Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2005 May;79(10):6459–6471. doi: 10.1128/JVI.79.10.6459-6471.2005

Functional Chimeras of Human Immunodeficiency Virus Type 1 gp120 and Influenza A Virus (H3) Hemagglutinin

K M Copeland 1, A J Elliot 1,, R S Daniels 1,*
PMCID: PMC1091698  PMID: 15858029

Abstract

In an attempt to produce a protein that will allow determination of the native human immunodeficiency virus type 1 (HIV-1) gp120 (Env) structure in its trimeric state, we fused the globular head of gp120 to the stalk region of influenza virus A (X31) hemagglutinin (HA). The chimeric protein (EnvHA) has been expressed by using a recombinant vaccinia virus system, and its functional characteristics were determined. EnvHA is expressed as a 120- to 150-kDa protein that can oligomerize to form dimers and trimers. It retains the low-pH (5.2 to 5.4) requirement of X31-HA to trigger membrane fusion but, unlike X31-HA, it is not absolutely dependent on exogenously added trypsin for protein processing to release the HA2 fusion peptide. In terms of receptor binding the chimeric protein retains specificity for human CD4 but, in relation to the membrane fusion event, it appears to lose the Env coreceptor specificity of the parental HIV-1 strains: NL43 for CXCR4 and JRFL for CCR5. These properties suggest that stable, functional EnvHAs are being produced and that they may be exploited in terms of structural studies. Further, the potential of introducing the envHA genes into influenza viruses, by use of reverse genetics, and their use as a therapeutic vaccine for HIV are discussed.


Attachment and entry of human immunodeficiency virus type 1 (HIV-1) to a host cell is mediated by the envelope (Env) glycoproteins. Env monomers are synthesized as 160-kDa glycoproteins (gp160) in the endoplasmic reticulum, where oligomerization takes place, with trimers being the predominant form (24). The gp160 precursor is transported to the Golgi, where it is proteolytically processed by furin into gp120 and gp41 subunits, which are held together noncovalently (24, 34, 69). The processed Env glycoproteins are then presented on the surface of the infected cell and subsequently, through budding, form the envelopes of progeny virions (69).

HIV-1 attachment to target cells is mediated by the binding of gp120 to CD4, the primary HIV-1 receptor (20). This binding exposes a site on gp120 that enables interactions with secondary coreceptors and further conformational changes (39). Thiol/disulfide exchange mediated by protein disulfide isomerase is involved in these conformational changes (2, 42). The two major HIV-1 coreceptors are the chemokine receptors CCR5 and CXCR4; CCR5 is generally considered to be the coreceptor utilized by HIV-1 virions in early, asymptomatic stages of infection, whereas viruses utilizing CXCR4 usually emerge during late stages of disease (5, 54). Binding of gp120 to the appropriate coreceptor triggers a conformational change in gp41 (15, 66). gp41 contains a short N-terminal hydrophobic sequence of amino acids, the fusion peptide, which mediates fusion of viral and host cell membranes, enabling entry of the virus into the host cell (26, 27). The conformational change in gp41, induced by the gp120-coreceptor interaction is necessary in order for this fusion to take place (15, 66).

It is generally accepted that knowledge of the structures of HIV glycoproteins will yield insights into the functions of the proteins, which will assist vaccine and drug development. However, despite intensive effort in a number of laboratories, the current understanding of attachment and fusion mechanisms of HIV-1 Env is incomplete. The structural information available for HIV glycoproteins is relatively poor and relates to severely truncated forms of monomeric gp120 (38, 39) and trimeric extracellular/extraviral domains of gp41 (12, 66), both of which may represent postfusion states. The relative lack of success probably relates to the highly glycosylated states of the HIV glycoproteins (many of the added oligosaccharides play a role in determining the correct folding of the protein) and the glycoproteins' inherent instability, which can result in extensive dissociation of gp120 from HIV-1 virus and virus-infected cells (41, 47, 52, 73). The former problem can be overcome by using glycosidases to remove oligosaccharides after glycoprotein synthesis (38, 39), and domains from other proteins have been introduced in attempts to improve stability (71, 72).

The influenza virus hemagglutinin (HA) is also a trimeric membrane glycoprotein with receptor-binding and membrane fusion functions (70). After initial attachment to the host target cell, via sialic acid-containing receptors, and internalization by host-mediated endocytosis, HA mediates fusion between the viral and endosomal membranes, allowing the release of ribonucleoprotein into the infected cell (40, 43). HA is initially synthesized as a trimeric precursor (HA0) containing three identical protein chains, each of which is proteolytically processed into two subunits, HA1 and HA2, that are held together covalently by a single disulfide bond (36, 68). The HA1 subunit forms a globular head and contains the receptor-binding sites and the majority of antigenic sites, whereas HA2 anchors the structure to the membrane, provides stability to the trimeric structure and contains an N-terminal fusion peptide that has a region of homology with the gp41 fusion peptide (15, 66). However, while HIV-1 Env-induced membrane fusion occurs at neutral pH, influenza virus HA has to be subjected to acidic conditions to trigger the conformational change that allows fusion of neighboring membranes (11, 46).

Since the initial crystallization of influenza virus HA (70), its structure and function have been extensively studied and well characterized (28, 31, 45, 55, 63-65). Two features of HA structure are of interest to us: (i) the expression of stable trimeric HA at the cell surface mediated by the HA2 region and (ii) the presence of a protease-sensitive site in HA2, adjacent to the transmembrane region, which enables efficient solubilization of the protein for structural studies (18, 56). Hence, we hypothesized that a chimeric protein composed of the HIV-1 Env gp120 globular head attached to the influenza virus HA1/HA2 stalk region could be expressed at cell surfaces and that the gp120 component would be held in a stable trimeric form by the HA-derived components. Such stability combined with the protease-sensitive site in HA2 should permit solubilization of the protein for subsequent purification and structural studies. By releasing the whole EnvHA protein, we hope to obtain information on the gp120 component in a trimeric state that is likely to resemble its structure on viruses and the surface of HIV-infected cells. Such structural information is currently unavailable and may well shed light on why gp120 monomers, for which structures of only severely truncated forms are available, are not good immunogens from a vaccine point of view. In addition, we would gain information on how the structure of the stalk region of HA may be altered to allow accommodation of a much larger head group.

The aim of the present study was to express the intact globular head of gp120 in a stable trimeric state that could be purified for structural studies. Here we report the construction and expression of chimeric HIV-1 Env-influenza virus HA proteins (EnvHAs) and show that these proteins retain certain antigenic, structural, and functional properties associated with the respective wild-type (wt) parent proteins.

MATERIALS AND METHODS

Design of EnvHA chimeric proteins.

Based on the known structure of the HA of influenza virus X31 (70) and the disulfide-bonding pattern and structure of HIV-1 gp120 (39, 41), a chimeric protein (EnvHA) that contained the entire stalk region of HA (the N and C termini of HA1 and the whole of HA2) and the globular head of gp120 was designed (Fig. 1). If folded correctly, the designed construct should maintain disulfide bonds between positions 68 and 293 of HA1, the eight in the globular head of gp120, that between residues 30 of HA1 and 153 of HA2, and that between residues 160 and 164 in HA2. Such a structure might be expected to possess much of the stability and therefore the membrane fusion characteristics of native HA and the receptor-binding properties of HIV-1 Env.

FIG. 1.

FIG. 1.

Schematic representation of the assembly of the EnvHA chimeric protein. (A) The influenza virus X31 (H3) HA, mRNA sense, with 5′ and 3′ noncoding regions is shown, as is the disulfide-bonded structure of the encoded HA in the processed form. HA1/HA2 subunits are covalently linked by a single disulfide bond between residue 30 of HA1 and residue 153 of HA2. The positions of the signal peptide (solid black area), fusion peptide (dark gray shading), and membrane anchor (light gray shading) are shown (residue numbering includes the signal peptide and fusion peptides in HA1 and HA2, respectively), as is the bromelain (Br) cleavage site in HA2. (B) The HIV-1 Env is presented in the processed form of gp120/gp41 with its disulfide-bonding pattern. The two subunits are held together noncovalently. All numbering refers to the pNL43 Env sequence (1) and the positions of the signal peptide (dark gray shading), fusion peptide (light gray shading), and membrane anchor (open areas) are shown. (C) The theoretical structure of EnvHA is shown with the Env- and HA-derived domains indicated. Dotted lines represent the sites where linkers (GGGS) are positioned in respective EnvHA constructs (Tables 1 and 2). Note the retention of the HA1 68-293 and HA1/HA2 30-153 disulfide bonds, which are expected to bring stability to the EnvHA construct. There is an N-to-H substitution between NL43 and JRFL at position 92.

Construction of envHA genes.

To construct the envHA genes, a clone of wt X31-HA was obtained (59) and the env genes of HIV-1 strains pNL43 (1) and JRFL (37) were rescued by PCR off proviral DNA, cloned, and sequenced as described previously (51). pNL43 and JRFL were chosen since they are well-characterized strains that use CXCR4 and CCR5 chemokine coreceptors, respectively (22). The required fragments of each gene were generated by using PCR with native Pfu polymerase (Stratagene) and a panel of oligonucleotide primers (Table 1). The fragments were purified from 1.5% (<1-kb) and 0.5% (>1-kb) agarose gels by using 45-μm-pore-size filter units (UFC30HVNB; Millipore) according to the manufacturer's instructions, and the three required fragments were joined together by using PCR-splice overlap extension (PCR-SOE) with Pfu polymerase and the primers X31HAFU and X31HARU. All PCRs were performed on a PTC-100 cycler (MJ Research, Inc.) using 25 cycles of 96°C for 2 min, 50°C for 1.5 min, and 72°C for 10 min (for products up to 1,300 bp) or 20 min (for final products of 2,360 to 2,600 bp). The envHA genes were ligated into the vaccinia virus shuttle vector pRB21 by using PstI and HindIII restriction sites, the resultant ligations were used to transform DH5α E. coli, and ensuing clones were sequenced prior to being used in the production of recombinant vaccinia (Copenhagen strain) viruses (7, 59). A number of constructs were made with or without linker sequences (GGGS) at the HA1/gp120 junctions to allow a degree of flexibility such that the gp120 globular head might be more easily accommodated on the HA stalk to allow trimer formation (Table 2). As controls, recombinant vaccinia viruses allowing expression of X31-HA, rescued with primers X31HAFU and X31HARU and HIV-1 NL43 and JRFL Envs, rescued with primers FgpV and RgpV (Table 1), were generated.

TABLE 1.

Oligonucleotide primers used in the construction of HA, envHA, and env genesa

Primer Sequence Positionb Sizec (bp) Commentd
X31HAFU AGTACCTGCAGAGCAAAAGCAGGGGATAATTC 11/1-21 HA PstI
X31Rint CATGTTAAAATKTTCTGTYACGCATATTTTCCCCGTTGAGGA HA 233-213/21 ENV 265
X31RintL CATGTTAAAATKTTCTGTYACAGATCCACCTCCGCATATTTTCCCCGTTGAGGA HA 233-213/12/21 ENV 277 Linker = GGGS
ENVFOR TCCTCAACGGGGAAAATATGCGTRACAGAAMATTTTAACATG HA 21/262-282 ENV J
HA 21/265-285 ENV N
ENVFORL TCCTCAACGGGGAAAATATGCGGAGGTGGATCTGTRACAGAAMATTTTAACATG HA 21/12/262-282 ENV J Linker = GGGS
HA 21/12/265-285 ENV N
ENVREV AGTGATGCATTCAGAAATACATGCTACTCCTAATGGTTCAAT ENV J 1464-1444/21 HA 1,245
ENV N 1485-1465/21 HA 1,263
ENVREVL AGTGATGCATTCAGAAATACAAGATCCACCTCCTGCTACTCCTAATGGTTCAAT ENV J 1464-1444/12/21 HA 1,269 Linker = GGGS
ENV N 1485-1465/12/21 HA 1,287
X31Fint ATTGAACCATTAGGAGTAGCATGTATTTCTGAATGCATCACT ENV 21/906-926 HA 892
X31FintL ATTGAACCATTAGGAGTAGCAGGAGGTGGATCTTGTATTTCTGAATGCATCACT ENV 21/12/906-926 HA 904 Linker = GGGS
X31HARU GAGTCAAGCTTAGTAGAAACAAGGGTGTTTT 11/1765-1746 HA HindIII
FgpVe TAAGAGGAATTCCAGAAGAYAGTGGCAATGARAGYGA Start codon italicized EcoRI
RgpVe ACCACACCATGGTTTGACCAYTTGCCACCCATBTTA Stop codon italicized ∼2,600 NcoI
a

Segments of the X31 HA gene and the env genes of HIV-1 isolates JRFL (J) and NL43 (N) were amplified and joined together by PCR-SOE. All primers were synthesized by Eurogentec Oswel.

b

The positions of hybridizing sequence in the entire X31 HA gene and the coding sequence of the env genes are given.

c

The sizes of first-round PCR products generated off the X31 HA and HIV-1 env genes are indicated.

d

The positions of restriction sites used for cloning into pRB21 are underlined in the primer sequences, as are the nucleotides encoding the linker sequences at the HA/env junctions.

e

These two primers were used to rescue intact env genes of JRFL and NL43.

TABLE 2.

Composition of EnvHA chimeric proteins

EnvHA constructa Parental HIV-1 strainb GGGS linkerc
HA1/Env Env/HA1
R3 NL43
S4 JRFL
T2 NL43 +
U4 JRFL +
V3 NL43 +
W2 JRFL +
X2 NL43 + +
Y1 JRFL + +
a

Eight EnvHA constructs were generated (R-Y), and the clones indicated were used in subsequent experiments.

b

Two HIV-1 strains, pNL43 (1) and JRFL (37), were used to supply the gp120 components.

c

Short peptide linkers (GGGS) were incorporated at HA1/Env and Env/HA1 junctions as indicated (see Fig. 1). +, Incorporated; −, not incorporated.

env, HA, and envHA gene expression.

Recombinant vaccinia viruses were plaque purified twice in CV-1 cells before use in experiments (59). To assess the expression of wt and chimeric proteins, CV-1 cells infected with recombinant vaccinia virus at a multiplicity of infection (MOI) of 1 and, 16 h postinfection, the cell medium was removed and the cells were resuspended in 1 ml of phosphate-buffered saline (PBS) and then centrifuged (6,000 rpm for 30 s). Cell pellets were lysed with 120 μl of sodium dodecyl sulfate (SDS) loading buffer (2% SDS, 62.5 mM Tris [pH 6.8], 5% β-mercaptoethanol, 0.1% bromophenol blue) and separated by SDS-polyacrylamide gel electrophoresis (PAGE). Western blotting was performed by using a 1:5,000 dilution of anti-Env sheep polyclonal serum (ARP401; UK Centralized Facility for AIDS Reagents [CFAR]), and a 1:1,000 dilution of anti-X31-HA rabbit polyclonal serum (supplied by D. A. Steinhauer [59]), with horseradish peroxidase (HRP)-labeled donkey anti-sheep (1:5,000 dilution; Sigma) and HRP-labeled protein A (1:2,000 dilution; Amersham Biosciences) secondary antibodies, respectively. To allow specific detection of gp120-containing proteins, a murine anti-V3 monoclonal antibody (EVA3012; CFAR) was used at 1:50 dilution with a 1:2,000 dilution of HRP-labeled goat anti-mouse (Promega). HA2 was detected with a rabbit polyclonal serum (R185, diluted 1:200; supplied by S. A. Wharton) raised against a HA2-derived peptide (115-125 [MNKLFEKTRRQ]) with HRP-labeled protein A as a secondary antibody. Blots were developed by using enhanced chemiluminescence (Amersham Biosciences).

Surface expression of EnvHA proteins.

CV-1 cells were grown on 13-mm glass coverslips in 24-well tissue culture plates. Cells were infected with recombinant vaccinia virus at an MOI of 1 for 16 h and fixed with 4% (wt/vol) paraformaldehyde in PBS. Surface expressed EnvHA proteins were detected by using HIV-1 strain-specific anti-Env and anti-HA antibodies. A 1:20 dilution of the monoclonal antibody EVA3012 (CFAR) was used to probe NL43-based constructs, with a fluorescein-linked sheep anti-mouse secondary antibody (1:200 dilution; Amersham Biosciences). A polyclonal rabbit serum EVA435 (1:100 dilution; CFAR) and a 1:200-diluted fluorescein-linked donkey anti-rabbit secondary antibody (Amersham Biosciences) were used to probe JRFL-based constructs. In order to detect intracellular EnvHA, cells were permeabilized prior to immunofluorescence staining by treating them with PBS-2% (vol/vol) Triton X-100 for 30 min at room temperature. Cells were counterstained with DAPI (4′,6′-diamidino-2-phenylindole) for 1 min at room temperature to visualize nuclei. Coverslips were mounted on glass slides and analyzed on a Nikon Labophot-2 fluorescence microscope.

Trypsin susceptibility of EnvHA.

To estimate the trypsin cleavability of expressed EnvHA proteins, CV-1 cells were infected with recombinant vaccinia virus at an MOI of 1. At 16 h postinfection, cells were washed with Dulbecco modified Eagle medium (DMEM; Invitrogen) and then incubated with a range of concentrations (0, 2.5, 5, 10, and 20 μg/ml) of TPCK-treated trypsin (Sigma) for 10 min at 37°C. Cells were then incubated with equivalent concentrations of trypsin inhibitor (0, 2.5, 5, 10, and 20 μg/ml; Sigma) for 10 min at 37°C and washed with PBS, and cell lysates were prepared. Lysates were analyzed by SDS-PAGE and Western blotting as described above. The oligomeric form of the EnvHA chimeric proteins was analyzed with recombinant vaccinia virus-infected CV-1 cell lysates prepared in the absence of β-mercaptoethanol, separated by SDS-PAGE, and probed by Western blot.

Preparation of plasma membranes.

CV-1 cells were grown in triple flasks (culture area of 500 cm2) and infected with recombinant vaccinia viruses, 15 flasks per recombinant, at an MOI of 1. At 72 h postinfection, when a 100% cytopathic effect was observed, the cells were harvested by centrifugation at 3,000 rpm and 4°C for 15 min in a Beckman JH-6C centrifuge. Cell pellets were washed with 30 ml of PBS and recentrifuged at 3,000 rpm and 4°C for 15 min in a Beckman GS-6R centrifuge. Final pellets were resuspended in 30 ml of 10 mM Tris-HCl (pH 6.8) containing 5 mM MgCl2 and incubated on ice for 60 min,; cells were then disrupted by Dounce homogenization (40 passes with plunger B). Samples were centrifuged at 3,000 rpm and 4°C for 15 min in a Beckman GS-6R centrifuge, and the supernatants were retained. The supernatant samples were adjusted to a final concentration of 70% (wt/vol) sucrose, divided between two SW28 ultracentrifuge tubes, and overlaid with 11 ml each of 50 and 35% (wt/vol; made up in 10 mM Tris-HCl [pH 6.8]) sucrose and 2 ml of 10 mM Tris-HCl (pH 6.8). After centrifugation at 28,000 rpm and 4°C for 2 h, the plasma membrane containing interfaces between the Tris-HCl and 35% sucrose layers were collected, diluted with 10 mM Tris-HCl (pH 6.8), and recentrifuged at 28,000 rpm and 4°C for 2 h. Pellets were resuspended in 1 ml of 10 mM Tris-HCl (pH 6.8), and the protein content was determined by using the Bradford test (9). Membranes were analyzed by SDS-PAGE and Western blotting as described above.

Membrane fusion assays.

Membrane fusion assays were performed according to a method modified from one described previously (60). Briefly, Ghost cells constitutively expressing either the CD4 receptor (g-parental), CD4 and CCR5 coreceptor (g-R5), or CD4 and CXCR4 coreceptor (g-X4) (14) were infected at an MOI of 1 with recombinant vaccinia virus. At 16 h postinfection, cells were washed with DMEM and incubated with 5 μg of TPCK-treated trypsin/ml for 5 min at 37°C. Cells were then washed and treated for 30 s with cell buffers (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2) that had been adjusted to particular pHs (6.0 to 5.0 in 0.2 steps) with citrate, as specified in Results, after which the pH was returned to neutral. Cells were incubated in DMEM with 5% fetal calf serum for 1 h at 37°C, and the formation of heterokaryons and syncytia was observed by using light microscopy. Heterokaryons and syncytia were fixed with PBS-0.25% (vol/vol) glutaraldehyde, stained with 1% (wt/vol) toluidine blue (Sigma), and photographed by using a Nikon Diaphot phase-contrast microscope and an F-301 camera.

RESULTS

Generation of envHA chimeric genes. All primary PCRs and the subsequent SOE reactions with three templates and primers X31HAFU and X31HARU worked efficiently to yield products of the expected sizes (results not shown). After insertion of the PCR-SOE products and the rescued genes for X31-HA, NL43-env, and JRFL-env into the vector pRB21 and transformation of DH5α E. coli, individual clones were picked and the plasmids sequenced to ensure selection of cloned genes (Table 2) that matched the sequences of the parental genes (accession numbers J02090, M19921, and U63632, respectively).

Expression of chimeric proteins in CV-1 cells.

Chimeric EnvHA proteins were expressed in CV-1 cells and lysates probed by using anti-Env and anti-HA polyclonal sera. Immunoblotting demonstrated the presence of two protein bands for EnvHA chimeric proteins R3 to Y1 (Fig. 2). The larger, running as a band in the range of 120 to 150 kDa and detectable by both anti-Env and anti-HA antibodies, corresponded to the estimated sizes of the EnvHA proteins and was similar to that of wt Envs detected with anti-Env antibodies. The smaller band, representing a protein of ca. 28 kDa was detected only when lysates were probed with anti-HA serum. As expected, the latter serum did not detect wt Envs.

FIG. 2.

FIG. 2.

Expression of EnvHA proteins. Cell lysates were prepared from recombinant vaccinia virus-infected CV-1 cells expressing the proteins indicated and separated by SDS-PAGE under reducing conditions. Lysates were probed by using anti-Env sheep polyclonal serum (ARP401) (A) and anti-HA rabbit polyclonal serum (X31) (B). Neither serum reacted with lysates from parental vaccinia virus (vRB12)-infected and from uninfected (NEG) cells. The locations of specific glycoprotein species are indicated.

To determine the oligomeric form of the EnvHA proteins expressed in infected cells, lysates were prepared in the absence of β-mercaptoethanol to maintain the native protein structure, and separated by SDS-PAGE. Probing with anti-Env polyclonal serum demonstrated the presence of the major 120- to 150-kDa EnvHA monomer and also revealed the presence of two higher-molecular-weight bands (Fig. 3). These bands corresponded to the predicted sizes of dimeric and trimeric forms of the EnvHA protein (ca. 300 and 450 kDa, respectively), suggesting that a proportion of the EnvHA proteins were expressed in a trimeric form as for wt parental Env and HA.

FIG. 3.

FIG. 3.

Oligomeric forms of EnvHA expressed in CV-1 cells. Cell lysates were prepared in the absence of β-mercaptoethanol, separated by SDS-PAGE, and probed with anti-Env (ARP401) and anti-HA polyclonal sera. The results for EnvHA constructs (R3 and Y1), wt Env (JRFL and NL43), and HA (X31) are shown. With both sera, monomeric EnvHA can be seen to run at ca. 150 kDa, and two higher-molecular-mass bands corresponding to dimeric and trimeric forms are observed. Similar forms are observed for Env and HA with their respective antisera.

Cell surface expression of EnvHA chimeric proteins.

Immunofluorescence staining with product-specific antibodies was used to assess expression on the surface of recombinant vaccinia virus-infected cells. Strain-specific anti-Env antibodies, raised against either NL43 or JRFL Env proteins, showed good specificity for the parental wt Env proteins and detected EnvHA constructs based on the respective Env strains (Fig. 4A). Although results are shown for EnvHA constructs R3 and Y1, it was possible to detect all EnvHA constructs. Similarly, the wt HA control was detected on the cell surface by using the anti-HA antibody (Fig. 4A). Cells were permeabilized to enable staining of intracellular EnvHA protein (Fig. 4B). A comparison between nonpermeabilized and permeabilized cells confirmed that the staining pattern observed in nonpermeabilized cells was indicative of EnvHA surface expression.

FIG. 4.

FIG. 4.

Detection of EnvHA cell surface expression by immunofluorescence. (A) CV-1 cells infected with recombinant vaccinia viruses were probed with anti-JRFL, anti-NL43, and anti-HA antibodiesto detect surface expression of EnvHA protein. Immunofluorescence results for EnvHA constructs R3 (X4 tropic) and Y1 (R5 tropic), wt controls (NL43, JRFL, and X31), vaccinia virus-infected (vRB12)- and uninfected (NEG) cells are shown. All eight EnvHA constructs were detected at the cell surface. (B) CV-1 cells infected with recombinant vaccinia viruses expressing EnvHA constructs (R3 and Y1) and HA (X31) were treated with PBS-2% (vol/vol) Triton X-100 to permeabilize cell membranes and then probed with anti-HA antibody to visualize intracellular staining of the expressed proteins.

Trypsin susceptibility of EnvHA.

Influenza HA is susceptible to trypsin, cleaving the precursor HA0 into two subunits: HA1 and HA2. Such cleavage is essential for virus infectivity (36). Cells expressing EnvHA proteins were exposed to trypsin, and cell lysates were probed to assess the susceptibility of EnvHAs. When probed with an anti-gp120 monoclonal antibody, neither EnvHA (R3) nor wt NL43 gp160 appeared to be particularly sensitive to trypsin (Fig. 5A), possibly reflecting the relatively low proportions of total EnvHA and gp160 present on the cell surface. However, on probing with anti-HA polyclonal serum detection of EnvHA decreased in line with increasing trypsin concentration, and there was some indication of an increase in intensity of the 28-kDa band. X31-HA0 was efficiently processed to HA1/HA2 at all concentrations used, although significant amounts of HA0 remained in all samples, presumably representing intracellular protein that had not been accessible to trypsin (Fig. 5B). These results suggested that the 28-kDa band seen in lysates containing EnvHA (Fig. 2B and 5B) corresponded to the HA2 subunit of wt HA and indicated that, unlike for HA0, there is a certain level of processing in CV-1 cells of the trypsin-susceptible cleavage site situated between the gp120/HA1 and HA2 domains of the EnvHA constructs (Fig. 1). By probing Western blots with a rabbit serum raised against a HA2-specific peptide, the identity of the 28-kDa protein as HA2 was confirmed and levels shown to increase after exposure of EnvHA and HA to trypsin (Fig. 6). Overall, these results show that the EnvHA proteins can be processed to yield HA2 but they are less susceptible to or dependent on trypsin processing than the wt HA.

FIG. 5.

FIG. 5.

Effect of trypsin on EnvHA (R3), wt NL43 Env, and HA (X31) proteins. CV-1 cells expressing the proteins indicated (R3, NL43, and X31) were incubated with increasing concentrations of trypsin at 37°C for 30 min. Cell lysates were prepared and separated by SDS-PAGE under reducing conditions and then probed with anti-Env monoclonal antibody (EVA3012) to detect wt EnvHA (120 to 150 kDa) and gp160 (note that these gels showed no products below the 64-kDa marker) (A) and anti-HA polyclonal serum (X31) to detect EnvHA, HA0, HA1, and HA2 (B). ✽, The TPCK-trypsin concentration used is indicated in μg/ml.

FIG. 6.

FIG. 6.

Identification of the 28-kDa protein as HA2. CV-1 cells expressing the proteins indicated (R3, Y1, and X31) were incubated in the absence (−) or presence (+) of 5 μg of trypsin/ml at 37°C for 30 min. Cell lysates were prepared and separated by SDS-PAGE under reducing conditions. Lysates were probed with R185 polyclonal serum to detect HA2. Cross-reactive bands were present in parental vaccinia virus (vRB12)-infected and uninfected (NEG) cells, but HA2 was absent.

Characterization of EnvHA at the cell surface.

Plasma membranes were prepared from CV-1 cells that had been infected with vaccinia virus recombinants expressing either R3-EnvHA or X31-HA. These preparations were subjected to SDS-PAGE and Western blotting with a variety of antibodies (Fig. 7). The anti-Env polyclonal serum (i.e., ARP401) and monoclonal antibody (i.e., 3012) were specific for the R3-EnvHA and, under reducing conditions, the major bands detected corresponded to the molecular mass range of 120 to 150 kDa predicted for monomers, whether or not trypsin treatment had taken place (Fig. 7Ai and Aii). Under nonreducing conditions the predominant species identified corresponded to trimers of EnvHA (Fig. 7Bi and Bii), as was the case when blots were probed with R185 (anti-HA2 peptide) and anti-X31-HA sera (Fig. 7Biii and Biv). In contrast, both R185 and anti-X31-HA rabbit sera detected a predominance of HA monomer in the membrane preparations, although dimer and trimer bands were observed. Under reducing conditions the anti-X31-HA serum detected bands corresponding to HA0, HA1, and HA2, even in the absence of trypsin treatment, and for EnvHA bands corresponding to monomer and HA2 were observed (Fig. 7Biv). Probing with R185 serum gave a clearer indication of trypsin treatment having worked since for the X31-HA sample, the HA0 band was significantly decreased and the HA2 band increased in intensities and, as expected, HA1 was not detected (Fig.7Biii). However, probing of the R3-EnvHA sample with R185 under reducing conditions resulted in the detection of HA2 bands only. The latter result was unexpected since EnvHA0 should contain the epitope recognized by R185 and the anti-X31-HA serum had detected a species approximating monomeric EnvHA.

FIG. 7.

FIG. 7.

Western blotting of CV-1 cell-derived plasma membranes. The protein concentrations of membrane preparations from CV-1 cells infected with vaccinia virus recombinants expressing EnvHA (R3) and HA (X31) were determined by using the Bradford test (9). The equivalent of 42 μg of protein for each preparation was made up to a final volume of 190 μl with 10 mM Tris-HCl (pH 6.8) and then incubated in the absence (−) or presence (+) of 2.5 μg of TPCK-trypsin/ml (5 μl of stock solution) for 10 min at room temperature. Reactions were then terminated by adding 5 μl of trypsin inhibitor (stock concentration of 0.1 mg/ml), divided in two, and 25 μl of the required SDS loading buffer (with or without β-mercaptoethanol) was added. Then, 10-μl aliquots, equivalent to 1.68 μg of protein, were separated by SDS-PAGE and probed by Western blotting as indicated. Blots were developed by using enhanced chemiluminescence and exposed for 5 s (i), 5 s (ii), 5 min (iii), or 5 min (iv) (A) or for 5 s (i), 5 s (ii), 10 s (iii), or 5 s (iv) (B). Long exposures in Aiii and iv were used since EnvHA monomers should not contain HA2 if full processing at the gp120HA1/HA2 site had occurred and EnvHA contains only short segments of the N and C termini of HA1, which are likely to be detected by a minority of antibodies present in the anti-X31-HA serum.

EnvHA-mediated cell membrane fusion.

To investigate whether the EnvHA proteins retained the fusogenic function of the influenza virus HA, a series of membrane fusion assays were performed. Recombinant vaccinia virus-infected cells expressing EnvHA, wt Env, and wt HA proteins were either left untreated or treated with trypsin and then either maintained at neutral pH or exposed to cell buffer adjusted to pH 5 to trigger the conformational changes required by wt HA to permit membrane fusion (59). Examples of Ghost cell fusion seen after trypsin and low-pH treatments are shown (Fig. 8). The wt Env and HA proteins produced different patterns of fusion: large syncytia were formed by wt Envs, and heterokaryons were formed by wt HA. The pattern of fused cells produced by the EnvHA proteins resembled that of the wt HA, and each EnvHA construct was able to initiate fusion in all of the Ghost cell lines, indicating that the coreceptor specificity associated with wt Env had been lost (Fig. 8 and Table 3). The results confirmed that wt HA was dependent on low pH and required trypsin treatment, whereas wt Env fused membranes at both low and neutral pH and was trypsin independent (Table 3) (11, 46). Further, whereas wt HA could fuse all cell types used, including baby hamster kidney (BHK) cells, which do not express either CD4 or chemokine coreceptors, wt Envs maintained their coreceptor specificities with JRFL fusing Ghost cells expressing CCR5 only while NL43 preferentially fused cells expressing CXCR4, although there was some fusion observed on the other Ghost cell lines. The latter observation is probably related to the parental and CCR5-expressing Ghost cell lines, with both having low-level endogenous expression of CXCR4.

FIG. 8.

FIG. 8.

Assay of membrane fusion under conditions optimal for X31-HA. Ghost cell lines and BHK were infected with recombinant vaccinia viruses to express the proteins indicated (R3, Y1, JRFL, NL43, and X31) for 16 h and then treated with 5 μg of trypsin/ml and briefly exposed to low- pH cell buffer (pH 5). Membrane fusion was then monitored as described in Materials and Methods. Uninfected cell lines (NEG) and those infected with wt vaccinia virus (vRB12) were treated similarly. Membrane fusion is not observed in NEG and vRB12 cultures, heterokaryon formation is seen in all wt HA (X31) expressing cultures, syncytia are observed in the three Env-NL43 (X4-tropic)-expressing Ghost cell cultures and the Env-JRFL (R5-tropic)/Ghost-R5 culture, whereas all Ghost cell cultures expressing EnvHA (R3 and Y1) show heterokaryon formation. Similar heterokaryon formation was observed with all eight EnvHA constructs (results not shown). ✽, For wt Envs the photographs shown were taken prior to pH 5 treatment since the treatment caused fused cells to detach from the 24-well plates.

TABLE 3.

Membrane fusion mediated by EnvHA proteinsa

Construct Fusion without trypsin at:
Fusion with trypsin at:
pH 7 pH 5 pH 7 pH 5
R3 ND X4, R5, P ND X4, R5, P
S4 ND X4, R5, P ND X4, R5, P
T2 ND X4, R5, P ND X4, R5, P
U4 ND X4, R5, P ND X4, R5, P
V3 ND X4, R5, P ND X4, R5, P
W2 ND X4, R5, P ND X4, R5, P
X2 ND X4, R5, P ND X4, R5, P
Y1 ND X4, R5, P ND X4, R5, P
JRFL R5 R5 R5 R5
NL43 X4, R5, P X4, R5, P X4, R5, P X4, R5, P
X31 ND ND ND X4, R5, P, B
vRB12 ND ND ND ND
NEG ND ND ND ND
a

Cells susceptible to fusion mediated by wt Env and/or wt HA (BHK [B], parental Ghost cells [P], and those producing either CXCR4 [X4] or CCR5 [R5]) were infected with recombinant vaccinia viruses to express the constructs indicated. After 16 h of incubation, cells were either left untreated (−) or treated (+) with 5 μg of trypsin/ml and then either maintained at neutral pH (pH 7) or exposed briefly to low-pH cell buffer (pH 5). Membrane fusion was then monitored as described in Materials and Methods and scored as no fusion detected (ND) or fusion detected in specific cell lines at high (roman type) and low (italics) levels.

In contrast, EnvHA proteins displayed a mix of the properties of their parental proteins. All were able to mediate fusion after low-pH treatment only, but the fusion was independent of trypsin treatment, although the level of fusion was increased when trypsin treatment was applied prior to exposure to low pH (Table 3). Thus, it appears that the background levels of EnvHA processing seen in previous results (Fig. 2 and 5 to 7) enable low levels of membrane fusion to occur in the absence of trypsin.

To assess more precisely the pH at which heterokaryon formation occurs with EnvHA, recombinant vaccinia viruses containing X31-HA and all eight EnvHA constructs were used to infect the three Ghost cell lines, and 16 h later they were subjected to pH treatment in 0.2-U steps covering the range 6.0 to 5.0. On leaving the cells for 1 h after each pH treatment, it was observed that whereas X31-HA yielded 80 to 100% heterokaryon formation at pH 5.0 to 5.2, all EnvHA constructs did so at pH 5.2 to 5.4 (results not shown). This 0.2 pH unit differential was conserved when cells were left for 4 h, at which time X31-HA was active at pH 5.6 and EnvHA constructs were active at pH 5.8.

DISCUSSION

The generation of viruses bearing chimeric proteins is not a novel concept; however, many of these proteins do not retain the structural and functional properties of the donor proteins (4, 35). We generated chimeric glycoproteins that grafted the globular head of the HIV-1 envelope protein (gp120) onto the HA1/HA2 stalk of the influenza virus HA protein. Using a recombinant vaccinia virus expression system, we were able to demonstrate the expression of these chimeric proteins in mammalian cells and their presence on cell surfaces. Due to the overall relative structural homology between Env and HA proteins, i.e., both are type I membrane proteins and form trimers on their respective virus particles, we predicted that chimeric proteins would be expressed but were unsure as to the structural and functional capabilities of the resultant EnvHA protein chimeras. However, the chimeras were designed to allow maintenance of important disulfide bonds in the HA and gp120 components, and short peptide linkers were incorporated at HA1/gp120 boundaries to give a degree of flexibility in these regions that might enhance the likelihood of correct protein folding to produce functional proteins (Fig. 1).

In order to use the EnvHA protein for structural studies of gp120, surface expression is essential since it infers correct protein folding and can assist protein purification. Initial experiments involving the infection of mammalian cells with recombinant vaccinia viruses produced proteins of the size predicted for EnvHA chimeras, although it was not possible to distinguish EnvHA0 (∼150 kDa) from EnvHA1 (∼120 kDa), probably due to the heterogeneity of the carbohydrates present at the large number of N-linked glycosylation sequons (NXS/T) on the gp120 component. The antigenic characteristics of the Env and HA subunits appeared to have been retained since we were able to utilize anti-Env and anti-HA antibodies for the detection of EnvHA, a portion of which was trimeric, in cell lysates and at the cell surface (Fig. 2 to 7).

Processing of influenza virus HA0 at an arginine residue (position 345 in X31 HA0) by trypsin-like proteases is essential for virus infectivity and the generation of the short hydrophobic N terminus of HA2, the fusion peptide (36, 56). This residue is then removed, leaving the adjacent glycine as the N terminus of the fusion peptide. Proteases that cleave the HA1/HA2 processing site by removing the N terminus glycine, e.g., bromelain and thermolysin, yield noninfectious viruses that cannot undergo fusion (29, 59). In agreement with others, in the absence of trypsin wt HA was present as the HA0 precursor, and it was processed into HA1 and HA2 by the protease (Fig. 5B) (59). The HA2 component was 28 kDa and corresponded to a protein seen in EnvHA expressing cell lysates in the absence of trypsin (Fig. 2B), although the intensity of this band increased in the presence of trypsin (Fig. 5B). The identity of this band was confirmed as HA2 by probing EnvHA-containing lysates with a rabbit polyclonal serum raised against a peptide corresponding to residues 115 to 125 of X31-HA2 (Fig. 6). This suggested that low-level processing of the EnvHA protein was occurring during protein synthesis. It is likely that by substituting gp120 for the HA1 globular head, certain structural changes will have taken place in the remaining HA1/HA2 stalk for the two domains to be compatible. In wt H3 (X31) HA, the HA used in the course of experiments reported here, the trypsin cleavage site forms a discrete loop that protrudes from the HA0 structure (16). It is possible that this loop has adopted a novel conformation in EnvHA, extending further out from the EnvHA0 structure, thereby being more accessible to host cell proteolytic enzymes. Certain highly pathogenic avian influenza viruses have an insertion of a series of basic amino acids adjacent to the trypsin cleavage site, thereby increasing the relative size of the “cleavage loop” (8, 61). The HAs of these viruses can be cleaved by enzymes other than those residing within the tissues of the respiratory and alimentary tracts, allowing such viruses to infect other organs within the host and resulting in serious systemic disease.

After processing of HA0 into HA1/HA2, low-pH treatment is required to induce conformational changes in HA that allow extrusion of the fusion peptide and membrane fusion to occur (57). Due to the HA1/HA2 stalk region having to accommodate a globular head approximately twice the size in EnvHA proteins (Fig. 1), structural limitations might have been imposed upon it. However, all EnvHA constructs were able to induce membrane fusion of Ghost cells expressing human CD4 after low-pH treatment whether or not they had been treated with trypsin (Table 3). This indicates that a portion of the EnvHA had been correctly processed in the host cells, whereas the increased levels of fusion seen after trypsin treatment indicates that some of the surface expressed EnvHA is in an unprocessed state and that trypsin treatment does not completely degrade the protein. These membrane fusion data support the EnvHA trypsin cleavage experiments in which an increase in the 28-kDa band (HA2) was observed in the presence of trypsin (Fig. 5B and 6). Overall, these results show that EnvHA retains the susceptibility to processing by trypsin-like proteases and the requirement of a low-pH environment to trigger membrane fusion, reminiscent of HA.

Analysis of the R3-EnvHA and X31-HA glycoproteins present on plasma membranes gave good indications of the quality and amounts of material available for purification (Fig. 7). Whether or not samples had been treated with trypsin, when gels were run under nonreducing conditions, all four antibody probes showed the predominant form of EnvHA to be trimeric. This was in contrast to the X31-HA-specific probes which indicated the bulk of the HA to be in a monomeric state. When run under reducing conditions, the anti-Env probes showed that the bulk of EnvHA retained a monomeric size whether or not trypsin treatment was applied. Probing of X31-HA containing membranes with the R185 and anti-X31-HA sera gave the expected results in that HA0/HA2 and HA0/HA1/HA2 were detected, respectively, and the levels of HA1/HA2 increased after trypsin treatment. In contrast, although both of these sera detected HA2 in R3-EnvHA containing samples, which increased in amount after trypsin treatment, EnvHA was detected with the anti-X31-HA serum only. This suggests either that the vast majority of EnvHA present on the cell surface is processed into EnvHA1/HA2 or that there is processing in the region from positions 115 to 153 of HA2, in addition to processing at the natural gp120HA1/HA2 trypsin susceptible cleavage site, that removes the R185 recognized epitope. That EnvHA mediates membrane fusion (Fig. 8 and Table 3) supports the former possibility. Whether this occurred intracellularly or at the cell surface is unknown, but such processing will have contributed to our inability to distinguish EnvHA0 and EnvHA1. The detection of HA2 in R3-EnvHA and X31-HA samples by R185 gives an indication of equivalence of expression at the cell surface which would equate to 1 mg of purified HA per 12 g (wet weight) of cells, amounts that have resulted in the determination of HA crystal structures (16, 28). Generation of similar HA-based chimeras may assist in structural studies of other trimeric proteins.

In membrane fusion assays the wt Env constructs of JRFL (R5-tropic) and NL43 (X4-tropic) induced fusion at neutral pH and retained their specificity for Ghost cells expressing the correct coreceptor (Fig. 8 and Table 3). However, coreceptor specificity was abolished in all EnvHA constructs, although the lack of membrane fusion in BHK cells confirmed that CD4 was still required. This suggests that the replacement of the gp120/gp41 stalk with the HA1/HA2 stalk had significant effects on the processes after the attachment of gp120 to CD4 receptors on target cells. Membrane fusion induced by HIV-1 Env has been shown to be a staged event with gp120-CD4 binding inducing conformational changes in gp120 that create or expose the chemokine coreceptor binding site, with the gp120-coreceptor interaction driving further conformational changes in the Env gp120/gp41 trimer to trigger the fusion event (reviewed in reference 23). Much effort has been put into mapping the sites on gp120 responsible for CD4-binding and coreceptor interaction and, although the V3 loop plays a major role, other variable domains and amino acid residues in constant regions are involved (3, 17, 19, 39, 53). EnvHA constructs were designed (Fig. 1) to contain all of the gp120 residues identified as being important in these interactions. In the experiments reported here we have not directly monitored coreceptor binding by EnvHAs, but the results suggest that it is not essential for induction of membrane fusion, whereas CD4 binding is. However, it is possible that the stability conferred on the EnvHA constructs by the HA1/HA2 stalk region, notably with there being a disulfide bond between HA1 and HA2, either impedes the conformational change induced by gp120-CD4 binding, thereby preventing the creation or exposure of the coreceptor binding site, or if coreceptor binding does occur the conformational changes induced may not be sufficient to trigger fusion at neutral pH. Whatever the cause of the apparent loss of coreceptor specificity, clearly EnvHA-CD4 binding, followed by a low-pH trigger is sufficient to induce membrane fusion (Fig. 8 and Table 3). That EnvHA is recognized by Env-specific monoclonal antibodies and polyclonal sera and retains binding specificity for CD4 suggests that the gp120 component is folded correctly.

It has been shown that the HAs of influenza virus mutants selected in the presence of high concentrations of amantadine contain amino acid substitutions at a number of positions in HA1 and/or HA2 that result in fusion occurring at elevated (more neutral) pHs, inferring less structural stability in HA1-HA2 interaction (21). When membrane fusion was monitored against a pH range of 6 to 5 in 0.2 steps, it was found that the pH at which fusion occurred was higher by ca. 0.2 pH units for EnvHAs compared to wt HA. This shift is comparable to those observed for influenza virus mutants containing amino acid substitutions in the globular head of HA1 (21). EnvHAs might be expected to be less stable than HA as the globular head of HA1 (224 amino acids and 2 N-linked glycosylation sequons) was replaced with gp120 proteins of approximately twice the size (NL43, 407 amino acids and 23 N-linked glycosylation sequons; JRFL, 401 amino acids and 22 N-linked glycosylation sequons). However, the membrane fusion induced by influenza virus HA has been shown to be pH, temperature, and time dependent (59, 60, 67). In the present study all fusion experiments were conducted at 37°C, and there were no discernible time differences for heterokaryon formation caused by X31-HA and EnvHAs. That all EnvHA constructs had the same membrane fusion characteristics is of interest since those with linkers included between respective Env and HA subunits, to provide some degree of flexibility to the protein structure, might have been expected to be more stable. The results indicate that the inclusion of these linkers had no significance.

In the present study we have shown that recombinant vaccinia virus can drive the expression of EnvHA, a proportion of which is present on cell surfaces as a stable, predominantly trimeric protein that retains functions of receptor binding and membrane fusion despite evidence for some proteolytic processing in HA2. Preliminary studies indicate that the bromelain-sensitive cleavage site in the HA2 domain is conserved, such that EnvHA glycoproteins can be purified for structural studies, and conditions of digestion are being optimized though it may be necessary to introduce alternative protease susceptible sites into the constructs (16). Further, since EnvHA is expressed as a stable, functional protein, opportunities of developing vaccines and/or therapies for HIV-1 infection are presented. It has been demonstrated that recombinant influenza viruses expressing fragments of HIV genes via either their HA or NA gene components have good vaccine potential (25, 30, 49). Although good drug therapies that drastically reduce the levels of HIV in an infected individual are available, no individual has, to date, been cleared of virus (effectively cured) since HIV can persist in a small reservoir of latently infected memory CD4+ T cells (reviewed in reference 6). Gene therapy approaches, largely based on retrovirus vectors expressing herpes simplex virus thymidine kinase under the control of an HIV-2 long terminal repeat, have been developed to allow selective killing of HIV-infected cells (10, 13, 48). However, in other disease treatment situations the use of retrovirus vectors that integrate stably into the host genome in a random manner have resulted in detrimental outcomes (32, 33, 44). The development of a reverse genetics system that allows efficient recovery of recombinant influenza viruses opens up the use of such viruses for gene therapy (50). Indeed, it has been shown recently that stable recombinant influenza viruses carrying two foreign genes, by replacing the HA and neuraminidase (NA) genes, can be produced (62). In the context of the results presented here, recombinant influenza viruses expressing EnvHA would target CD4-expressing cells and, since NA would no longer be required for recombinant influenza virus production, this gene segment could be used to carry a conditionally toxic gene, e.g., herpes simplex virus thymidine kinase (10) or reverse caspase-3, that induces apoptosis (58) under the control of an HIV-2 long terminal repeat such that only HIV-infected cells producing Tat would be killed. Recombinant influenza virus infection of the latently HIV-infected memory CD4+ T cells should stimulate them to produce Tat and thereby lead to their destruction. Attempts to generate such recombinant influenza viruses to explore these possibilities and provide a better source of EnvHA for structural studies are under way.

Acknowledgments

This study was supported by the British Medical Research Council and a Wellcome Trust Research Fellowship (A.J.E.).

We thank D. A. Steinhauer, S. A. Wharton, and D. J. Stevens for provision of immunologic reagents and guidance in aspects of this study relating to generation of recombinant vaccinia viruses, glycoprotein detection, and membrane fusion assays.

REFERENCES

  • 1.Adachi, A., H. E. Gendelman, S. Koenig, T. Folks, R. Willey, A. Rabson, and M. A. Martin. 1986. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol. 59:284-291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Barbouche, R., R. Miquelis, I. M. Jones, and E. Fenouillet. 2003. Protein-disulfide isomerase-mediated reduction of two disulfide bonds of HIV envelope glycoprotein 120 occurs post-CXCR4 binding and is required for fusion. J. Biol. Chem. 278:3131-3136. [DOI] [PubMed] [Google Scholar]
  • 3.Basmaciogullari, S., G. J. Babcock, D. Van Ryk, W. Wojtowicz, and J. Sodroski. 2002. Identification of conserved and variable structures in the human immunodeficiency virus gp120 glycoprotein of importance for CXCR4 binding. J. Virol. 76:10791-10800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Berting, A., C. Fischer, S. Schaefer, W. Garten, H. D. Klenk, and W. H. Gerlich. 2000. Hemifusion activity of a chimeric influenza virus hemagglutinin with a putative fusion peptide from hepatitis B virus. Virus Res. 68:35-49. [DOI] [PubMed] [Google Scholar]
  • 5.Bjorndal, A., H. Deng, M. Jansson, J. R. Fiore, C. Colognesi, A. Karlsson, J. Albert, G. Scarlatti, D. R. Littman, and E. M. Fenyo. 1997. Coreceptor usage of primary human immunodeficiency virus type 1 isolates varies according to biological phenotype. J. Virol. 71:7478-7487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Blankson, J. N., D. Persaud, and R. F. Siliciano. 2002. The challenge of viral reservoirs in HIV-1 infection. Annu. Rev. Med. 53:557-593. [DOI] [PubMed] [Google Scholar]
  • 7.Blasco, R., and B. Moss. 1995. Selection of recombinant vaccinia viruses on the basis of plaque formation. Gene 158:157-162. [DOI] [PubMed] [Google Scholar]
  • 8.Bosch, F. X., W. Garten, H. D. Klenk, and R. Rott. 1981. Proteolytic cleavage of influenza virus hemagglutinins: primary structure of the connecting peptide between HA1 and HA2 determines proteolytic cleavability and pathogenicity of Avian influenza viruses. Virology 113:725-735. [DOI] [PubMed] [Google Scholar]
  • 9.Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. [DOI] [PubMed] [Google Scholar]
  • 10.Brady, H. J., C. G. Miles, D. J. Pennington, and E. A. Dzierzak. 1994. Specific ablation of human immunodeficiency virus Tat-expressing cells by conditionally toxic retroviruses. Proc. Natl. Acad. Sci. USA 91:365-369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bullough, P. A., F. M. Hughson, J. J. Skehel, and D. C. Wiley. 1994. Structure of influenza haemagglutinin at the pH of membrane fusion. Nature 371:37-43. [DOI] [PubMed] [Google Scholar]
  • 12.Caffrey, M., M. Cai, J. Kaufman, S. J. Stahl, P. T. Wingfield, D. G. Covell, A. M. Gronenborn, and G. M. Clore. 1998. Three-dimensional solution structure of the 44-kDa ectodomain of SIV gp41. EMBO J. 17:4572-4584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Caruso, M., and A. Bank. 1997. Efficient retroviral gene transfer of a Tat-regulated herpes simplex virus thymidine kinase gene for HIV gene therapy. Virus Res. 52:133-143. [DOI] [PubMed] [Google Scholar]
  • 14.Cecilia, D., V. N. KewalRamani, J. O′Leary, B. Volsky, P. Nyambi, S. Burda, S. Xu, D. R. Littman, and S. Zolla-Pazner. 1998. Neutralization profiles of primary human immunodeficiency virus type 1 isolates in the context of coreceptor usage. J. Virol. 72:6988-6996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Chan, D. C., D. Fass, J. M. Berger, and P. S. Kim. 1997. Core structure of gp41 from the HIV envelope glycoprotein. Cell 89:263-273. [DOI] [PubMed] [Google Scholar]
  • 16.Chen, J., K. H. Lee, D. A. Steinhauer, D. J. Stevens, J. J. Skehel, and D. C. Wiley. 1998. Structure of the hemagglutinin precursor cleavage site, a determinant of influenza pathogenicity and the origin of the labile conformation. Cell 95:409-417. [DOI] [PubMed] [Google Scholar]
  • 17.Cho, M. W., M. K. Lee, M. C. Carney, J. F. Berson, R. W. Doms, and M. A. Martin. 1998. Identification of determinants on a dualtropic human immunodeficiency virus type 1 envelope glycoprotein that confer usage of CXCR4. J. Virol. 72:2509-2515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Compans, R. W., H. D. Klenk, L. A. Caliguiri, and P. W. Choppin. 1970. Influenza virus proteins. I. Analysis of polypeptides of the virion and identification of spike glycoproteins. Virology 42:880-889. [DOI] [PubMed] [Google Scholar]
  • 19.Cormier, E. G., D. N. Tran, L. Yukhayeva, W. C. Olson, and T. Dragic. 2001. Mapping the determinants of the CCR5 amino-terminal sulfopeptide interaction with soluble human immunodeficiency virus type 1 gp120-CD4 complexes. J. Virol. 75:5541-5549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Dalgleish, A. G., P. C. Beverley, P. R. Clapham, D. H. Crawford, M. F. Greaves, and R. A. Weiss. 1984. The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus. Nature 312:763-767. [DOI] [PubMed] [Google Scholar]
  • 21.Daniels, R. S., J. C. Downie, A. J. Hay, M. Knossow, J. J. Skehel, M. L. Wang, and D. C. Wiley. 1985. Fusion mutants of the influenza virus hemagglutinin glycoprotein. Cell 40:431-439. [DOI] [PubMed] [Google Scholar]
  • 22.Doms, R. W., A. L. Edinger, and J. P. Moore. 1998. Coreceptor use by primate lentiviruses, p. III20-III35. In B. Korber, C. Kuiken, B. Foley, B. Hahn, F. McCutchan, J. W. Mellors, and J. Sodroski (ed.), Human retroviruses and AIDS. Theoretical Biology and Biophysics, Los Alamos National Laboratory, Los Alamos, N.Mex.
  • 23.Dragic, T. 2001. An overview of the determinants of CCR5 and CXCR4 coreceptor function. J. Gen. Virol. 82:1807-1814. [DOI] [PubMed] [Google Scholar]
  • 24.Earl, P. L., B. Moss, and R. W. Doms. 1991. Folding, interaction with GRP78-BiP, assembly, and transport of the human immunodeficiency virus type 1 envelope protein. J. Virol. 65:2047-2055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ferko, B., D. Katinger, A. Grassauer, A. Egorov, J. Romanova, B. Niebler, H. Katinger, and T. Muster. 1998. Chimeric influenza virus replicating predominantly in the murine upper respiratory tract induces local immune responses against human immunodeficiency virus type 1 in the genital tract. J. Infect. Dis. 178:1359-1368. [DOI] [PubMed] [Google Scholar]
  • 26.Freed, E. O., D. J. Myers, and R. Risser. 1990. Characterization of the fusion domain of the human immunodeficiency virus type 1 envelope glycoprotein gp41. Proc. Natl. Acad. Sci. USA 87:4650-4654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Freed, E. O., D. J. Myers, and R. Risser. 1989. Mutational analysis of the cleavage sequence of the human immunodeficiency virus type 1 envelope glycoprotein precursor gp160. J. Virol. 63:4670-4675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Gamblin, S. J., L. F. Haire, R. J. Russell, D. J. Stevens, B. Xiao, Y. Ha, N. Vasisht, D. A. Steinhauer, R. S. Daniels, A. Elliot, D. C. Wiley, and J. J. Skehel. 2004. The structure and receptor binding properties of the 1918 influenza hemagglutinin. Science 303:1838-1842. [DOI] [PubMed] [Google Scholar]
  • 29.Garten, W., F. X. Bosch, D. Linder, R. Rott, and H. D. Klenk. 1981. Proteolytic activation of the influenza virus hemagglutinin: the structure of the cleavage site and the enzymes involved in cleavage. Virology 115:361-374. [DOI] [PubMed] [Google Scholar]
  • 30.Garulli, B., Y. Kawaoka, and M. R. Castrucci. 2004. Mucosal and systemic immune responses to a human immunodeficiency virus type 1 epitope induced upon vaginal infection with a recombinant influenza A virus. J. Virol. 78:1020-1025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gruenke, J. A., R. T. Armstrong, W. W. Newcomb, J. C. Brown, and J. M. White. 2002. New insights into the spring-loaded conformational change of influenza virus hemagglutinin. J. Virol. 76:4456-4466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Hacein-Bey-Abina, S., F. Le Deist, F. Carlier, C. Bouneaud, C. Hue, J. P. De Villartay, A. J. Thrasher, N. Wulffraat, R. Sorensen, S. Dupuis-Girod, A. Fischer, E. G. Davies, W. Kuis, L. Leiva, and M. Cavazzana-Calvo. 2002. Sustained correction of X-linked severe combined immunodeficiency by ex vivo gene therapy. N. Engl. J. Med. 346:1185-1193. [DOI] [PubMed] [Google Scholar]
  • 33.Hacein-Bey-Abina, S., C. von Kalle, M. Schmidt, F. Le Deist, N. Wulffraat, E. McIntyre, I. Radford, J. L. Villeval, C. C. Fraser, M. Cavazzana-Calvo, and A. Fischer. 2003. A serious adverse event after successful gene therapy for X-linked severe combined immunodeficiency. N. Engl. J. Med. 348:255-256. [DOI] [PubMed] [Google Scholar]
  • 34.Hallenberger, S., V. Bosch, H. Angliker, E. Shaw, H. D. Klenk, and W. Garten. 1992. Inhibition of furin-mediated cleavage activation of HIV-1 glycoprotein gp160. Nature 360:358-361. [DOI] [PubMed] [Google Scholar]
  • 35.Horimoto, T., A. Takada, K. Iwatsuki-Horimoto, M. Hatta, H. Goto, and Y. Kawaoka. 2003. Generation of influenza A viruses with chimeric (type A/B) hemagglutinins. J. Virol. 77:8031-8038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Klenk, H. D., R. Rott, M. Orlich, and J. Blodorn. 1975. Activation of influenza A viruses by trypsin treatment. Virology 68:426-439. [DOI] [PubMed] [Google Scholar]
  • 37.Koyanagi, Y., S. Miles, R. T. Mitsuyasu, J. E. Merrill, H. V. Vinters, and I. S. Chen. 1987. Dual infection of the central nervous system by AIDS viruses with distinct cellular tropisms. Science 236:819-822. [DOI] [PubMed] [Google Scholar]
  • 38.Kwong, P. D., R. Wyatt, S. Majeed, J. Robinson, R. W. Sweet, J. Sodroski, and W. A. Hendrickson. 2000. Structures of HIV-1 gp120 envelope glycoproteins from laboratory-adapted and primary isolates. Structure 8:1329-1339. [DOI] [PubMed] [Google Scholar]
  • 39.Kwong, P. D., R. Wyatt, J. Robinson, R. W. Sweet, J. Sodroski, and W. A. Hendrickson. 1998. Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature 393:648-659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Lamb, R. A., and P. W. Choppin. 1983. The gene structure and replication of influenza virus. Annu. Rev. Biochem. 52:467-506. [DOI] [PubMed] [Google Scholar]
  • 41.Leonard, C. K., M. W. Spellman, L. Riddle, R. J. Harris, J. N. Thomas, and T. J. Gregory. 1990. Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type 1 recombinant human immunodeficiency virus envelope glycoprotein (gp120) expressed in Chinese hamster ovary cells. J. Biol. Chem. 265:10373-10382. [PubMed] [Google Scholar]
  • 42.Markovic, I., T. S. Stantchev, K. H. Fields, L. J. Tiffany, M. Tomic, C. D. Weiss, C. C. Broder, K. Strebel, and K. A. Clouse. 2004. Thiol/disulfide exchange is a prerequisite for CXCR4-tropic HIV-1 envelope-mediated T-cell fusion during viral entry. Blood 103:1586-1594. [DOI] [PubMed] [Google Scholar]
  • 43.Marsh, M., and A. Helenius. 1989. Virus entry into animal cells. Adv. Virus Res. 36:107-151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Marshall, E. 2003. Gene therapy: second child in French trial is found to have leukemia. Science 299:320. [DOI] [PubMed] [Google Scholar]
  • 45.Martin, J., S. A. Wharton, Y. P. Lin, D. K. Takemoto, J. J. Skehel, D. C. Wiley, and D. A. Steinhauer. 1998. Studies of the binding properties of influenza hemagglutinin receptor-site mutants. Virology 241:101-111. [DOI] [PubMed] [Google Scholar]
  • 46.McClure, M. O., M. Marsh, and R. A. Weiss. 1988. Human immunodeficiency virus infection of CD4-bearing cells occurs by a pH-independent mechanism. EMBO J. 7:513-518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.McKeating, J. A., A. McKnight, and J. P. Moore. 1991. Differential loss of envelope glycoprotein gp120 from virions of human immunodeficiency virus type 1 isolates: effects on infectivity and neutralization. J. Virol. 65:852-860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Miyake, K., O. Iijima, N. Suzuki, M. Matsukura, and T. Shimada. 2001. Selective killing of human immunodeficiency virus-infected cells by targeted gene transfer and inducible gene expression using a recombinant human immunodeficiency virus vector. Hum. Gene Ther. 12:227-233. [DOI] [PubMed] [Google Scholar]
  • 49.Nakaya, Y., H. Zheng, and A. Garcia-Sastre. 2003. Enhanced cellular immune responses to SIV Gag by immunization with influenza and vaccinia virus recombinants. Vaccine 21:2097-2106. [DOI] [PubMed] [Google Scholar]
  • 50.Neumann, G., T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D. R. Perez, R. Donis, E. Hoffmann, G. Hobom, and Y. Kawaoka. 1999. Generation of influenza A viruses entirely from cloned cDNAs. Proc. Natl. Acad. Sci. USA 96:9345-9350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Penny, M. A., S. J. Thomas, N. W. Douglas, S. Ranjbar, H. Holmes, and R. S. Daniels. 1996. env gene sequences of primary HIV type 1 isolates of subtypes B, C, D, E, and F obtained from the World Health Organization Network for HIV Isolation and Characterization. AIDS Res. Hum. Retrovir. 12:741-747. [DOI] [PubMed] [Google Scholar]
  • 52.Poignard, P., T. Fouts, D. Naniche, J. P. Moore, and Q. J. Sattentau. 1996. Neutralizing antibodies to human immunodeficiency virus type-1 gp120 induce envelope glycoprotein subunit dissociation. J. Exp. Med. 183:473-484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Rizzuto, C. D., R. Wyatt, N. Hernandez-Ramos, Y. Sun, P. D. Kwong, W. A. Hendrickson, and J. Sodroski. 1998. A conserved HIV gp120 glycoprotein structure involved in chemokine receptor binding. Science 280:1949-1953. [DOI] [PubMed] [Google Scholar]
  • 54.Scarlatti, G., E. Tresoldi, A. Bjorndal, R. Fredriksson, C. Colognesi, H. K. Deng, M. S. Malnati, A. Plebani, A. G. Siccardi, D. R. Littman, E. M. Fenyo, and P. Lusso. 1997. In vivo evolution of HIV-1 coreceptor usage and sensitivity to chemokine-mediated suppression. Nat. Med. 3:1259-1265. [DOI] [PubMed] [Google Scholar]
  • 55.Skehel, J. J., P. M. Bayley, E. B. Brown, S. R. Martin, M. D. Waterfield, J. M. White, I. A. Wilson, and D. C. Wiley. 1982. Changes in the conformation of influenza virus hemagglutinin at the pH optimum of virus-mediated membrane fusion. Proc. Natl. Acad. Sci. USA 79:968-972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Skehel, J. J., and M. D. Waterfield. 1975. Studies on the primary structure of the influenza virus hemagglutinin. Proc. Natl. Acad. Sci. USA 72:93-97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Skehel, J. J., and D. C. Wiley. 2000. Receptor binding and membrane fusion in virus entry: the influenza hemagglutinin. Annu. Rev. Biochem. 69:531-569. [DOI] [PubMed] [Google Scholar]
  • 58.Srinivasula, S. M., M. Ahmad, M. MacFarlane, Z. Luo, Z. Huang, T. Fernandes-Alnemri, and E. S. Alnemri. 1998. Generation of constitutively active recombinant caspases-3 and -6 by rearrangement of their subunits. J. Biol. Chem. 273:10107-10111. [DOI] [PubMed] [Google Scholar]
  • 59.Steinhauer, D. A., S. A. Wharton, J. J. Skehel, and D. C. Wiley. 1995. Studies of the membrane fusion activities of fusion peptide mutants of influenza virus hemagglutinin. J. Virol. 69:6643-6651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Steinhauer, D. A., S. A. Wharton, J. J. Skehel, D. C. Wiley, and A. J. Hay. 1991. Amantadine selection of a mutant influenza virus containing an acid-stable hemagglutinin glycoprotein: evidence for virus-specific regulation of the pH of glycoprotein transport vesicles. Proc. Natl. Acad. Sci. USA 88:11525-11529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Subbarao, K., A. Klimov, J. Katz, H. Regnery, W. Lim, H. Hall, M. Perdue, D. Swayne, C. Bender, J. Huang, M. Hemphill, T. Rowe, M. Shaw, X. Xu, K. Fukuda, and N. Cox. 1998. Characterization of an avian influenza A (H5N1) virus isolated from a child with a fatal respiratory illness. Science 279:393-396. [DOI] [PubMed] [Google Scholar]
  • 62.Watanabe, T., S. Watanabe, T. Noda, Y. Fujii, and Y. Kawaoka. 2003. Exploitation of nucleic acid packaging signals to generate a novel influenza virus-based vector stably expressing two foreign genes. J. Virol. 77:10575-10583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Waterfield, M., G. Scrace, and J. Skehel. 1981. Disulphide bonds of haemagglutinin of Asian influenza virus. Nature 289:422-424. [DOI] [PubMed] [Google Scholar]
  • 64.Weis, W., J. H. Brown, S. Cusack, J. C. Paulson, J. J. Skehel, and D. C. Wiley. 1988. Structure of the influenza virus haemagglutinin complexed with its receptor, sialic acid. Nature 333:426-431. [DOI] [PubMed] [Google Scholar]
  • 65.Weis, W. I., S. C. Cusack, J. H. Brown, R. S. Daniels, J. J. Skehel, and D. C. Wiley. 1990. The structure of a membrane fusion mutant of the influenza virus haemagglutinin. EMBO J. 9:17-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Weissenhorn, W., A. Dessen, S. C. Harrison, J. J. Skehel, and D. C. Wiley. 1997. Atomic structure of the ectodomain from HIV-1 gp41. Nature 387:426-430. [DOI] [PubMed] [Google Scholar]
  • 67.Wharton, S. A., J. J. Skehel, and D. C. Wiley. 1986. Studies of influenza haemagglutinin-mediated membrane fusion. Virology 149:27-35. [DOI] [PubMed] [Google Scholar]
  • 68.Wiley, D. C., J. J. Skehel, and M. Waterfield. 1977. Evidence from studies with a cross-linking reagent that the haemagglutinin of influenza virus is a trimer. Virology 79:446-448. [DOI] [PubMed] [Google Scholar]
  • 69.Willey, R. L., J. S. Bonifacino, B. J. Potts, M. A. Martin, and R. D. Klausner. 1988. Biosynthesis, cleavage, and degradation of the human immunodeficiency virus 1 envelope glycoprotein gp160. Proc. Natl. Acad. Sci. USA 85:9580-9584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Wilson, I. A., J. J. Skehel, and D. C. Wiley. 1981. Structure of the haemagglutinin membrane glycoprotein of influenza virus at 3 Å resolution. Nature 289:366-373. [DOI] [PubMed] [Google Scholar]
  • 71.Yang, X., L. Florin, M. Farzan, P. Kolchinsky, P. D. Kwong, J. Sodroski, and R. Wyatt. 2000. Modifications that stabilize human immunodeficiency virus envelope glycoprotein trimers in solution. J. Virol. 74:4746-4754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Yang, X., J. Lee, E. M. Mahony, P. D. Kwong, R. Wyatt, and J. Sodroski. 2002. Highly stable trimers formed by human immunodeficiency virus type 1 envelope glycoproteins fused with the trimeric motif of T4 bacteriophage fibritin. J. Virol. 76:4634-4642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Zhu, X., C. Borchers, R. J. Bienstock, and K. B. Tomer. 2000. Mass spectrometric characterization of the glycosylation pattern of HIV-gp120 expressed in CHO cells. Biochemistry 39:11194-11204. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES