893-23-s0008.txt.

FASTA Nucleic Acid file of D3.

Whole genome sequence of D4. aac.00893-23-s0009.txt.

FASTA Nucleic Acid file of D4.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.