Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2005 May;79(10):6472–6477. doi: 10.1128/JVI.79.10.6472-6477.2005

Accumulation of Amino Acid Substitutions Promotes Irreversible Structural Changes in the Hemagglutinin of Human Influenza AH3 Virus during Evolution

Katsuhisa Nakajima 1,*, Eri Nobusawa 1, Alexander Nagy 2, Setsuko Nakajima 1
PMCID: PMC1091720  PMID: 15858030

Abstract

In order to clarify the effect of an accumulation of amino acid substitutions on the hemadsorption character of the influenza AH3 virus hemagglutinin (HA) protein, we introduced single-point amino acid changes into the HA1 domain of the HA proteins of influenza viruses isolated in 1968 (A/Aichi/2/68) and 1997 (A/Sydney/5/97) by using PCR-based random mutation or site-directed mutagenesis. These substitutions were classified as positive or negative according to their effects on the hemadsorption activity. The rate of positive substitutions was about 50% for both strains. Of 44 amino acid changes that were identical in the two strains with regard to both the substituted amino acids and their positions in the HA1 domain, 22% of the changes that were positive in A/Aichi/2/68 were negative in A/Sydney/5/97 and 27% of the changes that were negative in A/Aichi/2/68 were positive in A/Sydney/5/97. A similar discordance rate was also seen for the antigenic sites. These results suggest that the accumulation of amino acid substitutions in the HA protein during evolution promoted irreversible structural changes and therefore that antigenic changes in the H3HA protein may not be limited.


Subtypes of influenza viruses to which the human population is exposed are known to undergo substantial changes in their antigenicities. This property is referred to as antigenic drift and has been thought to result from the accumulation of a series of amino acid changes in antigenically important regions of the hemagglutinin (HA) molecule. It is important to elucidate the molecular mechanisms by which viruses alter their antigenic character in order to find a way to control epidemics of influenza.

Many studies have been carried out to clarify the manner by which influenza viruses escape antibody pressure. Mechanisms by which the HA molecule escapes neutralization by monoclonal antibodies were revealed by crystallographic studies (2, 10). These studies suggested that steric hindrance or the loss of an important hydrogen bond was the basic molecular principle abolishing antibody binding. Wilson and Cox (39) and Plotkin et al. (27) reported that multiple antigenic sites have changed in recent H3 virus epidemic strains. Mutants that escape neutralization by a single monoclonal antibody can be obtained at frequencies of 10−4 to 10−6 (22, 37, 41) and usually cannot be isolated in vitro by use of a mixture of monoclonal antibodies (17). Postinfection human sera contain polyclonal antibodies with various specificities toward the HA protein (23, 36). Therefore, the manner in which amino acid changes accumulate during passages in human populations remains to be determined. Ferguson et al. (7) showed that short-lived and unspecified antibody pressure was important for the construction of evolutionary patterns of influenza A virus by using mathematical modeling. However, with only the above information, we do not yet have the positive data needed for the prediction of antigenic sites that trigger antigenic change (30).

Another approach has been to determine the characteristics of amino acid changes in natural virus isolates. Many studies along this line have been carried out (3-5, 9, 26, 27, 32). Bush et al. (3), Suzuki and Gojobori (32), and Plotkin and Dushoff (26) stressed the positive selection of certain amino acid residues in the H3HA protein. This seems to explain the accumulation of amino acid changes in restricted regions. However, estimations of certain amino acid residues were different in these studies because the various authors applied different mathematical models. Therefore, it remains to be elucidated whether this positive selection can be explained as due to chance, to constraints of the HA structure, or to a selective environment.

Amino acid changes in natural isolates are principally chosen from changeable substitutions that do not disrupt HA activity. It has been reported that the physicochemical characteristics of proteins underlying the specific folding of polypeptide chains and protein functions are evolutionarily conserved and under continuous maintenance, particularly by the means of coordinated substitutions (1). Therefore, our approach was to obtain information about the restriction of changeable amino acid substitutions in the H3HA protein.

Influenza virus infection is initiated by an interaction between the viral glycoprotein, HA, and sialic acid moieties of glycoconjugates on host cells (reviewed by Wiley and Skehel [38]). HA proteins expressed in transfected COS cells hemadsorb red blood cells through the binding of sialic acid moieties (25). We introduced random one-point amino acid changes into the A/Aichi/2/68 virus (A/Aichi/68) (H3N2) HA protein by a PCR-based random mutation method (15) and assayed the hemadsorption activity of the mutant HAs in order to estimate the viability of the H3HA proteins resulting from these amino acid substitutions and to determine which changes were allowed during evolution (21). We found that each antigenic site could be further divided into smaller sites. The amino acid substitutions in the gaps between these smaller sites had a mostly negative impact on hemadsorption. Furthermore, we showed that 92% of the amino acid substitutions representing mainstream changes in the H3HA polypeptide during the last 30 years were restricted to changes that were positive in the HA protein of A/Aichi/68. However, if we wish to consider future amino acid substitutions in the H3HA protein, we need to determine whether accumulated amino acid substitutions would support the retention of the positive and negative hemadsorption patterns observed with the HA protein of A/Aichi/68 or would promote change.

For the present study, we used a PCR-based random mutation method or site-directed mutagenesis to introduce one-point amino acid changes into the HA1 domains of A/Sydney/5/97 (A/Sydney/97) (H3N2) and A/Aichi/68 and compared their effects on the hemadsorption activities of the two strains when they had identical amino acids at homologous positions.

MATERIALS AND METHODS

HA cDNA.

HA cDNAs from the A/Aichi/2/68 and A/Sydney/5/97 viruses were cloned and inserted into the pME18S expression vector by the use of EcoRI and XbaI sites as described previously (21).

Random mutations introduced into HA cDNA.

pME18S HA (A/Sydney/97) (1 ng) was amplified by a PCR with rTaq (Takara Shuzo, Japan) and the primer pair pME (−) and HA (−). The primer sequences were as follows: pME (−), TTCAGGTTCAGGGGGAGGTG; and HA (−), GGTACATTCCGCATCCCTGTTGC (A/Sydney/97 positions 1019 to 997). Amplification by PCR was carried out for 30 cycles. The amplified product was purified by use of a QIAquick PCR purification kit (QIAGEN, Tokyo, Japan). After one round of PCR, the product was diluted to 0.2 ng. A second-round PCR was performed under the same conditions. The purified PCR product was digested with EcoRI and NdeI. This fragment was replaced with the counterpart of pME18S HA (A/Sydney/97) cDNA.

Site-directed mutagenesis.

Site-directed mutagenesis of the HA cDNAs of A/Aichi/68 and A/Sydney/97 was carried out by a PCR mutagenic procedure as described previously (21). Ex Taq (Takara) was used for site-directed mutagenesis. PCR products amplified from pME18S HA (A/Aichi/68) and pME18S HA (A/Sydney/97) by the use of each mutant primer and the pME (−) primer were mixed with a PCR product from pME18S HA (A/Aichi/68 or A/Sydney/97) by use of the KO1 and KO2 primers, heated for 5 min at 94°C, and then cooled to room temperature. After filling up the heteroduplex DNAs with Ex Taq for 5 min at 72°C, we performed PCRs with the primers pME (−) and KO3. The PCR products were digested with EcoRI and NdeI, and then these fragments were replaced with the counterpart of HA cDNA. The primer sequences were as follows: KO1, AGCTGCGGACCTCAGCAAAAGCAG (the pME18S sequence is shown in italics and is followed by the HA1-11 sequence of A/Aichi/68; the underlined portion is the deficient EcoRI site); KO2, GGTAGGCTAATCTGCAGCAGCCATATGTGATCTTG (the tag sequence is shown in italics and is followed by the HA956-942 sequence of A/Aichi/68; the underlined portion is the NdeI site); and KO3, the tag sequence of KO2. The sequences of the mutant primers will be provided upon request.

Hemadsorption assay with HA cDNAs.

The PCR regions of isolated clones of pME18S HA were sequenced, and the hemadsorption activities of the COS cells expressing these pME18S HAs were examined by the use of human red blood cells (HRBCs). Transfection was performed as described previously (21). Briefly, each cDNA (200 ng) in minimal essential medium alone (MEM0) was incubated with Lipofectamine for 15 min at room temperature. COS cells (at 0.5 × 105 cells on an 18-mm coverslip that had been prepared 18 h earlier) were washed with MEM0. The DNA and Lipofectamine mixture was added to the cells, which were then incubated for 6 h at 37°C. The medium was changed to MEM containing 10% fetal calf serum (MEM10), and the cells were further incubated for 42 h at 37°C. The medium was changed to MEM0 4 h before the assay. The MEM0 was removed, 0.5% HRBCs were added to the culture, and the mixture was then incubated for 15 min at room temperature. Unadsorbed HRBCs were washed out with MEM0 and then examined under an optical microscope.

Immunofluorescence staining of the HA protein expressed on COS cells.

After the transfection of cDNA, the medium was changed to MEM10, followed by further incubation for 42 to 46 h at 37°C. The cells were then fixed with ethanol-acetone (1:1) at 4°C for 15 min or with 4% formamide at room temperature for 20 min. Indirect immunofluorescence staining was carried out with the monoclonal antibody 31 (23, 30), which recognizes A/Sydney/97, or with an anti-A/Aichi/68 rabbit serum (prepared by M. Ueda and A. Sugiura) to confirm the expression of the HA proteins in COS cells.

RESULTS

Comparison of restrictions against amino acid changes in HA proteins of A/Aichi/68 and A/Sydney/97.

We introduced 97 one-point amino acid changes into the HA1 domain of the HA protein of the A/Sydney/97 strain by using a PCR-based random mutation method and subsequently compared the findings with our previous results with A/Aichi/68 (20, 21) (Fig. 1). The percentage of surviving amino acid changes in the HA1 domain of A/Sydney/97 which did not abrogate the hemadsorption activity (positive) was calculated to be 51%. This value was not much different from that obtained previously for A/Aichi/68 (47%) (20). There were 21 positions on the HA1 proteins of A/Aichi/68 and A/Sydney/97 that had identical amino acid substitutions. Substitutions at 17 of these positions (7, 15, 22, 65, 70, 77, 79, 104, 117, 134, 136, 174, 183, 185, 198, 221, and 259) did not alter the hemadsorption character of the protein, but those at the other four positions (51, 105, 125, and 286) did.

FIG. 1.

FIG. 1.

One-point amino acid substitutions and their effects on the hemadsorption activities of A/Aichi/68 and A/Sydney/97. The results for A/Sydney/97 are shown together with those of A/Aichi/68, which were shown in Fig. 1 and Table 1 of our previous report (21). Substituted amino acids in the mutants of A/Aichi/68 and A/Sydney/97 are shown above and below the sequences, respectively. Green letters indicate positive changes in hemadsorption activity and red letters indicate negative changes.

Detailed analysis of the hemadsorption character of mutants with identical amino acid substitutions in the HA proteins of A/Aichi/68 and A/Sydney/97.

In order to further analyze the restriction characteristics for the HA proteins, we introduced 23 one-point amino acid changes identical to those in A/Sydney/97 at positions 31, 36, 42, 57, 66, 96, 101, 115, 120, 122, 126, 129, 154, 168, 184, 202, 210, 246, 267, 272, 288, 294, and 298 into the HA protein of A/Aichi/68 by using a site-directed mutagenesis method. These positions were randomly selected to cover the entire HA1 domain. The results of the experiment are shown in Table 1 together with those obtained by a PCR-based random mutation method. The results revealed that the hemadsorption patterns arising from the substitutions, whether positive or negative, were different for A/Aichi/68 and A/Sydney/97. Four of 18 (22%) substitutions that were positive for hemadsorption in the HA protein of A/Aichi/68 were negative for the HA protein of A/Sydney/97, and 7 of 26 (27%) substitutions that were negative for hemadsorption in the former were positive in the case of the latter. Therefore, during the 30 intervening years, the change in the hemadsorption character as a result of amino acid substitutions was estimated to be minimal, occurring at a rate of about 0.7% per year.

TABLE 1.

Effects of amino acid substitutions in the HA proteins of A/Aichi/68 and A/Sydney/97 on the hemadsorption character of the virusesa

Position Amino acid
Hemadsorption
Original Substitution Aichi/68 Sydney/97
7 D G + +
15 L P − −
22 N D − −
31* D H + +
36* V A − −
42* L P − −
51 I M − +
57* R Q + +
65 T S + +
66* L Q − −
70 L P − −
77 D G − −
79 F S − −
96* N D + −
101* D G − +
104 D N + +
105 Y C + −
115* S F − +
117 T S + +
120* F S − −
122* N S + +
125 F L + −
126* N K − +
129* G R − −
134 G R − −
136 S N − −
154* L S − +
168* M V + +
174 F L + +
183 H R − −
184* H R − −
185 P L − −
198 A V + +
202* V A − −
210* Q R + +
221 P S + +
246* N I − −
259 K R − −
267* I T + +
272* A T + +
286 G R − +
288* I T + −
294* F S − −
298* N D − +
a

HA cDNAs of the A/Aichi/68 and A/Sydney/97 viruses were cloned and inserted into the pME18S expression vector by the use of EcoRI and XbaI sites. A PCR-based random mutation method using pME18S HA (A/Sydney/97) was carried out as described in Materials and Methods. Effects on the hemadsorption character due to amino acid substitutions in the HA protein of A/Aichi/68 were described previously (21), except for those marked by asterisks. Amino acid substitutions indicated by asterisks were obtained by site-directed mutagenesis of the HA protein of A/Aichi/68 by a PCR mutagenesis procedure using pME18S HA (A/Aichi/68) as described in Materials and Methods. +, positive; −, negative.

Hemadsorption character of HA proteins that underwent amino acid substitutions after A/Sydney/97.

More than 22% of the amino acid substitutions observed among mainstream amino acid changes after 1997 were suspected of changing the hemadsorption character of A/Aichi/68. We analyzed 10 of the amino acid substitutions comprising mainstream changes of the H3HA polypeptide after 1997, as shown in Fig. 2. Substitutions at positions 131 and 155 were back-mutated to the same amino acids as those in A/Aichi/68, and the hemadsorption character of mutants exhibiting a W222R or S144N change is shown in Fig. 1. Using site-directed mutagenesis, we obtained six mutants with mainstream changes (R57Q, H75Q, T83K, N137S, T192I, and G225D) in the H3HA protein of A/Aichi/68. Three of 10 (30%) mutants were negative for hemadsorption. Thus, the frequency of negative changes in A/Aichi/68 increased with mainstream changes after 1997 compared to that (8%) before 1997.

FIG. 2.

FIG. 2.

Possible mainstream amino acid changes in the H3HA polypeptide from 1997 to 2003. The numbers on the right side of the mainstream stem indicate positions that underwent second (*), third (**), and fourth (***) amino acid changes from those in A/Aichi/68. The amino acids at positions 131 and 155 were reversed to the same ones as in A/Aichi/68. Site-directed mutagenesis to create the R57Q, H75Q, T83K, N137S, and T192I mutations was carried out as described in Materials and Methods.

Changes in hemadsorption character due to amino acid substitutions at antigenic sites during evolution.

We studied the effect on hemadsorption of the accumulation of amino acid substitutions at antigenic sites (Table 2). The positions of amino acid substitutions representing mainstream changes of natural isolates and/or positive changes in the antigenic region of the HA protein of A/Aichi/68 are shown together in the same group as changeable positions. Positions associated with negative changes in the antigenic region of the HA protein of A/Aichi/68 are presented as less changeable positions. Amino acid positions recognized in escape mutants selected in vitro by monoclonal antibodies are also shown in Table 2. Twenty-two of 47 changeable positions in the antigenic sites were matched to changed positions in the escape mutants. Only 1 (position 130) of 28 less changeable amino acid positions could be matched to the changed positions of these mutants. Therefore, changeable positions in antigenic sites were the major antibody targets. For the data shown in Table 1, 12 positions were located within the antigenic sites. Among these, six positions (57, 65, 122, 125, 126, and 198) were changeable positions and the other six (70, 79, 120, 134, 136, and 185) were less changeable positions (Table 2). For two (53 and 190) of the changeable positions, the amino acid substitutions were the same or reversed between A/Aichi/68 and A/Sydney/97 (Fig. 1). To obtain further information, we introduced substitutions into the HA protein of A/Sydney/97 at residues 82, 131, 143, and 156, which are at changeable positions, and residues 58, 61, 85, 130, 140, and 148, which are at less changeable positions (Table 3). Five of 12 (42%) amino acid substitutions at the changeable positions and 2 of 12 (17%) substitutions at the less changeable positions resulted in a difference in the hemadsorption characters of the two strains. A P-to-S substitution at position 143 represented a mainstream change after 1977, and until 1991, the reverse change, from S to P, had been allowed (from an analysis of monoclonal variants of A/Kamata/14/91 [our unpublished data]). However, an S-to-P change at this residue in the HA protein of A/Sydney/97 resulted in a loss of hemadsorption activity. These results also suggested that the hemadsorption character of the antigenic sites was affected by the accumulation of amino acid substitutions.

TABLE 2.

Changeable and less changeable positions in antigenic sitesa

Antigenic site or type of position Antigenic subsite or positions in the site
A A1A2A3
Changeable 121 122 124 125 126 128 131 133 135 137 142 143 144 145 146 147
Less changeable 120 127 130 134 136 139 140 148 151
Monoclonal 1221130213151355137314251433,51443,514531465
B B1B2
Changeable 155 156 157 158 159 160 163 165 188 189 190 192 193 196 197 198
Less changeable 152 153 185 191
Monoclonal 1554 1562 1583 1594 1652,41883,5 1893,41922 1933,4 1982,4
C C1 C2
Changeable 53 54 56 57 275 276 277 278
Less changeable 58 59 61 281 282
Monoclonal 5332783
E E1E2
Changeable 62 63 65 78 81 82 83
Less changeable 61 68 70 71 76 79 85 86 87 88
Monoclonal 812
a

The changeable and less changeable positions in the antigenic sites are described in the text. The amino acid positions that have been reported for escape mutants selected in vitro by monoclonal antibodies are shown as monoclonal. The superscripts 1, 2, 3, 4, and 5 indicate references 23, 14, 35, and 16 and our unpublished data, respectively.

TABLE 3.

Hemadsorption character of HA proteins with amino acid substitutions in antigenic sitesa

Class Amino acid position A/Aichi/68
A/Sydney/97
Amino acid change Hemad- sorption Amino acid change Hemad- sorption
Changeable 53 N to D Positive D to N Positive
57 R to Q Positive R to Q Positive
65 T to S Positive T to S Positive
82* E to R Positive T to S Positive
122 M to S Positive N to S Positive
125 F to L Positive F to L Negative
126 N to K Negative N to K Positive
131* T to A Positive A to T Positive
143* P to S Positive S to P Negative
156* K to N Negative Q to N Positive
190 E to G Negative D to G Positive
198 A to V Positive A to V Positive
Less changeable 58* I to M Negative I to M Negative
61* F to S Negative F to S Negative
70 L to P Negative L to P Negative
79 F to S Negative F to S Negative
85* D to E Negative D to E Positive
120 F to S Negative F to S Negative
130* V to A Negative V to A Negative
134 G to R Negative G to R Negative
136 S to N Negative S to N Negative
140* K to E Negative K to E Positive
148* F to L Negative F to L Negative
185 P to L Negative P to L Negative
a

Amino acid substitutions in the antigenic sites were obtained either by PCR-based random mutation (no asterisk) or by site-directed mutagenesis of the HA protein of A/Aichi/68 or A/Sydney/97 (asterisks).

Hemadsorption status following amino acid substitutions in conserved regions of the H3HA protein.

A comparison of the amino acid sequences of HA proteins among 15 subtypes of influenza A virus revealed the existence of strongly conserved positions (24, 28), such as those having S-S bond-forming cysteine residues in the HA1 region. In addition, Nagy et al. (unpublished data) observed nine strictly conserved positions (60D, 84W, 100Y, 149S, 153W, 180W, 234W, 281C, and 320M). Human H3 virus strains exhibit extreme stability at the above positions, as neither amino acid nor synonymous codon variation has been observed. We introduced amino acid substitutions at these positions into the HA proteins of A/Aichi/68 and A/Sydney/97. As shown in Table 4, all of the amino acid substitutions, except the one for 60D, resulted in negative hemadsorption activity. None of the hemadsorption-negative proteins migrated to the cell surface. As for position 60, many substitutions among subtypes were noted, and a change from D to N in the H3HA protein permitted the retention of hemadsorption activity. Therefore, position 60 may be a changeable position.

TABLE 4.

Effects of amino acid substitutions at conserved positions on the hemadsorption character of the HA proteins

Position Amino acid
Hemadsorption activity
Original Substitution A/Aichi/68 A/Sydney/97
60 D N Positive Positive
H Negative Negative
84 W R Negative Negative
G Negative NDa
100 Y N Negative Negative
H Negative Negative
149 S R Negative Negative
153 W R Negative Negative
G Negative NDa
180 W R Negative Negative
234 W R Negative Negative
281 C S Negative Negative
Y Negative NDa
320 M I Negative Negative
a

ND, not done.

DISCUSSION

It has been reported that the physicochemical characteristics underlying the specific folding of polypeptide chains and protein function are evolutionarily conserved (1). In order to avoid or to modify distortion of the HA structure by the accumulation of structural changes due to an increase in the number of amino acid changes, a regulatory mechanism might be in effect during the accumulation of these changes. To elucidate the regulation of amino acid substitution during protein evolution, coordinated or covariational substitution was carried out by computer analysis (1, 11, 34). In a previous report, we mentioned that we could not find any specific data on the regulation of the accumulation of amino acid changes in the HA protein by using two-point amino acid substitution analysis (21). Govindarajan et al. (12) showed experimentally that covariational change was not necessary for protein evolution, because none of the changes had a deleterious effect on protein function. From our present results, we calculated that about 99% of two-point amino acid substitutions would not affect the hemadsorption activity (55 mainstream amino acids were changed in the H3HA polypeptide of A/Aichi/68 to those present in A/Sydney/97, and the minimal discordance in amino acid substitutions was 22%; therefore, one amino acid substitution increased the discordance by 0.4%). This finding explained why no data suggesting a regulation of the accumulation of amino acid changes in the HA protein were obtained in our previous study (21).

In the present study, we showed that the accumulation of amino acid substitutions increases the likelihood of a positive-to-negative change in the HA protein of A/Aichi/68 at a rate of 0.4% per additional substitution. On the other hand, the accumulation of amino acid substitutions allowed for the possibility of new substitutions which were prohibited in the original protein. Furthermore, we showed that the rates of positive and negative changes in A/Aichi/68 and A/Sydney/97 were quite similar. These results suggested that an irreversible structural change had occurred in the HA protein during evolution. This was also supported by our previous findings that multiple amino acid changes in the HA protein of A/Aichi/68 were necessary for changing the receptor specificity (19, 25), and an intrasubtypical incompatibility of certain regions in the HA portion of chimeric proteins was observed (23, 30). However, we cannot exclude the possibility that an irreversible structural change by the accumulation of amino acid substitutions during evolution is specific to the HA protein of influenza virus, which is under immune pressure to alter its antigenicity.

Influenza viruses are comprised of 15 subtypes of HA protein. Recently, the three-dimensional structures of the H1, H5, H7, and H9 HAs were determined (13, 29, 31) and compared to that of H3HA (40). These HA structures were similar to each other, and it was suggested that the HA subtypes may have originated by diversification (29, 31). A comparison of the amino acid sequences of the 15 subtypes revealed the existence of certain strongly conserved positions (24, 28), but the number of these positions was found to be quite limited. Among subtypes, a number of deletions and insertions of amino acids exist in the HA1 domain. For the present study, the evidence suggests that an accumulation of amino acid substitutions promotes an irreversible change in the HA structure. Therefore, deletions, insertions, and/or covariations may not be essential for promoting the diversification of HA subtypes.

It has been pointed out that a few amino acids are essential for protein folding, as determined by folding kinetics (6, 8, 18). Nine strictly conserved positions in the H3HA protein were found by a sequence analysis of published H3HA sequences. We analyzed the effects of amino acid substitutions at these positions in the HA proteins of A/Aichi/68 and A/Sydney/97 and found that the mutated proteins, except for one with a mutation at position 60, abrogated hemadsorption activity and did not move to the cell surface. Therefore, these positions might be included in key sites for correct folding of the H3HA protein.

Twenty-three amino acid positions identified in escape mutants selected in vitro by the use of monoclonal antibodies to the H3HA protein (14, 16, 23, 35; our unpublished data) were matched to the observed positions of amino acid substitutions at antigenic sites. Of these, 22 were matched to changeable positions and 1 was matched to a less changeable position. The positions located in antigenic site D were deleted from the analysis because we thought that this site might be mouse specific (33). This revealed that the changeable positions in antigenic sites were the main antibody targets. The less changeable positions were located within inner sites of the HA molecule (21), where they supported substitutions at changeable positions. As shown in Table 3, the rate of discordance of the less changeable positions (17%) was lower than that (42%) of the changeable positions in the antigenic sites. During evolution, the hemadsorption status of the HA protein can change due to amino acid substitutions at changeable positions within the antigenic sites. This implies that irreversible structural changes have occurred in these sites. These results also suggest that antigenic changes in the H3HA protein may not be limited.

Acknowledgments

This work was supported in part by a scientific research grant from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.

REFERENCES

  • 1.Afonnikov, D. A., D. Y. Oshepkov, and N. A. Kolchanov. 2001. Detection of conserved physico-chemical characteristics of proteins by analyzing clusters of positions with co-ordinated substitutions. Bioinformatics 17:1035-1046. [DOI] [PubMed] [Google Scholar]
  • 2.Bizebard, T., B. Gigant, P. Rigolet, B. Rasmussen, O. Diat, P. Bosecke, S. A. Wharton, J. J. Skehel, and M. Knossow. 1995. Structure of influenza viral haemagglutinin complexed with a neutralizing antibody. Nature 376:92-94. [DOI] [PubMed] [Google Scholar]
  • 3.Bush, R. M., C. A. Bender, K. Subbarao, N. J. Cox, and W. M. Fitch. 1999. Predicting the evolution of human influenza A. Science 286:1921-1925. [DOI] [PubMed] [Google Scholar]
  • 4.Bush, R. M., C. B. Smith, N. J. Cox, and W. M. Fitch. 2000. Effects of passage history and sampling bias on phylogenetic reconstruction of human influenza A evolution. Proc. Natl. Acad. Sci. USA 97:6974-6980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bush, R. M., W. M. Fitch, C. A. Bender, and N. J. Cox. 1999. Positive selection on the H3 hemagglutinin gene of human influenza virus A. Mol. Biol. Evol. 16:1457-1465. [DOI] [PubMed] [Google Scholar]
  • 6.Dokholyan, N. V., S. V. Budyrev, H. E. Stanley, and E. I. Shakhnovich. 2000. Identifying the protein folding nucleus using molecular dynamics. J. Mol. Biol. 296:1183-1188. [DOI] [PubMed] [Google Scholar]
  • 7.Ferguson, N. M., A. P. Galvani, and R. M. Bush. 2003. Ecological and immunological determinants of influenza evolution. Nature 422:428-433. [DOI] [PubMed] [Google Scholar]
  • 8.Fersht, A. R. 1997. Nucleation mechanisms in protein folding. Curr. Opin. Struct. Biol. 7:3-9. [DOI] [PubMed] [Google Scholar]
  • 9.Fitch, W. M., R. M. Bush, C. A. Bender, and N. J. Cox. 1997. Longterm trends in the evolution of H(3)HA1 human influenza type A. Proc. Natl. Acad. Sci. USA 94:7712-7718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Fleury, D., S. A. Wharton, J. J. Skehel, M. Knossow, and T. Bizebard. 1998. Antigen distortion allows influenza virus to escape neutralization. Nat. Struct. Biol. 5:119-123. [DOI] [PubMed] [Google Scholar]
  • 11.Fukami-Kobayashi, K., D. R. Schreibe, and S. A. Benner. 2002. Detecting compensatory covariation signals in protein evolution using reconstructed ancestral sequences. J. Mol. Biol. 319:729-743. [DOI] [PubMed] [Google Scholar]
  • 12.Govindarajan, S., J. E. Ness, S. Kim, E. C. Mundorff, J. Minshull, and C. Gustafsson. 2003. Systematic variation of amino acid substitutions for stringent assessment of pairwise covariation. J. Mol. Biol. 328:1061-1069. [DOI] [PubMed] [Google Scholar]
  • 13.Ha, Y., D. J. Stevens, J. J. Skehel, and D. C. Wiley. 2002. H5 avian and H9 swine influenza virus haemagglutinin structures: possible origin of influenza subtypes. EMBO J. 21:865-875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kida, H., Y. Kawaoka, C. W. Naeve, and R. G. Webster. 1987. Antigenic and genetic conservation of H3 influenza virus in wild ducks. Virology 159:109-119. [DOI] [PubMed] [Google Scholar]
  • 15.Kok, R. G., D. M. Young, and L. N. Ornston. 1999. Phenotypic expression of PCR-generated random mutations in a Pseudomonas putida gene after its introduction into an Acinetobacter chromosome by natural transformation. Appl. Environ. Microbiol. 65:1675-1680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kostlansky, F., E. Vareckova, T. Betokova, V. Mucha, G. Russ, and S. A. Wharton. 2000. The strong positive correlation between effective affinity and infectivity neutralization of highly cross-reactive monoclonal antibodies IIB4, which recognize antigenic site B on influenza A virus haemagglutinin. J. Gen. Virol. 81:1727-1735. [DOI] [PubMed] [Google Scholar]
  • 17.Lambkin, R., L. McLain, S. E. Jones, A. L. Aldridge, and N. J. Dimmock. 1994. Neutralization escape mutants of type A influenza virus are readily selected by antisera from mice immunized with whole virus: a possible mechanism for antigenic drift. J. Gen. Virol. 75:3493-3502. [DOI] [PubMed] [Google Scholar]
  • 18.Mirny, L. A., V. I. Abkevich, and E. I. Shakhnovicch. 1998. How evolution makes proteins fold quickly. Proc. Natl. Acad. Sci. USA 95:4976-4981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Morishita, T., E. Nobusawa, K. Nakajima, and S. Nakajima. 1996. Studies on the molecular basis for loss of the ability of recent influenza A(H1N1) virus strains to agglutinate chicken erythrocytes. J. Gen. Virol. 77:2499-2506. [DOI] [PubMed] [Google Scholar]
  • 20.Nakajima, K., E. Nobusawa, and S. Nakajima. 2004. Restriction of amino acid change on the H3 hemagglutinin protein of influenza A virus, p. 174-177. In Y. Kawaoka (ed.), Options for the control of influenza V. Elsevier, Amsterdam, The Netherlands.
  • 21.Nakajima, K., E. Nobusawa, K. Tonegawa, and S. Nakajima. 2003. Restriction of amino acid change in influenza A virus H3HA: comparison of amino acid changes observed in nature and in vitro. J. Virol. 77:10088-10098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Nakajima, S., and A. P. Kendal. 1981. Antigenic drift in influenza A/USSR/90/77 (H1N1) variants selected in vitro with monoclonal antibodies. Virology 113:656-662. [DOI] [PubMed] [Google Scholar]
  • 23.Nakajima, S., E. Nobusawa, and K. Nakajima. 2000. Variation in response among individuals to antigenic sites on the HA protein of human influenza virus may be responsible for the emergence of drift strains in the human population. Virology 274:220-231. [DOI] [PubMed] [Google Scholar]
  • 24.Nobusawa, E., T. Aoyama, Y. Suzuki, Y. Tateno, and K. Nakajima. 1991. Comparison of complete amino acid sequences and receptor-binding properties among 13 serotypes of hemagglutinins of influenza A viruses. Virology 182:475-485. [DOI] [PubMed] [Google Scholar]
  • 25.Nobusawa, E., H. Ishihara, T. Morishita, K. Sato, and K. Nakajima. 2000. Change in receptor-binding specificity of recent human influenza A viruses (H3N2): a single amino acid change in hemagglutinin altered its recognition of sialyloligosaccharides. Virology 278:587-596. [DOI] [PubMed] [Google Scholar]
  • 26.Plotkin, J. B., and J. Dushoff. 2003. Codon bias and frequency dependent selection on the hemagglutinin epitopes of influenza A virus. Proc. Natl. Acad. Sci. USA 100:7152-7157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Plotkin, J. B., J. Dushoff, and S. A. Levin. 2002. Hemagglutinin sequence clusters and the antigenic evolution of influenza A virus. Proc. Natl. Acad. Sci. USA 99:6263-6268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Rome, C., N. Zhou, J. Suss, J. Mackenzie, and R. G. Webster. 1996. Characterization of a novel influenza hemagglutinin, H15: criteria for determination of influenza A subtypes. Virology 217:508-516. [DOI] [PubMed] [Google Scholar]
  • 29.Russell, R. J., S. J. Gamblin, L. F. Haire, D. J. Stevens, B. Xiao, Y. Ha, and J. J. Skehel. 2004. H1 and H7 influenza haemagglutinin structures extend a structural classification of haemagglutinin subtypes. Virology 325:287-296. [DOI] [PubMed] [Google Scholar]
  • 30.Sato, K., T. Morishita, E. Nobusawa, K. Tonegawa., K. Sakae, S. Nakajima, and K. Nakajima. 2004. Amino-acid change on the antigenic region B1 of H3 haemagglutinin may be a trigger for the emergence of drift strains of influenza A virus. Epidemiol. Infect. 132:399-406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Stevens, J., A. L. Corper, C. F. Basler, J. K. Taubenberger, P. Palese, and I. A. Wilson. 2004. Structure of the uncleaved human H1 hemagglutinin from the extinct 1918 influenza virus. Science 303:1866-1870. [DOI] [PubMed] [Google Scholar]
  • 32.Suzuki, Y., and T. Gojobori. 1999. A method for detecting positive selection at single amino acid sites. Mol. Biol. Evol. 16:1315-1328. [DOI] [PubMed] [Google Scholar]
  • 33.Tonegawa, K., E. Nobusawa, K. Nakajima, T. Kato, T. Kutsune, K. Kuroda, T. Shibata, Y. Harada, A. Nakamura, and M. Itoh. 2003. Analysis of epitope recognition of antibodies induced by DNA immunization against hemagglutinin protein of influenza A virus. Vaccine 21:3118-3125. [DOI] [PubMed] [Google Scholar]
  • 34.Tourasse, N. J., and W. H. Li. 2000. Selective constraints, amino acid composition, and the rate of protein evolution. Mol. Biol. Evol. 17:656-664. [DOI] [PubMed] [Google Scholar]
  • 35.Vanlandschoot, P., E. Beinaert, S. Dewilde, X. Saelens, and A. Bestebroer. 1995. Fairly conserved epitope on the hemagglutinin of influenza A(H3N2) virus with variable accessibility to neutralizing antibody. Virology 212:526-534. [DOI] [PubMed] [Google Scholar]
  • 36.Wang, M.-L., J. J. Skehel, and D. C. Wiley. 1986. Comparative analysis of the specificities of anti-influenza hemagglutinin antibodies in human sera. J. Virol. 57:124-128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Webster, R. G., and W. G. Laver. 1980. Determination of the number of non-overlapping antigenic areas on Hong Kong (H3N2) influenza virus hemagglutinin with monoclonal antibodies and the selection of variants with potential epidemiological significance. Virology 104:139-148. [DOI] [PubMed] [Google Scholar]
  • 38.Wiley, D. C., and J. J. Skehel. 1987. The structure and function of the hemagglutinin membrane glycoprotein of influenza virus. Annu. Rev. Biochem. 56:365-394. [DOI] [PubMed] [Google Scholar]
  • 39.Wilson, I. A., and N. J. Cox. 1990. Structural basis of immune recognition of influenza hemagglutinin. Annu. Rev. Immunol. 8:737-771. [DOI] [PubMed] [Google Scholar]
  • 40.Wilson, I. A., J. J. Skehel, and D. C. Wiley. 1981. Structure of the haemagglutinin membrane glycoprotein of influenza virus at 3Å resolution. Nature 289:366-373. [DOI] [PubMed] [Google Scholar]
  • 41.Yewdell, J., A. J. Caton, and W. Gerhald. 1986. Selection of influenza A virus adsorptive mutants by growth in the presence of a mixture of monoclonal anti-hemagglutinin antibodies. J. Virol. 57:632-638. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES