Skip to main content
eLife logoLink to eLife
. 2024 Mar 6;13:e85962. doi: 10.7554/eLife.85962

The ER tether VAPA is required for proper cell motility and anchors ER-PM contact sites to focal adhesions

Hugo Siegfried 1,†, Georges Farkouh 1, Rémi Le Borgne 1, Catherine Pioche-Durieu 1, Thaïs De Azevedo Laplace 1,‡, Agathe Verraes 1, Lucien Daunas 1, Jean-Marc Verbavatz 1,✉, Mélina L Heuzé 1,✉
Editors: Felix Campelo2, Suzanne R Pfeffer3
PMCID: PMC10917420  PMID: 38446032

Abstract

Cell motility processes highly depend on the membrane distribution of Phosphoinositides, giving rise to cytoskeleton reshaping and membrane trafficking events. Membrane contact sites serve as platforms for direct lipid exchange and calcium fluxes between two organelles. Here, we show that VAPA, an ER transmembrane contact site tether, plays a crucial role during cell motility. CaCo2 adenocarcinoma epithelial cells depleted for VAPA exhibit several collective and individual motility defects, disorganized actin cytoskeleton and altered protrusive activity. During migration, VAPA is required for the maintenance of PI(4)P and PI(4,5)P2 levels at the plasma membrane, but not for PI(4)P homeostasis in the Golgi and endosomal compartments. Importantly, we show that VAPA regulates the dynamics of focal adhesions (FA) through its MSP domain, is essential to stabilize and anchor ventral ER-PM contact sites to FA, and mediates microtubule-dependent FA disassembly. To conclude, our results reveal unknown functions for VAPA-mediated membrane contact sites during cell motility and provide a dynamic picture of ER-PM contact sites connection with FA mediated by VAPA.

Research organism: E. coli, Human

Introduction

The lipid identity of membrane compartments is highly regulated within cells and plays a key role in a diversity of cellular processes. During cell motility, lipids, in particular Phosphoinositides (PInst), are local determinants of molecular events leading to cell polarization, the formation of actin-driven protrusions and turnover of focal adhesions (FA) (Hammond and Burke, 2020; Tsujita and Itoh, 2015). PI(4,5)P2, the most abundant PInst at the plasma membrane, controls FA dynamics by regulating the binding of talin to integrins (Martel et al., 2001; Thapa et al., 2012) and the polarized trafficking of integrins (Nader et al., 2016). PI(4,5)P2 is described as a modulator of actin cytoskeleton organization and dynamics, either directly through the recruitment of several actin-binding proteins (Senju et al., 2017), or indirectly by regulating the activation of RhoA (Lacalle et al., 2007; Xu et al., 2010) and Cdc42 GTPases (Daste et al., 2017). The product of PI(4,5)P2 phosphorylation, PI(3,4,5)P3, also plays a crucial role in cell motility at the plasma membrane (PM). Several in vitro and in vivo studies have shown that PI(3,4,5)P3 acts as a ‘compass lipid’ that stabilizes the direction of migration (Funamoto et al., 2002; Hannigan et al., 2002; Lam et al., 2012) through the activation of Rac1 (Kunisaki et al., 2006; Welch et al., 2002; Yoshii et al., 1999).

Membrane lipids are transported through vesicular transport, but also through non-vesicular transport at so-named membrane contact sites (MCS; Jackson et al., 2016). MCS are sites of close apposition between two membranes, often the endoplasmic reticulum (ER) membrane and the membrane of another organelle, at a distance of less than 80 nm, where exchanges of lipids, Ca2 +and metabolites take place (Prinz et al., 2020; Scorrano et al., 2019; Wu et al., 2018). While the activity of lipid transfer at MCS was observed decades ago (Vance, 1990), their implication in patho-physiological processes such as cell motility has gained interest only recently (Prinz et al., 2020).

In this work, we studied the role of VAPA, a tethering protein at ER-mediated MCS during cell motility. VAPA is a member of the highly conserved VAP family of proteins, together with VAPB. VAP proteins are integral ER membrane proteins bridging the ER membrane to the membrane of other compartments by assembling with numerous partners including lipid transfer proteins that bind the target membrane, such as Nir proteins and OSBP-related (ORP) proteins. The assembly of most of VAP complexes relies on the interaction between the conserved N-terminal MSP (Major Sperm Protein) domain of VAPs and the FFAT (2 phenyl alanines in an acidic tract) motif on their partner. VAPs also contain a central coiled-coil dimerization domain and an ER transmembrane domain in their C-terminus (Murphy and Levine, 2016). VAP proteins are involved in several cellular functions such as lipid transport, membrane trafficking, the unfolded protein response pathway and microtubules organization (Kamemura and Chihara, 2019; Lev et al., 2008). VAP complexes with lipid transfer proteins control the homeostasis of PInst and sterols at various intracellular locations. At ER-PM contact sites, the VAP/Nir2 and VAP/ORP3 complexes regulate the transport of Phosphoinositol (PI) and PI(4)P respectively. Together with membrane-associated kinases and phosphatases, they contribute to modulating locally the pool of PI(4)P, PI(4,5)P2 and PI(3,4,5)P3 at the PM (Chang and Liou, 2015; Gulyás et al., 2020; Kim et al., 2013). In addition, the association of VAPs with OSBP-related proteins modifies the level of PI(4)P at endosomal membranes and at the Golgi, therefore regulating trafficking events in these two compartments (Dong et al., 2016; Kawasaki et al., 2022; Mesmin et al., 2013). Moreover, VAP proteins mediate cholesterol transport at ER-Golgi, ER-endosome and ER-peroxisome MCS (Dong et al., 2019; Hua et al., 2017; Mesmin et al., 2013; Wilhelm et al., 2017). Depending on the cell type and organism, the loss of VAP proteins can lead to either a reduction (Peretti et al., 2008) or an accumulation (Mao et al., 2019; Wakana et al., 2021; Subra et al., 2023) of PI(4)P levels in the Golgi membranes and its redistribution on endosomes (Dong et al., 2016). In yeast, depleting VAP orthologs results in the accumulation of PI(4)P at the plasma membrane (Stefan et al., 2011).

Altogether, these observations prompted us to hypothesize that VAPs, by regulating PInst homeostasis, could contribute to cell motility processes. Importantly, two partners of VAPs at ER-PM contact sites, ORP3 and Nir2, have been shown to regulate cell motility processes through different pathways (D’Souza et al., 2020; Keinan et al., 2014; Lehto et al., 2008; Weber-Boyvat et al., 2015). As a first-line approach, we decided to investigate the effects of VAPA depletion alone on the motility of human adenocarcinoma Caco2 cells. We observed strong motility defects, suggesting that VAPA is required for proper cell motility and that VAPB is not sufficient to compensate for the loss of VAPA. We then aimed to understand the precise function of VAPA in this process. Here, we show that the depletion of VAPA strongly impacts the organization of the actin cytoskeleton, the dynamics of protrusions and the turnover of FA during migration. The role of VAPA stands mainly at the PM where it regulates PI(4)P and PI(4,5)P2 homeostasis, the stability of ER-PM contact sites and their local anchoring at FA, thereby regulating FA disassembly.

Results

VAPA is required for proper cell migration and cell spreading

To assess the role of VAPA during cell motility, we generated, using CRISPR/Cas9 gene editing, stable Caco-2 cells either depleted for VAPA (VAPA KO), or expressing non-targeting sequences (Control). VAPA KO cells exhibited a complete and specific depletion of VAPA protein (Figure 1A and B). In VAPA KO cells, VAPB was well distributed throughout the ER and its levels were slightly increased, albeit non significant (Figure 1—figure supplement 1). We first assessed the capacity of VAPA KO and Control monolayers to migrate collectively upon space release on fibronectin-coated glass. In order to avoid any proliferation bias, we treated the cells with mitomycin. In these conditions, VAPA KO monolayers filled the open space less efficiently than Control monolayers (Figure 1D and E, Video 1). The analysis of leader cells trajectories revealed that VAPA KO leader cells were displacing faster but with a remarkable lack of directionality compared to Control leader cells (Figure 1F and G), which could account for the slower colonization capacity VAPA KO monolayers. This collective migration impairment was at least partially cell-intrinsic, as single VAPA KO cells displacing on a 2D surface exhibited identical defects compared to VAPA KO leader cells in monolayers (Figure 1H–J). Moreover, upon plating, VAPA KO cells were spreading much faster than Control cells, also indicating a cell-autonomous defect arising in these cells (Figure 1K and L). In order to determine the contribution of the MSP domain of VAPA in these phenotypes, we generated stable VAPA KO cell lines expressing a Wild-type form of VAPA (named VAPA KO +WT) or an MSP-mutated form of VAPA (named VAPA KO +KDMD) bearing the K94D M96D mutation that was previously shown to abolish FFAT binding (Kaiser et al., 2005). Both VAPA constructs, fused to mCherry, localized to the ER (Figure 1C). The expression of mCherry-VAPA WT restored either partially or totally the collective migration capacity of VAPA KO cells (Figure 1D–G and Video 1) and their spreading behaviour (Figure 1K and L), indicating that the loss of VAPA was indeed responsible for the defects observed in VAPA KO cells. Importantly, the VAPA KDMD mutant failed to rescue these phenotypes in VAPA KO cells (Figure 1D–G , and K–L and Video 1). Altogether, our results identify VAPA as a novel actor of collective and individual cell motility processes, and point to a determinant role of the FFAT-binding MSP domain in VAPA protein.

Figure 1. VAPA is required for proper cell migration and cell spreading.

(A) Left panel: Representative immunoblots showing the levels of VAPA and Tubulin in Control and VAPA KO cells. Tubulin expression level was used as loading control. Right panel: quantification of relative VAPA density in Control and VAPA KO cells normalized to Tubulin levels (mean ± SEM from three independent experiments). Data were analysed using a single-sample Student t-test. (B) Confocal images of Control and VAPA KO cells immunostained for VAPA. Scale bar 20 µm. (C) Confocal images of VAPA KO leader cells expressing wild-type mCherry-VAPA (VAPA KO +WT) or mCherry-VAPA KD/MD (VAPA KO +KDMD). Scale bar 10 µm. (D) Phase contrast images of Control, VAPA KO, VAPA KO +WT and VAPA KO +KDMD cells migrating collectively 48 hr after space release. For each condition, the trajectory of a leader cell over 20 hr is shown in green. Scale bar: 100 µm. (E) Analysis of relative colonized surface within the last 20 h by Control, VAPA KO, VAPA KO +WT and VAPA KO +KDMD cells (mean ± SEM from three independent experiments). Data were analysed using a One-way Anova paired test. (F, G) Analysis of Control, VAPA KO, VAPA KO +WT and VAPA KO +KDMD leader cell velocity (F) n=40, 40, 3,9 and 39 cells respectively from three independent experiments and directionality coefficient (G) n=34, 36, 32, and 26 cells respectively from three independent experiments. Data were analysed using a One-way Anova Kruskal-Wallis test. (H) Phase contrast images of a Control and VAPA KO individual cell displacing on fibronectin-coated glass during 5 minutes. The cell trajectory is shown in blue. Scale bar: 20 µm. (I, J) Analysis of cell velocity (I) and directionality coefficient (J) of Control and VAPA KO individual cells displacing on fibronectin-coated glass during at least 3 h (mean ± SEM; Control: n=64 cells; VAPA KO: n=33 cells from two independent experiments). data were analysed using non parametric Mann-Whitney t-test. (K) Epifluorescence images of Control, VAPA KO, VAPA KO +WT and VAPA KO +KDMD cells after 1 hour spreading on fibronectin-coated glass and stained as indicated. Scale bar: 50 µm. (L) Analysis of cells area after 1 hour spreading on fibronectin-coated glass (mean ± SEM; n=117, 134, 113, and 128 cells respectively from three independent experiments). Data were analysed using a One-way Anova Kruskal-Wallis test. (ns: non significant, ***p-values <0.001, **p-values <0.01, *p-values <0.05).

Figure 1—source data 1. Table containing the raw data used for the quantifications in Figure 1A, E, F, G, I, J and L.
Figure 1—source data 2. Folder containing the 2 original files of the full raw unedited blots for VAPA and Tubulin presented in Figure 1A and a figure with the uncropped annotated blots.

Figure 1.

Figure 1—figure supplement 1. Analysis of VAPB expression in VAPA KO cells.

Figure 1—figure supplement 1.

(A) Left panel: representative immunoblots showing the levels of VAPB and Tubulin in Control and VAPA KO cells. Tubulin level was used as loading control. Right panel: quantification of relative VAPB density in Control and VAPA KO cells normalized to Tubulin levels (mean ± SEM from three independent experiments). Data were analysed using a single-sample Student t-test (ns: non significant). (B) Confocal images of Control and VAPA KO leader cells immunostained for VAPB. Scale bar: 20 µm (5 µm in insets).
Figure 1—figure supplement 1—source data 1. Table containing the raw data used for the quantifications Figure 1—figure supplement 1A.
Figure 1—figure supplement 1—source data 2. Folder containing the 2 original files of the full raw unedited blots for VAPB and Tubulin presented in Figure 1—figure supplement 1A and a figure with the uncropped annotated blots.

Video 1. Phase contrast movie showing collective migration behaviour of Control cells, VAPA KO cells, VAPA KO cells expresing Cherry-VAPA WT (VAPA KO +WT) or Cherry-VAPA KDMD (VAPA KO +KDMD) 48 hr after space release.

Download video file (3.1MB, mp4)

Scale bar: 100 µm. Time stamp is hour:min.

VAPA regulates focal adhesions and actin cytoskeleton through its MSP domain

In order to characterize the motility defects of VAPA KO cells, we studied the organization of cell-matrix adhesions and actin cytoskeleton in these cells. To facilitate the analysis, we decided to focus on leader cells, standing at the leading edge of migrating monolayers (24–48 hr after insert removal), as these cells move in a given direction with a polarized and reproducible morphology. We observed an alteration of cell-matrix adhesions in VAPA KO cells that formed larger central FA compared to Control cells (Figure 2A and B). Peripheral FA, located at the leading edge tip where nascent adhesions form, exhibited the same size in Control and VAPA KO cells (Figure 2A and C). The expression of VAPA WT in VAPA KO cells restored the size of central FA, but it was not the case with VAPA KDMD, indicating that VAPA regulates FA size through its association with proteins containing an FFAT motif (Figure 2A–C). We then compared the organization of actin cytoskeleton in the four cell lines. In Control cells, the F-actin and cortactin stainings revealed the presence of numerous and thick parallel transverse actin arcs at the front, accompanied by cortactin-rich subdomains of branched actin standing at the front edge corresponding to lamellipodial extensions (Figure 2D and E). We indeed observed periodic waves of protrusion-retraction arising in these cells every 15 min in average (Figure 2E and H). By contrast, VAPA KO cells exhibited disorganized and thinner transverse actin arcs, wider cortactin-rich subdomains occupying most of the leading edge (Figure 2D and F–G) and giving rise to long-lasting protrusions (Figure 2E and H). Similarly to the FA phenotype, we were able to recover the organization of actin, the size of cortactin-rich domains and the frequency of protrusions by expressing VAPA WT but not the MSP mutant VAPA KDMD (Figure 2D and F–H). To conclude, we show that VAPA controls different aspects of cell motility, namely the maintenance of FA size and the preservation of the spatial and temporal organization of the actin cytoskeleton. These functions depend on the association of VAPA with FFAT-motif containing proteins such as lipid transfer proteins, suggesting that lipid transfer is probably required.

Figure 2. VAPA regulates focal adhesions and actin cytoskeleton through its MSP domain.

Figure 2.

(A) Confocal images with zoom boxes of central (green squares) and peripheral (blue squares) paxillin-labeled focal adhesions from Control, VAPA KO, VAPA KO +WT and VAPA KO +KDMD leader cells in migrating monolayers 24 -48hr after insert removal. Scale bar: 20 µm (2 µm in insets). (B, C) Analysis of central (B) and peripheral (C) focal adhesion area quantified from images in A, in Control, VAPA KO, VAPA KO +WT and VAPA KO +KDMD leader cells (Control: n=2968 central and 353 peripheral focal adhesions from 20 cells, VAPA KO: n=4329 central and 293 peripheral focal adhesions from 22 cells, VAPA KO +WT: n=3818 central and 336 peripheral focal adhesions from 24 cells, VAPA KO +KDMD: n=2801 central and 297 peripheral focal adhesions from 19 cells, from three independent experiments). Data were analysed using a One-way Anova Kruskal-Wallis test.( D) Confocal images of actin cytoskeleton network in Control, VAPA KO, VAPA KO +WT and VAPA KO +KDMD leader cells stained for cortactin and F-actin. Green arrows point to F-Actin transversal arcs. Plot profiles of the cortactin signal along the leading edge are shown on the right. Pink lines highlight the cortactin-rich protrusive subdomains. Scale bar: 20 µm.( E) Differential Interference Contrast (DIC) images (left) and kymographs (right) along the yellow lines of Control and VAPA KO leader cells from a 30 min movie at 1 frame every 3 seconds, showing protrusion and retraction phases of the leading edge. Scale bar: 20 µm (left) and 5 µm (right). (F, G) Analysis of proportion of the leading edge enriched with cortactin (F) and mean size of cortactin-enriched domains at the leading edge normalized to the length of the leading edge (G) quantified from images in D (mean ± SEM; n=29 cells for each cell line, from three independent experiments). Data were analysed using a One-way Anova Kruskal-Wallis test. (H) Quantification of protrusion phases frequency per 30 min quantified from the kymographs in E, in Control, VAPA KO, VAPA KO +WT and VAPA KO +KDMD leader cells (mean ± SEM; n=16, 21, 17 and 12 cells respectively, from three independent experiments). Data were analysed using a non parametric Mann-Whitney t-test. (ns: non significant, ***p-values <0.001, **p-values <0.01, *p-values <0.05).

Figure 2—source data 1. Table containing the raw data used for the quantifications Figure 2B, C, D, F, G and H.

VAPA controls the levels of PI(4)P and PI(4,5)P2 at the PM, but is not essential for PI(4)P homeostasis in the Golgi and endosomal compartments

We then intended to decipher the mechanisms by which VAPA could regulate FA size, the actin cytoskeleton and cell motility. To test the lipid transfer hypothesis, we first characterized to which extend its deletion affected PInst homeostasis. Previous studies have shown that depleting both VAPA and VAPB affected the levels of PI(4)P at the Golgi and PM (Mao et al., 2019; Stefan et al., 2011), and induced the accumulation of PI(4)P in early endosomes (Dong et al., 2016). Using a GFP-PH-OSBP probe, we detected a major intra-cellular pool of PI(4)P at similar levels in the Golgi compartment in Control and VAPA KO cells (Figure 3A–C). Importantly, the depletion of VAPA alone was not sufficient to observe an accumulation of PI(4)P in early endosomes (Figure 3B and C) which is in agreement with the SupFig. S1D by Dong et al., 2016 showing no effect on intra-cellular PI(4)P distribution when only VAPA is depleted in HeLa cells. This result suggests that VAPB, which is slightly more abondant in VAPA KO cells, can compensate for the absence of VAPA at ER-Golgi and ER-endosome contact sites thus maintaining PI(4)P homeostasis at the Golgi and endosomes in VAPA KO Caco-2 cells. We then analyzed the amount of PI(4)P and PI(4,5)P2 at the PM using the mCherry-P4M SidM (Hammond et al., 2014) and the RFP-PH-PLCδ1 probes respectively. The depletion of VAPA induced a decrease of the PM/cytosol ratio for both PI(4)P and PI(4,5)P2 in protrusive sub-domains of the leading edge (Figure 3D, E, H and I). The decrease of PI(4,5)P2 in VAPA KO cells was also observed at the dorsal side of the PM by immunofluorescence staining with anti-PI(4,5)P2 antibodies (Figure 3F and G). Altogether, these results show that in Caco-2 cells, VAPA is required to maintain a certain level of PI(4)P and PI(4,5)P2 specifically at the plasma membrane, but is dispensable for PI(4)P homeostasis at the Golgi and endosomal compartments.

Figure 3. VAPA controls PInst homeostasis at the PM, but not in other compartments.

Figure 3.

(A, B) Confocal images and zoom boxes of PI(4)P distribution in Control and VAPA KO leader cells expressing GFP-PH-OSBP and immunostained for TGN46 (A) or EEA1 (B). Scale Bar: 10 µm. (C) Analysis of Golgi(TGN46)/cytosol (left panel) and Early endosomes(EEA1)/Cytosol (right panel) ratio of GFP-PH-OSBP signal, quantified from images in A and B, in Control and VAPA KO leader cells (Left panel: n=24–25 cells, Right panel: n=13 cells; from three independent experiments). (D, H) Top: Sum projection of confocal images of PI(4)P (D) and PI(4,5)P2 (H) distribution in Control and VAPA KO leader cells expressing mCherry-P4M SidM or RFP-PH-PLCδ1 respectively, represented as a color-coded heat map. Scale bar: 10 µm. Bottom: Plot profiles of normalized grey levels along the pink lines. (E, I) Analysis of PM/Cytosol ratio of mCherry-P4M SidM (E) and RFP-PH-PLCδ1 (I), quantified from plot profiles represented in D and H respectively, in protrusive domains at the leading edge of Control and VAPA KO leader cells (E: n=14–16 cells, I: n=26–27 cells; from three independent experiments). (F) XZ view of confocal images of Control and VAPA KO cells immunostained for PI(4,5)P2. Scale Bar: 5 µm. (G) Analysis of PI(4,5)P2 peak intensity, quantified from images in F, in Control and VAPA KO leader cells (Control: n=58 cells; VAPA KO: n=53 cells, from three independent experiments). All data were analysed using non parametric Mann-Whitney t-test (ns: non significant, ***p-values <0.001, **p-values <0.01, *p-values <0.05).

Figure 3—source data 1. Table containing the raw data used for the quantifications Figure 3C, D, E, G, H and I.

VAPA stabilizes ventral ER-PM contact sites at the front of migrating cells

Based on our observation pointing to a specific role of VAPA in PInst homeostasis at the PM, we questioned the spatio-temporal distribution of ER-PM contacts sites during cell migration and the role of VAPA in this organization. To this aim, we took advantage of a fluorescent probe, GFP-MAPPER, which selectively labels ER-PM contact sites (Chang et al., 2013). When expressed in Caco-2 cells, GFP-MAPPER distributed as foci along ER tubules both in Control and VAPA KO cells (Figure 4A) and appeared at ER-PM appositions detected by TIRF microscopy (Figure 4B and Video 2). Moreover, we could observe GFP-MAPPER foci along VAPA-containing ER tubules highlighted with an exogenous mCherry-VAPA WT protein expressed in Control cells (Figure 4C) or with an anti-VAPA antibody (Figure 4—figure supplement 1A). At the front of leader cells, GFP-MAPPER foci divided in two subpools: the dorsal subpool ongoing forward movement with the migrating cell and the ventral subpool remaining immobile relative to the substrate, suggesting that ventral ER-PM contact sites might be anchored to cell-matrix adhesions (Figure 4—figure supplement 1B and Video 3). Using electron microscopy, we were indeed able to identify numerous ER-PM contact sites sitting at the ventral leading edge of migrating cells (Figure 4D). At the ultrastructural level, the depletion of VAPA had no significant effect on ER-PM contact sites regardless of their location (Figure 4—figure supplement 1C–E). However, the dynamic analysis of GFP-MAPPER foci revealed that ventral ER-PM contact sites, which barely moved (400 nm/min on average) and persisted generally more than 10 min in Control cells, were significantly less stable both spatially and temporally in VAPA KO cells (Figure 4E–G and Video 4). To conclude, our results identify a sub-pool of ER-PM contact sites docked to the substrate at the front of migrating cells, and whose spatio-temporal stability requires VAPA. Together with the alteration of FA size in VAPA KO cells, these results prompted us to hypothesize that VAPA might accomplish a function at FA.

Figure 4. VAPA stabilizes ventral ER-PM contact sites at the front of migrating cells.

(A) TIRF microscopy images of GFP-MAPPER foci distribution along the ER in Control and VAPA KO leader cells expressing GFP-MAPPER and RFP-KDEL. Scale bar: 5 µm. (B) Sequential TIRF microscopy images of ER and GFP-MAPPER foci accumulation at the front of a Control leader cell expressing GFP-MAPPER and RFP-KDEL. Scale bar: 1 µm. (C) Confocal images of GFP-MAPPER foci distribution along Cherry-VAPA containing ER in Control cells transiently expressing Cherry-VAPA. Scale bar: 1 µm. (D) Transmission Electron Microscopy images of transversal cuts of a Control leader cell, showing the leading edge. Arrows point to ER-PM contact sites at the bottom of the cell. Scale bar: 1 µm (top) and 100 nm in insets 1 and 2. (E) Sequential TIRF microscopy images of GFP-MAPPER foci at the front of Control and VAPA KO leader cells expressing GFP-MAPPER. Individual GFP-MAPPER foci at each time point are pictured in the frames below images. Scale bar: 1 µm. (F, G). Analysis of the lifetime (F) and the speed (G) of ventral GFP-MAPPER foci, quantified from images in E, in Control and VAPA KO leader cells (Control: n=92 and 52 foci from 8 cells; VAPA KO: n=77 and 58 foci from 6 cells, from four independent experiments). All data were analysed using non parametric Mann-Whitney t-test (***p-values <0.001).

Figure 4—source data 1. Table containing the raw data used for the quantifications Figure 4F and G.

Figure 4.

Figure 4—figure supplement 1. Dynamic and ultrastructural analysis of ER-PM contact sites.

Figure 4—figure supplement 1.

(A) Confocal images of GFP-MAPPER foci distribution along anti-VAPA-stained ER in Control cells. On the right: plot profiles of normalized gray values along the two lines depicted in yellow. Scale bar: 1 µm. (B) Sequential spinning disk images of dorsal (magenta) and ventral (green) GFP-MAPPER foci at the front of a Control leader cell expressing GFP-MAPPER. Top and bottom plane images were color-coded in magenta and green respectively. Circles highlight single GFP-MAPPER foci at the dorsal (blue) and ventral (red) sides. Scale bar: 3 µm. (C) Representative Transmission Electron Microscopy images of a Control and a VAPA KO cell showing ER-PM contact sites. Scale bar: 0.3 µm. The ER compartment and the PM are pictured in the right framebox. (D, E). Analysis of the ER portion in contact with the PM (D) and the percentage of the PM in contact with the ER (E), quantified from images in A, in Control and VAPA KO leader cells (mean ± SEM; Control: n=25 cells: VAPA KO: n=14 cells, from three independent experiments). All data were analysed using non parametric Mann-Whitney t-test (ns: non significant).
Figure 4—figure supplement 1—source data 1. Table containing the raw data used for the quantifications Figure 4—figure supplement 1A and D and 1E.

Video 2. TIRF microscopy movie showing the accumulation of a GFP-MAPPER foci (green) at a site of close apposition between the ER (RFP-KDEL, Magenta) and the PM, at the front of a Control leader cell.

Download video file (130KB, mp4)

Scale bar: 1 µm.

Time stamp is min:sec.

Video 3. Confocal microscopy movie showing dorsal (magenta) and ventral (green) GFP-MAPPER foci at the front of a Control leader cell expressing GFP-MAPPER.

Download video file (486.6KB, mp4)

Circles highlight single GFP-MAPPER foci at the dorsal (blue) and ventral (red) sides.

Scale bar: 2 µm. Time stamp is min:s.

Video 4. TIRF microscopy movie showing the dynamics and tracks of GFP-MAPPER foci at the front of Control and VAPA KO leader cells expressing GFP-MAPPER.

Download video file (461.2KB, mp4)

Scale bar: 1 µm. Time stamp is min:s.

VAPA promotes microtubule-dependent FA disassembly

To further investigate the role of VAPA in FA turnover, we studied more precisely FA dynamics in Control and VAPA KO cells during cell migration by TIRF microscopy. While the assembly rate of FA was similar in both cell lines, their disassembly rate was slower in VAPA KO cells (Figure 5A–C). In addition, VAPA KO FA exhibited a longer lifetime in average, with a majority lasting at least 40 min, instead of 30 min in Control cells (Figure 5A and D). The expression of VAPA WT in VAPA KO cells restored the lifetime of FA, unlike VAPA KDMD mutant, indicating that not only the size of FA but also their lifetime depended on the interaction of VAPA with FFAT-containing proteins (Figure 5D). One way to disassemble FA is through clathrin-mediated endocytosis of integrins which has been shown to depend on microtubules (Ezratty et al., 2009; Ezratty et al., 2005). To test whether VAPA-mediated disassembly of FA relied on the microtubule network, we synchronized FA disassembly by nocodazole wash-out experiment in migrating cells and measured the evolution of FA size, as described previously. In Control cells, nocodazole wash-out induced the fast recovery of the microtubule network after 15 min (Figure 5—figure supplement 1A) concomitantly to the disassembly of FA attested by a 50% reduction of FA size. However, in VAPA KO cells, FA failed to disassemble upon microtubule recovery (Figure 5E and F). These results demonstrate that VAPA is required for microtubule-dependent FA disassembly during migration of Caco2 cells.

Figure 5. VAPA promotes microtubule-dependent FA disassembly.

(A) Sequential TIRF microscopy images of focal adhesions in Control and VAPA KO leader cells expressing mCherry-Vinculin. Scale Bar: 1 µm. (B, C) Analysis of assembly rate (B) and disassembly rate (C) of focal adhesions (FA), quantified from time-lapse images in A, in Control and VAPA KO leader cells (whisker plots with 10–90 percentile; Control: n=217 FA from 9 cells; VAPA KO: n=342 FA from 8 cells, from three independent experiments). Data were analysed using non parametric Mann-Whitney t-test. (D) Distribution of focal adhesion life times in Control, VAPA KO, VAPA KO +WT and VAPA KO +KDMD leader cells (Control: n=98 FA from 10 cells; VAPA KO: n=120 FA from 12 cells, VAPA KO +WT: n=79 FA from 8 cells, VAPA KO +KDMD: n=90 FA from 9 cells, from three independent experiments). Data were analysed using a One-way Anova Kruskal-Wallis test. (E) Confocal images of focal adhesions after nocodazole treatment and wash-out in migrating Control and VAPA KO leader cells immunostained for paxillin. Scale bar: 10 µm (2 µm in insets). (F) Analysis of relative focal adhesions (FA) size, quantified from images in E, in Control and VAPA KO leader cells after 0 min, 15 min, 30 min, and 60 min after nocodazole wash-out (FA from 22 to 25 cells were analysed, from 3 independent experiments. Control T0min: n=6053 FA; Control T15 min: n=5146 FA; Control T30 min: n=5543 FA; Control T60 min: n=3913 FA; VAPA KO T0 min: n=4481 FA, VAPA KO T15 min: n=3878 FA, VAPA KO T30 min: n=4165 FA; T60 min: n=4889 FA). Data were analysed using non parametric Mann-Whitney t-test. (ns: non significant, ***p-values <0.001, **p-values <0.01, *p-values <0.05).

Figure 5—source data 1. Table containing the raw data used for the quantifications Figure 5B, C, D and F.

Figure 5.

Figure 5—figure supplement 1. Organisation of microtubules after nocodazole treatment and wash-out.

Figure 5—figure supplement 1.

(A) Sequential Confocal images of microtubules before and after 2 hr treatment with nocodazole, followed by wash-out during indicated time in Control leader cells immunostained for tubulin.
Scale bar: 10 µm.

VAPA mediates the stable anchoring of ER-PM contact sites to FA before their disassembly

To understand the function of VAPA at FA, we analysed the repartition and the dynamic of ventral ER-PM contact sites relative to FA by TIRF microscopy. In Control cells, the majority of central FA (75%) exhibited one or more GFP-MAPPER foci in their vicinity (Figure 6A and B). Using super-resolutive Structured Illumination Microscopy (SIM), we could determine that the peaks of the most proximal GFP-MAPPER foci partially superposed on the peaks of FA, with a distance of around 50–150 nm at 50% of the peaks, suggesting that the two elements were either in contact or in close proximity. Some GFP-MAPPER foci were even found inside the perimeter of FA (Figure 6—figure supplement 1A). In VAPA KO cells, only 30% of central FA were standing proximal to at least one GFP-MAPPER foci (Figure 6A and B). The expression of VAPA WT or the mutant VAPA KDMD in VAPA KO cells restored the high percentage of central FA proximal to GFP-MAPPER foci (Figure 6B), indicating that the MSP domain of VAPA was not required for the physical proximity between central FA and ER-PM contact sites. Unlike central FA, almost none of the peripheral FA were proximal to GFP-MAPPER foci (Figure 6B), suggesting that ER-PM contact sites are probably getting closer to FA after their assembly. Indeed, when we monitored the time course of mCherry-Vinculin and GFP-MAPPER signals within the perimeter of single FA by TIRF microscopy, we could establish that in Control cells, for most FA (71,4%), the first GFP-MAPPER foci appearing in the FA vicinity was detected after FA assembly and before its disassembly, with a preferential arrival within the 10 min preceding disassembly (Figure 6C–E). Once detected, this first GFP-MAPPER foci seemed to anchor to the pre-existing FA, as it was persisting 6 min on average in the FA vicinity (Figure 6C and F). In VAPA KO cells, where only 30% of FA were found in proximity to GFP-MAPPER foci (Figure 6A–B), there was no preferential time distribution of arrival of the first GFP-MAPPER foci, with 47,6% of them arriving before FA disassembly and 52.4% after FA disassembly (Figure 6C–E). Once detected, these foci were rapidly moving away (Figure 6C and F). These results show that VAPA is required for the stable anchoring of ER-PM contact sites to pre-existing FA before and at the time of FA disassembly. Imporantly, we were able to detect by TIRF microscopy the presence of VAPA at GFP-MAPPER foci proximal to FA (Figure 6G and H) reinforcing the idea that VAPA is indeed playing a role there.

Figure 6. VAPA mediates the stable anchoring of ER-PM contact sites to FA before their disassembly.

(A) TIRF microscopy images of GFP-MAPPER and focal adhesions in Control and VAPA KO leader cells expressing GFP-MAPPER and mCherry-Vinculin. Scale bars: 10 µm (1 µm in insets). (B) Analysis of the percentage of central (top) or peripheral (bottom) focal adhesions in contact with GFP-MAPPER foci in Control, VAPA KO, VAPA KO +WT and VAPA KO +KDMD leader cells (n=10–12 cells, from three independent experiments). Data were analysed using a One-way Anova Kruskal-Wallis test. (C) Sequential TIRF microscopy images of GFP-MAPPER foci and focal adhesions before and after its disassembly in a Control and 2 representative VAPA KO leader cells expressing GFP-MAPPER and mCherry-Vinculin. Scale bar: 1 µm. (D) Time course of GFP-MAPPER (green) and mCherry-Vinculin (magenta) signals during the lifetime of focal adhesions in the yellow ROI depicted in C. The signals were smoothed, readjusted to the minimal value and expressed as % of the maximal value. (E) Histogram representing the repartition of first anchoring time of GFP-MAPPER foci relative to focal adhesion disassembly in Control and VAPA KO leader cells, quantified from images in D (n=21 focal adhesions from 7 cells from three independent experiments). (F) Analysis of duration of the first anchoring of GFP-MAPPER foci to focal adhesions in Control and VAPA KO leader cells, from images in D (n=21 focal adhesions from 7 cells from three independent experiments). Data were analysed using a non parametric Mann-Whitney t-test. (G) TIRF microscopy images of iRFP-Vinculin, GFP-MAPPER and Cherry-VAPA WT in a VAPA KO leader cell. Scale bar: 2 µm. (H) Plot profiles of normalized grey levels along the two lines depicted in G. (ns: non significant, ***p-values <0.001, **p-values <0.01, *p-values <0.05).

Figure 6—source data 1. Table containing the raw data used for the quantifications Figure 6B, D, E, F and H.

Figure 6.

Figure 6—figure supplement 1. Analysis of proximity between FA and GFP-MAPPER foci by super-resolution microscopy.

Figure 6—figure supplement 1.

(A) Two examples of images obtained by epifluorescence and structured illumination microscopy (SIM), in Control leader cells expressing GFP-MAPPER and mCherry-Vinculin. Scale bar: 0.5 μm (100 nm in insets). The proximity between focal adhesions and GFP-MAPPER foci obtained by SIM is illustrated in plot profiles of normalized gray values along the blue lines.
Figure 6—figure supplement 1—source data 1. Table containing the raw data used for the quantifications Figure 6—figure supplement 1A.

Discussion

In this work, we identify VAPA as an essential player in cell motility, with implications in different aspects of this process. We show that VAPA is required for both single and collective cell migration, cell spreading, protrusive waves, actin cytoskeleton dynamics and FA turnover. These processes require the MSP domain of VAPA, suggesting that they are regulated through VAPA-mediated lipid transfer mechanisms.

Our study reveals a non-redundant function for VAPA in cell motility among the VAP family of proteins in Caco2 cells. Indeed, the presence of endogenous VAPB in VAPA KO cells, even at slightly higher levels, was not sufficient to compensate the loss of VAPA. The function of VAPA in cell migration seems to arise from its specific role at ER-PM contact sites where it was necessary to maintain high levels of PI(4)P and PI(4,5)P2 independently of VAPB. It was not the case at the Golgi or endosomes, where the depletion of VAPA alone had no effect on PI(4)P levels, which is in agreement with previous observations by Dong et al in HeLa cells depleted for VAPA only (SupFigS1D of Dong et al., 2016). This suggests that VAPB might compensate for the absence of VAPA at ER-Golgi and ER-endosomes contact sites and that migration defects in VAPA KO cells were not a result of a dysfunction of lipid transfer in the secretory pathway. Together with previous studies (Dong et al., 2016; Mao et al., 2019; Peretti et al., 2008; Stefan et al., 2011), our results converge to the idea that VAPA and VAPB might fulfill both redundant and specific tasks in lipid homeostasis and cellular functions.

PI(4,5)P2 and its phosphorylation product PI(3,4,5)P3 have been described for decades as central orchestrators of cell motility through regulation of actin dynamics, FA maturation and turnover, membrane organization and curvature, and intracellular trafficking (Mandal, 2020; Tsujita and Itoh, 2015). Notably, several previous studies have shown that altering the global synthesis of PI(4,5)P2, either by knockdown of certain isoforms of the PIPKI kinase which phosphorylates PI(4)P (Chao et al., 2010a, Chao et al., 2010b; Thapa et al., 2012), or by optogenetic approaches (Idevall-Hagren et al., 2012; Xiong et al., 2016), results in defects that are comparable to the ones observed in VAPA KO cells – namely disorganization of actin, protrusion defects, FA persistence and loss of directional movement. Thus, the phenotypes of VAPA KO cells could be solely explained by a global reduction in PI(4,5)P2 levels at the PM. However, our results clearly show that VAPA not only regulates PI(4,5)P2 homeostasis at the PM, but also fulfills a function at FA where it stably anchors ER-PM contact sites and promotes microtubule-dependent FA disassembly. Importantly, we provide for the first time a quantitative spatio-temporal connection between ER-PM contact sites and FA dynamics in polarized and migrating cells.

Ideas and speculation

Based on these results, we propose a hypothetical model in which VAPA, through local regulation of lipid transfer in the vicinity of FA would induce the internalization of integrins through clathrin-mediated endocytosis which depends on PI(4,5)P2 levels (Chao et al., 2010a, Chao et al., 2010b; Nader et al., 2016) and on microtubule polymerization (Ezratty et al., 2009). Interestingly, MCS have already been shown to directly regulate endocytosis in yeast (Encinar Del Dedo et al., 2017).

Through which mechanisms could VAPA control the dynamics of FA and their close proximity with ER-PM contact sites? Our results show that the MSP domain of VAPA is required for the regulation of FA dynamics. Importantly, two lipid transfer proteins interacting with VAPA at ER-PM contact sites, Nir2 and ORP3, have been previously described as regulators of FA dynamics and cell motility, establishing them as potential drivers for the specific function of VAPA at FA. Nir2, which interacts with VAPs at ER-PM and ER-Golgi contact sites and regulates PI transport (Chang and Liou, 2015; Kim et al., 2013; Peretti et al., 2008), favors epithelial-mesenchymal transition and tumor metastasis (Keinan et al., 2014). Similarly to VAPA KO cells, the depletion of Nir2 in HeLa cells induces a decrease of PI(4,5)P2 levels at the PM (Kim et al., 2013), indicating that a part of VAPA effect on PInst homeostasis could be supported by VAPA/Nir2-mediated lipid transfer. ORP3, which extracts PI(4)P from the PM at ER-PM contact sites (Gulyás et al., 2020), positively regulates the R-Ras pathway promoting cell-matrix adhesion (Lehto et al., 2008; Weber-Boyvat et al., 2015). More recently, ORP3 was found to be recruited to disassembling FA upon calcium influx and to favour their turnover through lipid exchange and crosstalk with STIM1/Orai1-mediated calcium influx (D’Souza et al., 2020).

But VAPA might not act at FA just through its MSP domain. Indeed, we show that VAPA favours the proximity between FA and ER-PM contact sites independently of its MSP domain. Thus, we could imagine that VAPA also associates to FFAT-lacking proteins that would mediate the anchoring of ER to FA. Previous studies have highlighted the role of ER proteins in FA turnover and maturation that could be potential candidates. Kinectin, an integral ER membrane protein interacting with kinesin, has been shown to control the apposition of ER to FA through a microtubule-dependent transport (Guadagno et al., 2020; Ng et al., 2016). Another protein, the phosphatase PTP1B, which localizes to the cytoplasmic face of the ER and was identified as a partner of VAPA using a BioID approach (Antonicka et al., 2020), is targeted to newly formed FA and contributes to their maturation through dephosphorylation of its substrate p130Cas (Dadke and Chernoff, 2002; Hernández et al., 2006; Liu et al., 1998).

Therefore, the role of VAPA-mediated contact sites at FA could not only be the local modulation of lipid transfer, but also the establishment of a common platform mediating the anchoring of ER and microtubules close to FA where several processes, like lipid transfer, calcium exchange and vesicular transport could converge and participate to FA dynamics.

To conclude, our study reveals unknown functions for VAPA in cell motility processes and in local anchoring of ER-PM contact sites to FA. For a long time, we have assumed that PInst regulation at FA will principally be mediated by the interplay of lipid kinases and phosphatases. Our work reinforces the idea that lipid transfer would be an additional pathway for lipids to be controlled at FA and provides evidences for a spatio-temporal connection between MCS and FA mediated by VAPA. Finally, this work opens new roads to decipher the precise molecular determinants of VAPA function and to explore the role of VAPA during cancerogenesis.

Materials and methods

The complete list of materials is provided in Supplementary file 1.

Cell culture

CaCo-2 cells, originally acquired from ATCC, were kindly provided by Dr. D. Delacour (IBDM, Marseille). No mycoplasma contamination was detected. CaCo-2 CRISPR control and VAPA knock-out cell lines were maintained in culture in DMEM (1 x) GlutMax 5 g/L D-glucose +pyruvate medium (Gibco) supplemented with 20% fetal bovine serum (Gibco), 100 units/mL penicillin, 100 µg/mL streptomycin and 2 µg/Ml (Gibco) puromycin in 5% CO2 at 37 °C.

Antibodies, reagents, and plasmids

The following primary antibodies were used: mouse anti-EEA1 monoclonal antibody (BD transduction), rabbit anti-VAPB polyclonal antibody (Atlas antibody), mouse anti-VAPA monoclonal antibody and rabbit anti-VAPA polyclonal antibody for the immunoblot (Sigma), rabbit anti-TGN46 polyclonal antibody (Abcam), mouse anti-paxilline monoclonal antibody (Merck), mouse anti-cortactin monoclonal antibody (Merck), mouse anti-tubulin monoclonal antibody (GeneTex), mouse anti-PI(4,5)P2 monoclonal IgM antibody (Echelon). The following secondary antibodies were used: goat anti-mouse IgM Alexa fluor 555 or Alexa fluor 488, goat anti-mouse IgG Alexa fluor 555 or Alexa fluor 488, goat anti-rabbit IgG Alexa fluor 555 or Alexa fluor 488 (Invitrogen).

The following reagents were used: Hu Plasma Fibronectin (Sigma); Methanol-free formaldehyde (Thermofisher); Fluoromont-G with DAPI (Invitrogen); Alexa fluor 647-conjugated Phalloidin (Invitrogen).

The following plasmids were used; pEGFP-MAPPER (long version, containing the two flexible helical linkers, (EAAAR) 4 and (EAAAR) 6, upstream and downstream flanking regions of the FRB, respectively) was a kind gift from Jen Liou (UT Southwestern Medical Center, USA) (Chang et al., 2013), pmCherry-Vinculin was a gift from Chinten James Lim (Addgene plasmid # 80024; http://n2t.net/addgene:80024; RRID:Addgene_80024; Lee et al., 2013); iRFP-Vinculin was a gift from Mathieu Coppey (Institut Curie, CNRS UMR168) (Valon et al., 2017); pEGFP-PH-OSBP was a gift from Marci Scidmore (Addgene plasmid # 49571; http://n2t.net/addgene:49571; RRID:Addgene_49571; Moorhead et al., 2010) pmRFP-PH-PLCδ1 was a kind gift from Francesca Giordano (Institute for Integrative Biology of the Cell, France) Giordano et al., 2013; mCherry-P4M-SidM was a gift from Tamas Balla (Addgene plasmid # 51471; http://n2t.net/addgene:51471; RRID:Addgene_51471; Hammond et al., 2014) pmRFP-KDEL plasmid was a kind gift from Nihal Altan-Bonnet (National Heart Lung and Blood Institute, NIH, USA) Altan-Bonnet et al., 2006; pmCherry-VAPA and pmCherry-VAPA KD/MD, obtained from pEGFP-VAPA and pEGFP-VAPA KD/MD, were kind gifts from Fabien Alpy (IGBMC, France) Alpy et al., 2013; CRISPR-Cas9-resistant pmCherry-VAPA and pmCherry-VAPA KD/MD plasmids were obtained by mutagenesis of pmCherry-VAPA and pmCherry-VAPA KD/MD plasmids. Briefly, pmCherry-VAPA and pmCherry-VAPA KD/MD plasmids were amplified by PCR (30 cycles of 10 s at 94 °C, 5 s at 55 °C and 6 min at 72 °C) using the forward 5’TAAGACCGAATTCCGGTATCATCGATCCAGGGTCAACTGTGACTGTTTCAGT 3’ and reverse 5’ CGGAATTCGGTCTTACGCAATATCGTCGAGGTGCTGTAGTCTTCACTTTGA 3’ primers. PCR products were digested by DpnI enzyme for 2 hr at 37 °C (Agilent) and loaded on a 1% Agarose Gel. PCR amplicons were extracted, purified using the NucleoSpin Gel and PCR clean up kit (Macherey-Nagel) and ligated using the NEBuilder HiFi DNA assembly kit (BioLabs).

Transfection

For each transfection, 0.5 million Caco2 cells were nucleofected with 2 µg of DNA in 100 µL of T solution using the B024 program on Amaxa Nuclefector II machine, as recommended by the manufacturer (Lonza). CaCo-2 transfected cells were then re-suspended in warm culture medium, replaced 24 hr later.

Production of CRISPR Cas9 cell lines

Cells were transfected as described above with the double nickase CRISPR Cas9 plasmid targeting human VAPA (Santa Cruz) or a double nickase CRISPR Cas9 Control plasmid (Santa Cruz). The following day, cells were incubated with puromycin at 2 µg/mL. After antibiotic selection, single GFP positive cells were sorted by flow cytometry. Clonal cells were maintained in culture with puromycin and the amount of VAPA protein was detected by western blot and immunofluorescence. VAPA KO cell lines expressing exogenous Cherry-VAPA and Cherry-VAPAKDMD were obtained by transfection of VAPA KO cells with CRISPR-Cas9-resistant pmCherry-VAPA and pmCherry-VAPA KD/MD plasmids. Stable cell lines were generated by selection with Geneticin (Gibco) and sorting of Cherry-positive populations by flow cytometry.

Western blotting

Confluent cells were lysed in 100 mM Tris pH 7.5, 150 mM NaCl, 0.5% NP40, 0.5% triton-X100, 10% glycerol,1X protease inhibitor cocktail (Roche) and 1 X phosphatase inhibitor (Roche) for 20 min at 4 °C. After 15 min centrifugation at 13,000 g, solubilized proteins were recovered in the supernatant. Protein concentration was measured using Bradford assay (Bio-Rad). For SDS PAGE, 50 µg protein extracts were loaded in 4–12% Bis-Tris gel (Invitrogen) or poly-acrylamide gels and proteins were transferred overnight at 4 °C on a nitrocellulose membrane using a liquid transfer system (Bio-Rad). Non-specific sites were blocked with 5% non-fat dry milk in PBS 0.1% Tween 20. Primary antibodies were diluted (1/1000 to 1/500) in PBS 0.1% Tween 20 and incubated overnight at 4 °C. After three washes in PBS 0.1% Tween 20, secondary HRP antibodies diluted in PBS 0.1% Tween 20 (1/10,000) were incubated for 1 hr and washed three times with PBS 0.1% Tween 20. Immunocomplexes of interest were detected using Supersignal west femto maximum sensitivity substrate (Thermo Fisher Scientific) and visualized with ChemiDoc chemoluminescence detection system (Bio-Rad). Quantification of Western blots by densitometry was performed using the Gel analyzer plug in from Image J.

Immunofluorescence

Cells were fixed with pre-warmed 4% formaldehyde in PBS for 15 min at RT and then washed three times with PBS. For anti-tubulin immunostaining, cells were fixed with frozen Methanol for 15 min at RT. Permeabilization and blocking were performed in 0.05% saponin/0.2% BSA in PBS for 15 min at RT. The primary antibodies diluted in Saponin/BSA buffer were then incubated overnight at 4 °C. After three washes in saponin/BSA buffer, the samples were incubated with secondary antibodies and, when indicated, Alexa-coupled phalloidin to stain F-Actin in the same buffer for 1 hr at RT. The preparations were washed twice in saponin/BSA buffer, once in PBS, and then mounted with the DAPI Fluoromount-G mounting media.

Immunostaining with anti-PI(4,5)P2 antibody was performed as described by Kim et al., 2013. Briefly, cells were fixed at 4 °C for 1 hr in 3.7% formaldehyde / 0.1% glutaraldehyde and incubated in PBS containing 0.1 M glycine for 15 min. Permeabilization, blocking and staining were performed as described above, at 4 °C.

Cell migration assays

Collective migration assays were performed using 2-well silicon inserts (Ibidi). Glass coverslips were coated with fibronectin solution at 20 µg/mL in water, for 1 hr at room temperature. The cover slip surface was washed with sterile water and air-dried. Ibidi inserts were deposited on the fibronectin coated surface and 40,000–50,000 cells were loaded per well. For fluorescence live imaging, cells were directly plated after transfection in the well. After 3–4 hr of incubation, cell division was blocked using mitomycin at 10 µg/mL in CaCo-2 culture medium, for 1 hr. After overnight incubation in a fresh CaCo-2 culture medium, the insert was removed. Experiments were performed 24 hr to 48 hr after insert removal.

For individual cell migration, cell division was blocked using mitomycin at 10 µg/mL in CaCo-2 culture medium, for 1 hr. After overnight incubation in a fresh CaCo-2 culture medium, cells were detached and plated on a glass coverslip coated with 20 µg/mL fibronectin. After 6 hr, cells were imaged for 24 hr.

Collective and individual cell migration assays were performed using a Zeiss Wide-Field Microscope and imaged at 1 frame every 10 min. Cell trajectories were analysed using Manual Tracking from Fiji. Cell directionality was calculated as the ratio between the net displacement and the trajectory length within the last 20 hr of collective migration.

Cell spreading assay

Cells were incubated for 1 hr on fibronectin-coated coverslips and fixed with formaldehyde 4% solution as described in the immuno labelling section. Coverslips were mounted on slides and samples were imaged using a Zeiss Apotome fluorescence microscope equipped with a 10 x objective. The spreading area was determined based on Phalloidin-segmented ROI in Fiji/ImageJ.

Nocodazole experiment

The nocodazole wash-out experiment was adapted from Ezratty et al., 2005. Briefly, cells were collected and resuspended in starvation medium (DMEM GlutaMax medium containing 1% fetal bovine serum and 1% of penicillin/streptomycin) and plated in the silicon insert, as described in the Migration assay section. Twenty-four hours later, the insert was removed and cells were left migrating in the starvation medium during 24 hr. Cells were then treated during 2 hr with 10 µM nocodazole diluted in starvation medium. Then, nocodazole was washed-out with starvation medium and cells were fixed either immediately (‘0 min Wash-out’) or after 15, 30, or 60 min wash-out, using 4% formaldehyde. Focal adhesions and microtubules were labelled as described above.

Electron microscopy

Migrating cells were fixed in a 2% formaldehyde/1% glutaraldehyde in PBS solution for 1 hr at room temperature, then washed in PBS. Cells were embedded in a gel of 10% BSA and 10% gelatin. Post fixation was performed in reduced osmium (1% OsO4 +1% K3Fe(CN)6) in water at 4 °C for 1 hr. After extensive washes, cells were incubated in 1% Thiocarbohydrazine in water for 20 min at room temperature and then washed and incubated with 2% OsO4 in water for 30 min at room temperature. After washes, cells were contrasted with 1% uranyl acetate overnight at 4 °C. The following day, the uranyl acetate solution was removed and the samples washed using pure water. Cells were incubated with a pH 5.5 lead nitrate in aspartic acid solution for 30 min at room temperature, washed in water and dehydrated in successive ethanol baths. Cells were embedded in Agar Low Viscosity Resin (Agar Scientific). 70 nm-thick thin sections were cut using a UC6 ultramicrotome from Leica and deposited on EM grids. Electron microscopy acquisitions were performed using a 120kV Tecnai 12 electron microscope (ThermoFisher) equiped with a OneView 4 K camera (Gatan).

Analysis of protrusive activity

The analysis of protrusive activity was performed on DIC images acquired every 3 s for 30 min. Kymographs representing the evolution of the leading edge in time along a line were generated and analysed with Fiji. Positive slopes were considered as protrusions and negative slopes as retractions. For each cell, the mean time spent in protrusion and the mean frequency of protrusions.was calculated from 2 to 4 kymographs.

Measurement of focal adhesion assembly and disassembly

Cells were transfected as described above using the mCherry-Vinculine plasmid and migration assays were performed on fibronectin coated 1.5 H Glass bottom Dishes (Ibidi). Cells were imaged using a TIRF microscope at 1 frame every minute for 1–2 h. Focal adhesion assembly and disassembly rates were obtained using the focal adhesion analysis server (https://faas.bme.unc.edu/; Berginski and Gomez, 2013). Focal adhesion assembly and disassembly rate tracks were generated. The tracks with a R-squared equal to or greater than 0.8 were used for the analysis.

Quantification of PI(4)P and PI(4,5)P2 levels

To characterize the intracellular pool of PI(4)P at the Golgi and on endosomes, colocalization between the GFP-PH-OSBP and TGN46 or EEA1 signals were obtained using Fiji Pearson coefficient plugins. The relative levels of PI(4)P in the Golgi or in endosomes were calculated as the ratio between GFP-PH-OSBP signal in the Golgi or endosomes masks and GFP-PH-OSBP signal in the cytosol, using segmentation tools in Fiji.

The PM to cytosol signal ratios of Ch-P4M-SidM and RFP-PH-PLCδ1 were measured along lines of 5–15 microns at the leading edge of migrating cells, in protrusive domains where the signal was the most enriched. The ratio was calculated as the maximal peak intensity along the line divided by the mean intensity value of RFP-PH-PLCδ1 in the cytosol. The plots on the graph represent the mean of 3 ratios at 3 different locations per cell.

For the quantification of endogenous PI(4,5)P2, cells were immnuno-stained with anti-PI(4,5)P2 antibodies. Confocal imaging was performed using the same acquisition parameters between control and VAPA KO cells. For one z-section, three lines were drawn per cell and the mean of maximal fluorescence intensity at the peak was plotted.

Analysis of ER-PM contact sites on electron microscopy images

Electron microscopy images were analysed using Fiji/ImageJ. For the analysis, only ER-PM appositions of less than 30 nm distance were considered as ER-PM contact sites.

Analysis of GFP-MAPPER foci dynamics

GFP-MAPPER foci on TIRF images were tracked using the Manual Tracking plugin from Fiji. The speed corresponds to the mean of instantaneous speeds for each foci. The lifetime was determined visually on the basis of the intensity levels and corresponds the time spent between the first visual appearance of a foci and its visual disappearance.

Quantification of FA in contact with ER-PM contact sites

The quantification of FA in contact with ER-PM contact sites was performed on TIRF microscopy acquisitions. Ten to 30 FA were randomly selected per cell. An FA was considered to be in contact with an ER-PM contact sites if there was at least one pixel recovery between GFP-MAPPER signal and mCherry-vinculin signal.

Plot profiles quantification

The normalized grey levels represented in the plot profiles were obtained by first subtracting the minimal grey level to all raw grey levels, and then, by normalizing to the maximal grey level.

Images acquisition and analysis

For live-microscopy experiments, the samples were placed in a chamber equilibrated at 37 °C under 5% CO2 atmosphere.

Confocal live microscopy imaging was acquired using a Yokogawa CSU-X1 Spinning Disk confocal mounted on an inverted motorized Axio Observer Z1 (Zeiss) and equipped with a sCMOS PRIME 95 (photometrics) camera, using a 63 x/1.4 Plan-Apochromat Oil DIC objective.

TIRF and Super resolution 3D Lattice SIM images were acquired on a ELYRA 7 Zeiss microscope equipped with Two cameras Edge 4.2 CLHS (PCO), using 63 x/1,4 Plan-Apochromat Oil DIC M27 objective. Images were acquired and processed with SW ZEN Black 3.4 software.

For fixed samples, images were acquired with a Zeiss Apotome fluorescence microscope equipped with a 63 X oil immersion objective or with a Zeiss LSM 780 confocal microscope equipped with a 63 X/1.4 Plan-Apochromat Oil DIC objective at a resolution of 0.3 μm z-stacks. Image processing and analysis were done on Fiji software.

Acknowledgements

We thank Delphine Delacour, Fabien Alpy, Simon de Beco and the past and current members of Membrane Dynamics and Intracellular Trafficking team at Institut Jacques Monod for helpful discussions. We acknowledge the ImagoSeine core facility of the IJM, member of the France BioImaging infrastructure (ANR-10-INBS-04) and GIS-IBiSA, with support from La ligue contre le Cancer (R03/75-79), the Region Île-de-France (Sesame), Université Paris Cité (Labex Who am I?, ANR-11-LABX-0071, Idex ANR-11-IDEX-0005–02), Inserm (Plan Cancer), Région Ile de France (SESAME) and Fondation Bettencourt Schueller. This work was supported by grants from Gefluc groupement Les Entreprises Contre le Cancer (M.L.H), Cancéropôle Ile de France and INCa (M.L.H) (2021–1-EMERG-51), La Ligue contre le cancer (M.L.H) (RS23/75-66), Université Paris Cité (M.L.H) (Labex Who am I?, ANR-11-LABX-0071, Idex ANR-11-IDEX-0005–02) and the Agence Nationale de la Recherche (J-M.V) (ANR-20-CE13-0021). H.S was supported by fellowships from La Ligue contre le cancer and the Fondation pour la Recherche Médicale. M.L.H acknowledges René-Marc Mège, Benoît Ladoux and Delphine Delacour for kindly providing antibodies and plasmids during the starting period of this work.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Jean-Marc Verbavatz, Email: jean-marc.verbavatz@ijm.fr.

Mélina L Heuzé, Email: melina.heuze@ijm.fr.

Felix Campelo, Institute of Photonic Sciences, Spain.

Suzanne R Pfeffer, Stanford University, United States.

Funding Information

This paper was supported by the following grants:

  • Gefluc Les Entreprises contre le Cancer to Mélina L Heuzé.

  • Canceropôle Ile de France and INCa 2021-1-EMERG-51 to Mélina L Heuzé.

  • La Ligue contre le Cancer RS23/75-66 to Mélina L Heuzé.

  • Université Paris Cité Labex Who am I ?, ANR-11-LABX-0071, Idex ANR-11-IDEX-0005-02 to Mélina L Heuzé.

  • Agence Nationale de la Recherche ANR-20-CE13-0021 to Jean-Marc Verbavatz.

  • La Ligue contre le Cancer Doctoral Fellowship to Hugo Siegfried.

  • La Fondation pour la Recherche Médicale 4th year fellowship to Hugo Siegfried.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing.

Investigation.

Formal analysis, Investigation, Methodology.

Formal analysis, Investigation, Methodology.

Formal analysis, Investigation.

Investigation.

Formal analysis, Investigation.

Conceptualization, Supervision, Funding acquisition, Methodology, Writing – original draft, Project administration, Writing – review and editing.

Conceptualization, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing.

Additional files

MDAR checklist
Supplementary file 1. Complete list of materials used in this study indicating the references and dilutions used for the antibodies.
elife-85962-supp1.xlsx (17.3KB, xlsx)

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files; Source Data files have been provided for all figures.

References

  1. Alpy F, Rousseau A, Schwab Y, Legueux F, Stoll I, Wendling C, Spiegelhalter C, Kessler P, Mathelin C, Rio MC, Levine TP, Tomasetto C. STARD3 or STARD3NL and VAP form a novel molecular tether between late endosomes and the ER. Journal of Cell Science. 2013;126:5500–5512. doi: 10.1242/jcs.139295. [DOI] [PubMed] [Google Scholar]
  2. Altan-Bonnet N, Sougrat R, Liu W, Snapp EL, Ward T, Lippincott-Schwartz J. Golgi inheritance in mammalian cells is mediated through endoplasmic reticulum export activities. Molecular Biology of the Cell. 2006;17:990–1005. doi: 10.1091/mbc.e05-02-0155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Antonicka H, Lin ZY, Janer A, Aaltonen MJ, Weraarpachai W, Gingras AC, Shoubridge EA. A high-density human mitochondrial proximity interaction network. Cell Metabolism. 2020;32:479–497. doi: 10.1016/j.cmet.2020.07.017. [DOI] [PubMed] [Google Scholar]
  4. Berginski ME, Gomez SM. The Focal Adhesion Analysis Server: a web tool for analyzing focal adhesion dynamics. F1000Research. 2013;2:68. doi: 10.12688/f1000research.2-68.v1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chang CL, Hsieh TS, Yang TT, Rothberg KG, Azizoglu DB, Volk E, Liao JC, Liou J. Feedback regulation of receptor-induced Ca2+ signaling mediated by E-Syt1 and Nir2 at endoplasmic reticulum-plasma membrane junctions. Cell Reports. 2013;5:813–825. doi: 10.1016/j.celrep.2013.09.038. [DOI] [PubMed] [Google Scholar]
  6. Chang CL, Liou J. Phosphatidylinositol 4,5-bisphosphate homeostasis regulated by Nir2 and Nir3 proteins at endoplasmic reticulum-plasma membrane junctions. The Journal of Biological Chemistry. 2015;290:14289–14301. doi: 10.1074/jbc.M114.621375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chao WT, Ashcroft F, Daquinag AC, Vadakkan T, Wei Z, Zhang P, Dickinson ME, Kunz J. Type I phosphatidylinositol phosphate kinase beta regulates focal adhesion disassembly by promoting beta1 integrin endocytosis. Molecular and Cellular Biology. 2010a;30:4463–4479. doi: 10.1128/MCB.01207-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chao WT, Daquinag AC, Ashcroft F, Kunz J. Type I PIPK-alpha regulates directed cell migration by modulating Rac1 plasma membrane targeting and activation. The Journal of Cell Biology. 2010b;190:247–262. doi: 10.1083/jcb.200911110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dadke S, Chernoff J. Interaction of protein tyrosine phosphatase (PTP) 1B with its substrates is influenced by two distinct binding domains. The Biochemical Journal. 2002;364:377–383. doi: 10.1042/BJ20011372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Daste F, Walrant A, Holst MR, Gadsby JR, Mason J, Lee J-E, Brook D, Mettlen M, Larsson E, Lee SF, Lundmark R, Gallop JL. Control of actin polymerization via the coincidence of phosphoinositides and high membrane curvature. Journal of Cell Biology. 2017;216:3745–3765. doi: 10.1083/jcb.201704061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dong R, Saheki Y, Swarup S, Lucast L, Harper JW, De Camilli P. Endosome-ER contacts control actin nucleation and retromer function through VAP-dependent regulation of PI4P. Cell. 2016;166:408–423. doi: 10.1016/j.cell.2016.06.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dong J, Du X, Wang H, Wang J, Lu C, Chen X, Zhu Z, Luo Z, Yu L, Brown AJ, Yang H, Wu JW. Allosteric enhancement of ORP1-mediated cholesterol transport by PI(4,5)P2/PI(3,4)P2. Nature Communications. 2019;10:2. doi: 10.1038/s41467-019-08791-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. D’Souza RS, Lim JY, Turgut A, Servage K, Zhang J, Orth K, Sosale NG, Lazzara MJ, Allegood J, Casanova JE. Calcium-stimulated disassembly of focal adhesions mediated by an ORP3/IQSec1 complex. eLife. 2020;9:e54113. doi: 10.7554/eLife.54113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Encinar Del Dedo J, Idrissi F-Z, Fernandez-Golbano IM, Garcia P, Rebollo E, Krzyzanowski MK, Grötsch H, Geli MI. ORP-mediated ER contact with endocytic sites facilitates actin polymerization. Developmental Cell. 2017;43:588–602. doi: 10.1016/j.devcel.2017.10.031. [DOI] [PubMed] [Google Scholar]
  15. Ezratty EJ, Partridge MA, Gundersen GG. Microtubule-induced focal adhesion disassembly is mediated by dynamin and focal adhesion kinase. Nature Cell Biology. 2005;7:581–590. doi: 10.1038/ncb1262. [DOI] [PubMed] [Google Scholar]
  16. Ezratty EJ, Bertaux C, Marcantonio EE, Gundersen GG. Clathrin mediates integrin endocytosis for focal adhesion disassembly in migrating cells. The Journal of Cell Biology. 2009;187:733–747. doi: 10.1083/jcb.200904054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Funamoto S, Meili R, Lee S, Parry L, Firtel RA. Spatial and temporal regulation of 3-phosphoinositides by PI 3-kinase and PTEN mediates chemotaxis. Cell. 2002;109:611–623. doi: 10.1016/s0092-8674(02)00755-9. [DOI] [PubMed] [Google Scholar]
  18. Giordano F, Saheki Y, Idevall-Hagren O, Colombo SF, Pirruccello M, Milosevic I, Gracheva EO, Bagriantsev SN, Borgese N, De Camilli P. PI(4,5)P(2)-dependent and Ca(2+)-regulated ER-PM interactions mediated by the extended synaptotagmins. Cell. 2013;153:1494–1509. doi: 10.1016/j.cell.2013.05.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Guadagno NA, Margiotta A, Bjørnestad SA, Haugen LH, Kjos I, Xu X, Hu X, Bakke O, Margadant F, Progida C. Rab18 regulates focal adhesion dynamics by interacting with kinectin-1 at the endoplasmic reticulum. The Journal of Cell Biology. 2020;219:e201809020. doi: 10.1083/jcb.201809020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gulyás G, Sohn M, Kim YJ, Várnai P, Balla T. ORP3 phosphorylation regulates phosphatidylinositol 4-phosphate and Ca2+ dynamics at plasma membrane-ER contact sites. Journal of Cell Science. 2020;133:jcs237388. doi: 10.1242/jcs.237388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hammond GRV, Machner MP, Balla T. A novel probe for phosphatidylinositol 4-phosphate reveals multiple pools beyond the Golgi. The Journal of Cell Biology. 2014;205:113–126. doi: 10.1083/jcb.201312072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hammond GRV, Burke JE. Novel roles of phosphoinositides in signaling, lipid transport, and disease. Current Opinion in Cell Biology. 2020;63:57–67. doi: 10.1016/j.ceb.2019.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hannigan M, Zhan L, Li Z, Ai Y, Wu D, Huang CK. Neutrophils lacking phosphoinositide 3-kinase gamma show loss of directionality during N-formyl-Met-Leu-Phe-induced chemotaxis. PNAS. 2002;99:3603–3608. doi: 10.1073/pnas.052010699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hernández MV, Sala MGD, Balsamo J, Lilien J, Arregui CO. ER-bound PTP1B is targeted to newly forming cell-matrix adhesions. Journal of Cell Science. 2006;119:1233–1243. doi: 10.1242/jcs.02846. [DOI] [PubMed] [Google Scholar]
  25. Hua R, Cheng D, Coyaud É, Freeman S, Di Pietro E, Wang Y, Vissa A, Yip CM, Fairn GD, Braverman N, Brumell JH, Trimble WS, Raught B, Kim PK. VAPs and ACBD5 tether peroxisomes to the ER for peroxisome maintenance and lipid homeostasis. The Journal of Cell Biology. 2017;216:367–377. doi: 10.1083/jcb.201608128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Idevall-Hagren O, Dickson EJ, Hille B, Toomre DK, De Camilli P. Optogenetic control of phosphoinositide metabolism. PNAS. 2012;109:E2316–E2323. doi: 10.1073/pnas.1211305109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jackson CL, Walch L, Verbavatz JM. Lipids and their trafficking: an integral part of cellular organization. Developmental Cell. 2016;39:139–153. doi: 10.1016/j.devcel.2016.09.030. [DOI] [PubMed] [Google Scholar]
  28. Kaiser SE, Brickner JH, Reilein AR, Fenn TD, Walter P, Brunger AT. Structural basis of FFAT motif-mediated ER targeting. Structure. 2005;13:1035–1045. doi: 10.1016/j.str.2005.04.010. [DOI] [PubMed] [Google Scholar]
  29. Kamemura K, Chihara T. Multiple functions of the ER-resident VAP and its extracellular role in neural development and disease. Journal of Biochemistry. 2019;165:391–400. doi: 10.1093/jb/mvz011. [DOI] [PubMed] [Google Scholar]
  30. Kawasaki A, Sakai A, Nakanishi H, Hasegawa J, Taguchi T, Sasaki J, Arai H, Sasaki T, Igarashi M, Nakatsu F. PI4P/PS countertransport by ORP10 at ER-endosome membrane contact sites regulates endosome fission. The Journal of Cell Biology. 2022;221:e202103141. doi: 10.1083/jcb.202103141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Keinan O, Kedan A, Gavert N, Selitrennik M, Kim S, Karn T, Becker S, Lev S. The lipid-transfer protein Nir2 enhances epithelial-mesenchymal transition and facilitates breast cancer metastasis. Journal of Cell Science. 2014;127:4740–4749. doi: 10.1242/jcs.155721. [DOI] [PubMed] [Google Scholar]
  32. Kim S, Kedan A, Marom M, Gavert N, Keinan O, Selitrennik M, Laufman O, Lev S. The phosphatidylinositol‐transfer protein Nir2 binds phosphatidic acid and positively regulates phosphoinositide signalling. EMBO Reports. 2013;14:891–899. doi: 10.1038/embor.2013.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kunisaki Y, Nishikimi A, Tanaka Y, Takii R, Noda M, Inayoshi A, Watanabe K, Sanematsu F, Sasazuki T, Sasaki T, Fukui Y. DOCK2 is a Rac activator that regulates motility and polarity during neutrophil chemotaxis. The Journal of Cell Biology. 2006;174:647–652. doi: 10.1083/jcb.200602142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lacalle RA, Peregil RM, Albar JP, Merino E, Martínez-A C, Mérida I, Mañes S. Type I phosphatidylinositol 4-phosphate 5-kinase controls neutrophil polarity and directional movement. The Journal of Cell Biology. 2007;179:1539–1553. doi: 10.1083/jcb.200705044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lam P, Yoo SK, Green JM, Huttenlocher A. The SH2-domain-containing inositol 5-phosphatase (SHIP) limits neutrophil motility and wound recruitment in zebrafish. Journal of Cell Science. 2012;125:4973–4978. doi: 10.1242/jcs.106625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lee HS, Anekal P, Lim CJ, Liu CC, Ginsberg MH. Two modes of integrin activation form a binary molecular switch in adhesion maturation. Molecular Biology of the Cell. 2013;24:1354–1362. doi: 10.1091/mbc.E12-09-0695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lehto M, Mäyränpää MI, Pellinen T, Ihalmo P, Lehtonen S, Kovanen PT, Groop PH, Ivaska J, Olkkonen VM. The R-Ras interaction partner ORP3 regulates cell adhesion. Journal of Cell Science. 2008;121:695–705. doi: 10.1242/jcs.016964. [DOI] [PubMed] [Google Scholar]
  38. Lev S, Ben Halevy D, Peretti D, Dahan N. The VAP protein family: from cellular functions to motor neuron disease. Trends in Cell Biology. 2008;18:282–290. doi: 10.1016/j.tcb.2008.03.006. [DOI] [PubMed] [Google Scholar]
  39. Liu F, Sells MA, Chernoff J. Protein tyrosine phosphatase 1B negatively regulates integrin signaling. Current Biology. 1998;8:173–176. doi: 10.1016/s0960-9822(98)70066-1. [DOI] [PubMed] [Google Scholar]
  40. Mandal K. Review of PIP2 in Cellular signaling, functions and diseases. International Journal of Molecular Sciences. 2020;21:8342. doi: 10.3390/ijms21218342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Mao D, Lin G, Tepe B, Zuo Z, Tan KL, Senturk M, Zhang S, Arenkiel BR, Sardiello M, Bellen HJ. VAMP associated proteins are required for autophagic and lysosomal degradation by promoting a PtdIns4P-mediated endosomal pathway. Autophagy. 2019;15:1214–1233. doi: 10.1080/15548627.2019.1580103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Martel V, Racaud-Sultan C, Dupe S, Marie C, Paulhe F, Galmiche A, Block MR, Albiges-Rizo C. Conformation, localization, and integrin binding of talin depend on its interaction with phosphoinositides. The Journal of Biological Chemistry. 2001;276:21217–21227. doi: 10.1074/jbc.M102373200. [DOI] [PubMed] [Google Scholar]
  43. Mesmin B, Bigay J, Moser von Filseck J, Lacas-Gervais S, Drin G, Antonny B. A four-step cycle driven by PI(4)P hydrolysis directs sterol/PI(4)P exchange by the ER-Golgi tether OSBP. Cell. 2013;155:830–843. doi: 10.1016/j.cell.2013.09.056. [DOI] [PubMed] [Google Scholar]
  44. Moorhead AM, Jung JY, Smirnov A, Kaufer S, Scidmore MA. Multiple host proteins that function in phosphatidylinositol-4-phosphate metabolism are recruited to the chlamydial inclusion. Infection and Immunity. 2010;78:1990–2007. doi: 10.1128/IAI.01340-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Murphy SE, Levine TP. VAP, a versatile access point for the endoplasmic reticulum: review and analysis of FFAT-like motifs in the VAPome. Biochimica et Biophysica Acta. 2016;1861:952–961. doi: 10.1016/j.bbalip.2016.02.009. [DOI] [PubMed] [Google Scholar]
  46. Nader GPF, Ezratty EJ, Gundersen GG. FAK, talin and PIPKIγ regulate endocytosed integrin activation to polarize focal adhesion assembly. Nature Cell Biology. 2016;18:491–503. doi: 10.1038/ncb3333. [DOI] [PubMed] [Google Scholar]
  47. Ng IC, Pawijit P, Teo LY, Li H, Lee SY, Yu H. Kinectin-dependent ER transport supports the focal complex maturation required for chemotaxis in shallow gradients. Journal of Cell Science. 2016;129:2660–2672. doi: 10.1242/jcs.181768. [DOI] [PubMed] [Google Scholar]
  48. Peretti D, Dahan N, Shimoni E, Hirschberg K, Lev S. Coordinated lipid transfer between the endoplasmic reticulum and the Golgi complex requires the VAP proteins and is essential for Golgi-mediated transport. Molecular Biology of the Cell. 2008;19:3871–3884. doi: 10.1091/mbc.e08-05-0498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Prinz WA, Toulmay A, Balla T. The functional universe of membrane contact sites. Nature Reviews. Molecular Cell Biology. 2020;21:7–24. doi: 10.1038/s41580-019-0180-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Scorrano L, De Matteis MA, Emr S, Giordano F, Hajnóczky G, Kornmann B, Lackner LL, Levine TP, Pellegrini L, Reinisch K, Rizzuto R, Simmen T, Stenmark H, Ungermann C, Schuldiner M. Coming together to define membrane contact sites. Nature Communications. 2019;10:1287. doi: 10.1038/s41467-019-09253-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Senju Y, Kalimeri M, Koskela EV, Somerharju P, Zhao H, Vattulainen I, Lappalainen P. Mechanistic principles underlying regulation of the actin cytoskeleton by phosphoinositides. PNAS. 2017;114:E8977–E8986. doi: 10.1073/pnas.1705032114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Stefan CJ, Manford AG, Baird D, Yamada-Hanff J, Mao Y, Emr SD. Osh proteins regulate phosphoinositide metabolism at ER-plasma membrane contact sites. Cell. 2011;144:389–401. doi: 10.1016/j.cell.2010.12.034. [DOI] [PubMed] [Google Scholar]
  53. Subra M, Dezi M, Bigay J, Lacas-Gervais S, Di Cicco A, Araújo ARD, Abélanet S, Fleuriot L, Debayle D, Gautier R, Patel A, Roussi F, Antonny B, Lévy D, Mesmin B. VAP-A intrinsically disordered regions enable versatile tethering at membrane contact sites. Developmental Cell. 2023;58:121–138. doi: 10.1016/j.devcel.2022.12.010. [DOI] [PubMed] [Google Scholar]
  54. Thapa N, Sun Y, Schramp M, Choi S, Ling K, Anderson RA. Phosphoinositide signaling regulates the exocyst complex and polarized integrin trafficking in directionally migrating cells. Developmental Cell. 2012;22:116–130. doi: 10.1016/j.devcel.2011.10.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Tsujita K, Itoh T. Phosphoinositides in the regulation of actin cortex and cell migration. Biochimica et Biophysica Acta. 2015;1851:824–831. doi: 10.1016/j.bbalip.2014.10.011. [DOI] [PubMed] [Google Scholar]
  56. Valon L, Marín-Llauradó A, Wyatt T, Charras G, Trepat X. Optogenetic control of cellular forces and mechanotransduction. Nature Communications. 2017;8:14396. doi: 10.1038/ncomms14396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Vance JE. Phospholipid synthesis in a membrane fraction associated with mitochondria. The Journal of Biological Chemistry. 1990;265:7248–7256. doi: 10.1016/S0021-9258(19)39106-9. [DOI] [PubMed] [Google Scholar]
  58. Wakana Y, Hayashi K, Nemoto T, Watanabe C, Taoka M, Angulo-Capel J, Garcia-Parajo MF, Kumata H, Umemura T, Inoue H, Arasaki K, Campelo F, Tagaya M. The ER cholesterol sensor SCAP promotes CARTS biogenesis at ER-Golgi membrane contact sites. The Journal of Cell Biology. 2021;220:e202002150. doi: 10.1083/jcb.202002150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Weber-Boyvat M, Kentala H, Lilja J, Vihervaara T, Hanninen R, Zhou Y, Peränen J, Nyman TA, Ivaska J, Olkkonen VM. OSBP-related protein 3 (ORP3) coupling with VAMP-associated protein A regulates R-Ras activity. Experimental Cell Research. 2015;331:278–291. doi: 10.1016/j.yexcr.2014.10.019. [DOI] [PubMed] [Google Scholar]
  60. Welch HCE, Coadwell WJ, Ellson CD, Ferguson GJ, Andrews SR, Erdjument-Bromage H, Tempst P, Hawkins PT, Stephens LR. P-Rex1, a PtdIns(3,4,5)P3- and Gβγ-regulated guanine-nucleotide exchange factor for Rac. Cell. 2002;108:809–821. doi: 10.1016/S0092-8674(02)00663-3. [DOI] [PubMed] [Google Scholar]
  61. Wilhelm LP, Wendling C, Védie B, Kobayashi T, Chenard M-P, Tomasetto C, Drin G, Alpy F. STARD3 mediates endoplasmic reticulum-to-endosome cholesterol transport at membrane contact sites. The EMBO Journal. 2017;36:1412–1433. doi: 10.15252/embj.201695917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Wu H, Carvalho P, Voeltz GK. Here, there, and everywhere: The importance of ER membrane contact sites. Science. 2018;361:eaan5835. doi: 10.1126/science.aan5835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Xiong D, Xiao S, Guo S, Lin Q, Nakatsu F, Wu M. Frequency and amplitude control of cortical oscillations by phosphoinositide waves. Nature Chemical Biology. 2016;12:159–166. doi: 10.1038/nchembio.2000. [DOI] [PubMed] [Google Scholar]
  64. Xu W, Wang P, Petri B, Zhang Y, Tang W, Sun L, Kress H, Mann T, Shi Y, Kubes P, Wu D. Integrin-induced PIP5K1C kinase polarization regulates neutrophil polarization, directionality, and in vivo infiltration. Immunity. 2010;33:340–350. doi: 10.1016/j.immuni.2010.08.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Yoshii S, Tanaka M, Otsuki Y, Wang DY, Guo RJ, Zhu Y, Takeda R, Hanai H, Kaneko E, Sugimura H. alphaPIX nucleotide exchange factor is activated by interaction with phosphatidylinositol 3-kinase. Oncogene. 1999;18:5680–5690. doi: 10.1038/sj.onc.1202936. [DOI] [PubMed] [Google Scholar]

Editor's evaluation

Felix Campelo 1

This manuscript presents important findings that bring together two important topics in cell biology: the function of membrane contact sites and cell migration. The authors present compelling evidence to support a role of the ER tether protein VAP-A in focal adhesion dynamics and cell motility. This paper will be of interest to those cell biologists and biophysicists working on adhesion, migration, and membrane contact site biology.

Decision letter

Editor: Felix Campelo1
Reviewed by: Felix Campelo2

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "The ER tether VAPA is required for proper cell motility and anchors ER-PM contact sites to focal adhesions" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Felix Campelo as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Suzanne Pfeffer as the Senior Editor.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential Revisions:

We all agree that this manuscript reports potentially very interesting findings, but we also think that additional data will be needed to support the claims. The essential revisions requested are the following (1-3 will require new experiments, 4-6 might not, but additional discussion is requested):

1) Show additional rescue experiments (and/or test some of the findings with other KO clones). Especially regarding those experiments presented in Figures 1,5, and 6. We all agreed that this is perhaps the major gap in the paper. See detailed reviews below.

2) Show VAP-A localization by IF together with the localization of GFP-MAPPER MCS.

3) Test how peripheral vs. more centrally organized FAs behave with respect to VAP-A.

4) Improve their assessment/discussion on the PI4P and PIP2 results.

5) Improve on the method explanation/statistics description, etc.

6) The model is very speculative with respect to the data presented in the manuscript. This is in principle OK, but then it really needs to be discussed more as a speculative/working hypothesis rather than a summary model. While it would be great to be able to experimentally test some of the model's predictions (e.g., test some of the observed effects by KO Nir2, ORP3, or monitor integrin trafficking), we are not requesting any additional experiments in this regard.

Reviewer #1 (Recommendations for the authors):

As mentioned in the public review, I think that this is a very interesting paper, with potentially major findings that will help us understand better the process of cell migration. However, I think that, although parts of the paper are based on solid evidence, there are some important points of the paper that would require additional, stronger, and more compelling evidence.

– The VAP-A KO cell line is produced by single clonal selection. I really appreciate the experiments shown in Figure 2A, where the phenotype in the KO was rescued by the expression of WT and not mutant VAP-A. However, similar rescue experiments are not performed elsewhere in the manuscript. I am of course not saying that the rescues are presented in every single experiment, but in some of the key experiments, additional evidence about the specificity of the VAP-A effect should be provided (e.g. have the authors generated additional clonal KOs and tested the effects in those cell lines?)

– It was not clear to me, based on the image in Figure 2B, that the cortactin signal in the KOs is different from Control. Could the authors quantify that?

– Line 109: the title of the section reads as "VAPA regulates FAs and actin cytoskeleton through its MSP domain". However, the authors have not tested the role of the MSP domain in the actin effects. Hence, a rescue experiment with the WT and mutant VAP-A would be necessary here.

– Figure 6: This is a potentially quite cool finding. However, based only on this I'm not sure that the claims in the paper are sustained by the evidence. For instance, is a similar effect as that presented in panel E seen for those FAs, not in contact with an ER-PM MCS (according to panel B, there are about 25% of those)? Similarly, doing this experiment in the KO cells, where there is a fraction (>30%) of FAs proximal to an MCS, would determine whether MCS are enough for this effect or whether VAP-A is indeed playing a role there.

– The model is interesting and I think it presents a lot of possibilities for future work. However, as it is now, I think it is very hypothetical (which the authors already state in the legends), and mostly based on published work. This is fine, however, I feel that, given some of the cell-specific differences seen in this report (e.g. Golgi PI4P changes), the ideas in the cartoon might not be 100% extrapolated to their system. Of course, it would be great if the authors test the effects of depleting other ER-PM MCS proteins (Nir2, ORP3), or study integrin uptake, etc. However, I think this would be too much to ask for this paper (so it is not necessary in my opinion), but then this section might need to be integrated as an "Ideas and Speculation" section, according to eLife editorial: https://elifesciences.org/inside-eLife/e3e52a93/eLife-latest-including-ideas-and-speculation-in-eLife-papers

Other important points:

– Regarding the results in Figure 1C, I, J: The KOs look overall to be larger cells. Is this true? Is this due to clonal selection or because of the KO of VAP-A? Would the authors rescue the phenotype with the re-expression of the WT VAP-A? I think it would be informative to measure the final area/single cell after 24 h of spreading (steady state) and/or measure the nuclear area to be sure these effects are not due to size variability but to VAP-A depletion. Also, images in panel (I) are very pixelated in my PDF.

– The values plotted in Figure 3C are surprisingly small if they are indeed reporting at the fluorescence intensity density in the Golgi region relative to the same quantity measured elsewhere in the cytosol. Could the authors double-check if the quantification is done correctly, or maybe I am missing something?

– Figure 4E: I think the results are clear, but their representation of them could be improved to help the readers. I'd suggest that the tracking performed in the panels below the TIRF frames are showily more data points, and linked through connecting trajectory lines. Also, explain in the methods how this tracking and the lifetime and speed (panels F, G) have been measured.

– This might be something obvious for the authors/other experts in the field, but why is it that VAP-AKO cells move faster (single cell velocity) if FAs are longer lived?

– Work in HeLa cells has shown that VAP-A depletion leads to higher PI4P levels at the Golgi region (Y. Wakana et al.). Do you think that the observed changes are cell type (CACO2) specific? Have the authors considered the possibility to use other means to measure PI4P levels at the Golgi (e.g. antibody staining)?

– GFP-MAPPER: As I understand it from the reference, there are versions of the GFP-MAPPER plasmid with different lengths of the cytosolic linker part. Could the authors specify which one they used?

– The description of the nocodazole washout experiment is a bit difficult to follow and understand properly in the methods, I think it will help the readers if the authors could explain it a bit clearer.

Reviewer #2 (Recommendations for the authors):

The conclusions raised by the authors are convincing. I have listed here some comments, which I hope will strengthen some results and help to improve the manuscript.

Figure 1C: As VAPA KO cells filled the open space slower than control cells and that cell density is obviously lower in VAPA KO cell monolayer, it might be necessary to measure (or discuss) the proliferation rate of VAPA KO cells compared to control cells.

Is there any effect of VAPA depletion on cell-cell contacts required for collective migration?

Figure 2A: the authors focus on the larger FA observed in VAPA KO cells compared to the control cells in the "interior" of the cell. However, from the pictures displayed in Figure 2A, it seems that there is more paxillin signal in the cell periphery of control and VAPA KO + mCh-VAPA KDMD. Is there any effect of VAPA depletion on adhesive structures at the cell contour?

The same comment can be raised for results shown in Figure 5F. Did the authors measure FA dynamics both at the cell center and at the cell periphery? Do the different FA populations have the same behavior in VAPA depletion conditions?

Figure 2C: remove the "e" to "cortactin".

Using data presented in Figure6, the authors claim (lines 201-203) " Thus, we show that VAPA is required for the anchoring of ER-PM contact sites to FA, which happens at the time of FA disassembly"

To consolidate their interpretation, performing the same experiments as the ones conducted for Fig6 C-E but in VAPA KO cells and in VAPA KO cells expressing VAPA construct (rescue experiment) would be necessary.

In the discussion (lines 232-237) and in Figure 7, the authors discuss the role of VAPA-mediated ER-PM contact sites and FA in integrin trafficking. However, in this manuscript, no experiments regarding integrin trafficking were performed. To my opinion, other possible mechanisms might be added to Figure 7 such as the role of VAPA for calcium influx, STIM1 and ORP3.

Reviewer #3 (Recommendations for the authors):

Main recommendations

1) Results and hypotheses arising from VAPA KO should be tested by rescue experiments with WT and mutants (such as in Figure 2A). VAPA should be shown at ER-PM contacts in Figure 4 and Fig6 and in the recommended rescue experiments.

2) The data in the paper are from a single Crispr/Cas9 clone of VAPA KO. It is important to confirm some findings with other clones.

3) The direct link between VAPA, PI(4,5P)2 and FA disassembly is missing. The Nir2 (/ORP/lipid transfer pathway) hypothesis should be tested, by KO or siRNA, in cell motility or FA turnover experiment. Integrin endocytosis should be tested in VAPA KO and in rescue experiments. VAPA should be shown at ER-PM contacts near FA with Nir2 or another protein acting on PI(4,5)P2.

4) The authors assessed PI(4)P levels at Golgi and endosomes but not at the PM. As for PI(4,5)P2, it was tested at dorsal PM, but not at the ventral area where FA disassembly occurs. These measurements should be done. For PI(4)P, it would be wise to use the P4M-SiDM probe (PMID 24711504), rather than OSBP-PH which seems highly recruited to the Golgi but not to other membranes. Moreover, previous studies showed that not only VAPB but also VAPA is present at ER-Golgi and ER-endosome contacts in different cell types (by binding to CERT, OSBP, ORPs), with striking effects on PI(4)P modulation. How do the authors explain this apparent discrepancy?

5) For statistics it is highly recommended to use superplots (PMID 32346721). In addition, showing data with only ~10 cells analyzed per condition, as in Figure 3, is hardly acceptable.

Other points:

6) The two sets of images in Fig5E are difficult to compare because the starting point of FA formation is different. The rate of FA assembly appears to be 10 min longer in VAPA KO than in the control, which is not consistent with quantification. It is also difficult to judge the delay in disassembly. The time-lapse images should be comparable by showing the same acquisition times.

7) The authors claim that "contacts" are created between ER-PM contact sites and FA based on a one-pixel overlap (Fig6A, B), but whether the resolution of the image used here allows going that far is questionable.

8) The authors must show the effect on microtubule network during the washout experiment in Fig5F. The loss of FA size is difficult to see based on the images. The bar chart should be replaced by a panel in which individual measurements are shown (see point 5).

– Line 55. VAP not only binds to lipid transfer proteins.

– Line 185. To a non-specialist, it can be difficult to understand why the microtubule network comes into play here.

eLife. 2024 Mar 6;13:e85962. doi: 10.7554/eLife.85962.sa2

Author response


Essential Revisions:

We all agree that this manuscript reports potentially very interesting findings, but we also think that additional data will be needed to support the claims. The essential revisions requested are the following (1-3 will require new experiments, 4-6 might not, but additional discussion is requested):

1) Show additional rescue experiments (and/or test some of the findings with other KO clones). Especially regarding those experiments presented in Figures 1,5, and 6. We all agreed that this is perhaps the major gap in the paper. See detailed reviews below.

Considering the amount of additional experiments requested, we chose to concentrate on the Rescue cell lines. Indeed, they offered the double advantage of testing whether the phenotypes observed in VAPA KO cells are due to VAPA depletion and to interrogate the role of the MSP domain in the different processes studied. We have added new data that include the 2 VAPA KO cell lines expressing either VAPA WT or the mutant VAPA KDMD. Their phenotypes were analyzed in most of the cellular processes studied in the paper and described in figures 1, 2, 5 and 6. See point-by-point responses.

2) Show VAP-A localization by IF together with the localization of GFP-MAPPER MCS.

We have done the experiments requested by the Reviewers concerning that point. As suggested by Reviewer #3, we have added images of endogenous or exogenous VAPA at ER-PM contact sites in figures 4, figure 4—figure supplement 1 and figure 6.

3) Test how peripheral vs. more centrally organized FAs behave with respect to VAP-A.

We have added several data on peripheral FA and investigated the role of VAPA on this subpopulation in figures 2 and 6 (see responses to Reviewer #2).

4) Improve their assessment/discussion on the PI4P and PIP2 results.

We have added some data on PI4P at the PM using another probe and increased the sample size when necessary in figure 3. We have also improved the discussion on our results in the manuscript (see responses to Reviewer #1 and #3).

5) Improve on the method explanation/statistics description, etc.

We have provided all the additional information that were requested by the reviewers.

6) The model is very speculative with respect to the data presented in the manuscript. This is in principle OK, but then it really needs to be discussed more as a speculative/working hypothesis rather than a summary model. While it would be great to be able to experimentally test some of the model's predictions (e.g., test some of the observed effects by KO Nir2, ORP3, or monitor integrin trafficking), we are not requesting any additional experiments in this regard.

As explained in the responses to reviewers, we have removed the model that was too speculative and didn’t give an exhaustive view of the hypotheses. We developed a discussion on the hypotheses in the subsection Ideas and Speculation.

Reviewer #1 (Recommendations for the authors):

As mentioned in the public review, I think that this is a very interesting paper, with potentially major findings that will help us understand better the process of cell migration. However, I think that, although parts of the paper are based on solid evidence, there are some important points of the paper that would require additional, stronger, and more compelling evidence.

– The VAP-A KO cell line is produced by single clonal selection. I really appreciate the experiments shown in Figure 2A, where the phenotype in the KO was rescued by the expression of WT and not mutant VAP-A. However, similar rescue experiments are not performed elsewhere in the manuscript. I am of course not saying that the rescues are presented in every single experiment, but in some of the key experiments, additional evidence about the specificity of the VAP-A effect should be provided (e.g. have the authors generated additional clonal KOs and tested the effects in those cell lines?)

We have added new data that include the 2 VAPA KO cell lines expressing either VAPA WT or the mutant VAPA KDMD. Their phenotypes were analyzed in most of the cellular processes studied in the paper and described in figures 1, 2, 5 and 6: collective cell migration (Figure 1D-G), cell spreading (Figure 1K-L), organization of actin cytoskeleton (Figure 2D, 2F-G), protrusion dynamics (Figure 2D-E, 2H), focal adhesions size (Figure 2A-C), lifetime (Figure 5D) and proximity with GFP-MAPPER foci (Figure 6A-B). Unfortunately, for technical reasons, it was impossible to quantify the assembly and disassembly rates of focal adhesions in these 2 cell lines (Figure 5). However, the fact that the size and the lifetime of focal adhesions were rescued in VAPA KO+WT but not in VAPA KO+KDMD (Figure 2A-C and Figure 5D) is a proof that the defects of focal adhesion dynamics observed in VAPA KO cells is due to the absence of VAPA and depends on its MSP domain.

– It was not clear to me, based on the image in Figure 2B, that the cortactin signal in the KOs is different from Control. Could the authors quantify that?

We apologize if we were not clear on this part in the manuscript. We do not claim that there is a difference in the grey levels intensity of the cortactin signal between Control and VAPA KO cells. The difference that we observed resides in the distribution of cortactin along the leading edge, in particular the characteristics of cortactin-rich protrusive subdomains that are occupying a higher proportion of the leading edge and are longer in VAPA KO cells (Figure 2F and 2G). In order to clarify these quantifications, we have now added plot profiles of cortactin signal along the leading edge to highlight these cortactin-rich protrusive subdomains (in pink in the figure).

– Line 109: the title of the section reads as "VAPA regulates FAs and actin cytoskeleton through its MSP domain". However, the authors have not tested the role of the MSP domain in the actin effects. Hence, a rescue experiment with the WT and mutant VAP-A would be necessary here.

We apologize if this title seemed overinterpreted: what we called actin cytoskeleton in the title related to the organization of cortactin for which we had rescued conditions. In order to complete this part, we followed the Reviewer’s comment by adding a description of the organization of actin in VAPA KO+WT and VAPA KO+KDMD cell lines (Figure 2D) and quantified the repartition of cortactin and the dynamics of protrusions (Figure 2E-H). As described in the manuscript, all these phenotypes were rescued by the expression of VAPA WT but not VAPA KDMD, indicating that they depend on the MSP domain of VAPA.

– Figure 6: This is a potentially quite cool finding. However, based only on this I'm not sure that the claims in the paper are sustained by the evidence. For instance, is a similar effect as that presented in panel E seen for those FAs, not in contact with an ER-PM MCS (according to panel B, there are about 25% of those)? Similarly, doing this experiment in the KO cells, where there is a fraction (>30%) of FAs proximal to an MCS, would determine whether MCS are enough for this effect or whether VAP-A is indeed playing a role there.

We thank the Reviewer for giving us the opportunity to improve the experimental evidences on this point. We have now added new data that, we hope, will be more convincing (Figure 6C-H).

  • Concerning the 25-30% of FA not in contact with GFP-MAPPER foci (quantified in Figure 6B), it is possible that they were in fact in contact with a GFP-MAPPER foci during their lifetime, as this quantification reflects the situation at one time point. They might correspond to the FA that are assembling and not yet in contact, as we observe in panels C and E that the first GFP-MAPPER foci appear on pre-existing FA. So we probably took them into account in our dynamic analysis. However, it might also be that a proportion of FA in Control cells are indeed never in contact with GFP-MAPPER foci (or that we are not able to detect them); then for those FA, we won’t be able to answer the Reviewer’s question on the correlation between FA dynamic and GFP-MAPPER dynamic, as there is no GFP-MAPPER signal in the vicinity of the FA.

  • Concerning the 30% of FA in contact with GFP-MAPPER foci in VAPA KO cells, we have now added some data. Our results show that VAPA is required:

Moreover, using TIRF microscopy, we were able to detect the presence of VAPA in GFP-MAPPER foci proximal to FA (Figure 6G-H).

Altogether, these observations point to a specific role of VAPA in the ER-PM contact sites proximal to FA.

– The model is interesting and I think it presents a lot of possibilities for future work. However, as it is now, I think it is very hypothetical (which the authors already state in the legends), and mostly based on published work. This is fine, however, I feel that, given some of the cell-specific differences seen in this report (e.g. Golgi PI4P changes), the ideas in the cartoon might not be 100% extrapolated to their system. Of course, it would be great if the authors test the effects of depleting other ER-PM MCS proteins (Nir2, ORP3), or study integrin uptake, etc. However, I think this would be too much to ask for this paper (so it is not necessary in my opinion), but then this section might need to be integrated as an "Ideas and Speculation" section, according to eLife editorial: https://elifesciences.org/inside-eLife/e3e52a93/eLife-latest-including-ideas-and-speculation-in-eLife-papers

We thank the Reviewer for this suggestion. The part of the Discussion describing potential hypothesis has now been integrated in the “Ideas and Speculation” subsection (Lines 294-338). In addition, the model has been removed from the paper as we felt that it was too speculative and that it doesn’t give an exhaustive view of the possible hypothesis.

Other important points:

– Regarding the results in Figure 1C, I, J: The KOs look overall to be larger cells. Is this true? Is this due to clonal selection or because of the KO of VAP-A? Would the authors rescue the phenotype with the re-expression of the WT VAP-A? I think it would be informative to measure the final area/single cell after 24 h of spreading (steady state) and/or measure the nuclear area to be sure these effects are not due to size variability but to VAP-A depletion. Also, images in panel (I) are very pixelated in my PDF.

We have now added new data showing that the expression of VAPA WT in VAPA KO cells partially restores the spreading behaviour of these cells within the first hour, and that it depends on the MSP domain of VAPA (Figure 1K-L), which is in favour of a VAPA-dependent effect rather than a size variability effect. In addition, as requested by the Reviewer, we analyzed the cell areas after 24 hours in the 4 cell lines. As shown in Author response image 1, after 24 hours, the phenotype was inverted compared to 1 hour spreading: the depletion of VAPA induced a strong decrease of the cell area, restored by the expression of exogenous VAPA WT but not VAPA KDMD. This phenotype might be due to the fact that after 24 hours, the cells are not spreading anymore, but have started to move in 2D as individual cells, so their shape and area are intimately linked to their motile behaviour. The small size of VAPA KO cells is correlated to their faster way to move, while Control cells are more static cells with a “fried egg” shape and a high surface spreading. This observation is also well visible in Figure 1H. However, in motile monolayers, VAPA KO cells look bigger than Control cells, which is the opposite of individual motile cells. We think this decrepancy might be due to the fact that in monolayers, the cell area is also influenced by the presence and the integrity of cell-cell junctions that could be altered in VAPA KO cells.

Author response image 1. Analysis of cell area 24 hours after plating.

Author response image 1.

A. Epifluorescence images of Control, VAPA KO, VAPA KO+WT and VAPA KO+KDMD cells 24 hours after plating on fibronectin-coated glass and stained as indicated. Scale bar: 100 μm. B. Analysis of cell area 24 hours after plating on fibronectin-coated glass (n=49 to 57 cells from 3 independent experiments). Data were analysed using a One-way Anova Kruskal-Wallis test. (ns: non significant, ***P-values <0.001, **P-values <0.01, *P-values <0.05).

Altogether, our new data clearly show that the size differences are indeed due to the absence of VAPA rather than a size variability due to clonal selection.

– The values plotted in Figure 3C are surprisingly small if they are indeed reporting at the fluorescence intensity density in the Golgi region relative to the same quantity measured elsewhere in the cytosol. Could the authors double-check if the quantification is done correctly, or maybe I am missing something?

We thank the Reviewer for pointing this out. There was indeed an error in the normalization of the results. We have corrected this error and increased the sample size to more than 20 cells, as suggested by Reviewer #3 (Figure 3C). We obtained a Golgi/Cytosol ratio of around 5 which is in agreement with the PI4P enrichment detected in the Golgi.

– Figure 4E: I think the results are clear, but their representation of them could be improved to help the readers. I'd suggest that the tracking performed in the panels below the TIRF frames are showily more data points, and linked through connecting trajectory lines. Also, explain in the methods how this tracking and the lifetime and speed (panels F, G) have been measured.

As suggested by the Reviewer, we have now improved the representation of the results, by adding more time points and by labeling each time point with a specific colour in the tracking image (Figure 4E). We have also added a small paragraph in the methods to explain the way this analysis was done (Lines 530-534).

– This might be something obvious for the authors/other experts in the field, but why is it that VAP-AKO cells move faster (single cell velocity) if FAs are longer lived?

We thank the Reviewer for raising this point which is not trivial. At that stage, we can’t give any experimental explanation for this, but we can speculate on the reasons why VAPA KO cells have longer-lived FAs and move faster.

First, the group of Denis Wirtz showed, some time ago, that for slow-moving cells (like individual Caco2 cells), an increase in FAs size correlates with a faster cell speed (Kim and Wirtz, 2013), highlighting the fact that having bigger FAs does not necessarily prevent the cells from moving faster.

Second, even if VAPA KO focal adhesions live longer, we have no information on their molecular composition, their maturation/activation status, their connection with the actin-cytoskeleton and their mechano-sensitivity. All these parameters can influence the motile behaviour of the cells, including cell directionality and cell speed (Doyle et al., 2022; Gupton and Waterman-Storer, 2006).

– Work in HeLa cells has shown that VAP-A depletion leads to higher PI4P levels at the Golgi region (Y. Wakana et al.). Do you think that the observed changes are cell type (CACO2) specific?

We thank the Reviewer for mentioning this work by Wakana et al. that we have now added to the manuscript (Lines 77-78). In this study, as in the 3 other studies that we cite in the manuscript (Lines 76-80), the authors depleted both VAPA and VAPB and observed, depending on the cell type and organism, either a reduction (Peretti et al., 2008) or an accumulation (Mao et al., 2019; Wakana et al., 2021) of PI4P levels in the Golgi membranes and its redistribution on endosomes (Dong et al., 2016). The main difference with our study is that we depleted only VAPA. As discussed in lines 159-169 and 265-277, our results showing no effect of VAPA depletion on PI4P at the Golgi or endosomes can be explained by a possible redundancy of VAPA and VAPB in these 2 compartments. In other words, in our VAPA KO cells, the presence of VAPB would be enough to maintain the levels of PI4P at the Golgi and endosomes. This is corroborated by the results of P. di Camilli’s group (Dong et al., 2016) who did not observe any defect in the intra-cellular distribution of PI4P in cells expressing only VAPB (see Figure S1D in their paper).

Moreover, our results show that something different happens at the PM where the presence of VAPB does not seem to be enough to maintain the levels of PI4P and PI(4,5)P2. Interestingly, the same phenotype has been observed in Nir2 depleted cells (discussed in lines 308-311).

Have the authors considered the possibility to use other means to measure PI4P levels at the Golgi (e.g. antibody staining)?

We tried to stain our cells with anti-PI4P antibodies but didn’t get a sufficient signal to be able to quantify properly the images. However, as requested by Reviewer #3, we have now added new data on the amount of PI4P at the PM using P4M-SidM probe and showed that PI4P levels at the PM are decreased in VAPA KO cells, similar to PI(4,5)P2 levels (Figure 3D).

GFP-MAPPER: As I understand it from the reference, there are versions of the GFP-MAPPER plasmid with different lengths of the cytosolic linker part. Could the authors specify which one they used?

We used the long version of MAPPER that has been characterized throughout Chang et al. paper (Chang et al., 2013), and that contains two flexible helical linkers, (EAAAR) 4 and (EAAAR) 6, upstream and downstream flanking regions of the FRB, respectively. This precision has been added to the Methods section (Lines 364-367).

The description of the nocodazole washout experiment is a bit difficult to follow and understand properly in the methods, I think it will help the readers if the authors could explain it a bit clearer.

We have now explained more precisely the nocodazole wash-out experiment in the Methods (Lines 467-476).

Reviewer #2 (Recommendations for the authors):

The conclusions raised by the authors are convincing. I have listed here some comments, which I hope will strengthen some results and help to improve the manuscript.

Figure 1C: As VAPA KO cells filled the open space slower than control cells and that cell density is obviously lower in VAPA KO cell monolayer, it might be necessary to measure (or discuss) the proliferation rate of VAPA KO cells compared to control cells.

We thank the Reviewer for giving us the opportunity to clarify this point. Concerning the proliferation rate, in order to avoid any proliferation bias, we inhibited cell division by treating the cells with mitomycin. This information has been added in the Results section (Lines 104-105). When VAPA KO cells are displacing collectively, they spread more than Control cells (see point 6 of Reviewer #1) which is why, on the figure 1D, the density looks lower.

Is there any effect of VAPA depletion on cell-cell contacts required for collective migration?

We have not investigated the organization of cell-cell junctions in VAPA KO cells. It is indeed highly probable that VAPA regulates junctional organization, as PI(4,5)P2 has been shown to control endocytosis of cadherins and organization of the actin cortex. So the phenotype observed in collective migration might be due, at least in part, to a function of VAPA at cell-cell contacts. However, as we observe the same motility phenotype on individual cells (Figure 1H-J), we can be confident on the fact that the role of VAPA on cell motility is at least partially independent of cell-cell junctions, as mentioned in Lines 109-112.

Figure 2A: the authors focus on the larger FA observed in VAPA KO cells compared to the control cells in the "interior" of the cell. However, from the pictures displayed in Figure 2A, it seems that there is more paxillin signal in the cell periphery of control and VAPA KO + mCh-VAPA KDMD. Is there any effect of VAPA depletion on adhesive structures at the cell contour?

The same comment can be raised for results shown in Figure 5F. Did the authors measure FA dynamics both at the cell center and at the cell periphery? Do the different FA populations have the same behavior in VAPA depletion conditions?

We thank the Reviewer for raising this point. We have now added some data on peripheral FA that, in fact, correspond to the population of nascent adhesions and focal complexes. As shown in Fig. 2A-C and Fig. 6A-B, we observed no difference between the cell lines, or a very slight one, in the size of peripheral FA and their proximity with GFP-MAPPER foci. These results suggest that VAPA is not involved in the first steps of FA assembly, which is consistent with the observation that Control and VAPA KO FA assemble at the same speed (Fig. 5B), and that GFP-MAPPER foci appear in the vicinity of FA after their assembly (Fig. 6C-D).

Figure 2C: remove the "e" to "cortactin".

This error has been corrected.

Using data presented in Figure6, the authors claim (lines 201-203) " Thus, we show that VAPA is required for the anchoring of ER-PM contact sites to FA, which happens at the time of FA disassembly"

To consolidate their interpretation, performing the same experiments as the ones conducted for Fig6 C-E but in VAPA KO cells and in VAPA KO cells expressing VAPA construct (rescue experiment) would be necessary.

We have now added new data in Figure 6, showing that in VAPA KO cells, there is no preferential arrival of the 1st GFP-MAPPER foci before FA disassembly (Figure 6C-E), and that the proximity between FA and GFP-MAPPER foci lasts shorter (Figure 6F). Unfortunately, because of technical issues with our new TIRF microscope, we were not able to include Rescue cell lines in these experiments that necessitated more acquisitions. However, we added some data on the Rescue cell lines in Figure 6A-B showing that VAPA is indeed necessary for the proximity between central FA and GFP-MAPPER.

In the discussion (lines 232-237) and in Figure 7, the authors discuss the role of VAPA-mediated ER-PM contact sites and FA in integrin trafficking. However, in this manuscript, no experiments regarding integrin trafficking were performed. To my opinion, other possible mechanisms might be added to Figure 7 such as the role of VAPA for calcium influx, STIM1 and ORP3.

We fully agree with the Reviewer, which is why we removed the model that we felt was too speculative and didn’t give an exhaustive view of the possible hypothesis. We also integrated the part of the Discussion describing potential hypothesis in the “Ideas and Speculation” subsection (Lines 294338). The possible connection with STIM1 and ORP3 is discussed in this subsection.

Reviewer #3 (Recommendations for the authors):

Main recommendations

1) Results and hypotheses arising from VAPA KO should be tested by rescue experiments with WT and mutants (such as in Figure 2A). VAPA should be shown at ER-PM contacts in Figure 4 and Fig6 and in the recommended rescue experiments.

We thank the Reviewer for raising these points and giving us the opportunity to improve the paper. As explained in our responses to Reviewer #1, we have now added a significant amount of data in the 2 VAPA KO cell lines expressing either VAPA WT or the mutant VAPA KDMD. Their phenotypes were analyzed in most of the cellular processes studied in the paper and described in figures 1, 2, 5 and 6: collective cell migration (Figure 1D-G), cell spreading (Figure 1K-L), organization of actin cytoskeleton (Figure 2D, 2F-G), protrusion dynamics (Figure 2D-E, 2H), focal adhesions size (Figure 2A-C), lifetime (Figure 5D) and proximity with GFP-MAPPER foci (Figure 6A-B).

VAPA should be shown at ER-PM contacts in Figure 4 and Fig6 and in the recommended rescue experiments.

As suggested by the Reviewer, we have added images of endogenous or exogenous VAPA at ER-PM contact sites:

– by confocal microscopy in Control cells transiently expressing Cherry-VAPAWT and GFP-MAPPER (Figure 4C)

– by confocal microscopy in Control cells transiently expressing GFP-MAPPER and immuno-stained with anti-VAPA antibodies (Figure 4—figure supplement 1A)

In addition, in Figure 6G, we added a TIRF image showing the localization of exogenous VAPAWT expressed in VAPA KO cells co-localizing with ER-PM contact sites close to focal adhesions, which reinforces our results showing the local function of VAPA at focal adhesions.

2) The data in the paper are from a single Crispr/Cas9 clone of VAPA KO. It is important to confirm some findings with other clones.

The editors requested additional data in Rescue cell lines and/or other VAPA KO clones. Considering the difficulties we’ve had during this review process (in particular the departure of the first author and the technical issues with our TIRF microscope) and the amount of additional experiments requested, we chose to concentrate on the Rescue cell lines. Indeed, they offered the double advantage of testing whether the phenotypes observed in VAPA KO cells are due to VAPA depletion and to interrogate the role of the MSP domain in the different processes studied.

3) The direct link between VAPA, PI(4,5P)2 and FA disassembly is missing. The Nir2 (/ORP/lipid transfer pathway) hypothesis should be tested, by KO or siRNA, in cell motility or FA turnover experiment. Integrin endocytosis should be tested in VAPA KO and in rescue experiments. VAPA should be shown at ER-PM contacts near FA with Nir2 or another protein acting on PI(4,5)P2.

We agree with the Reviewer that our paper doesn’t give any experimental evidence on the molecular mechanisms involved in the function of VAPA during cell motility. However, we feel that these elements would be beyond the scope of this work, as mentioned by the Editors.

4) The authors assessed PI(4)P levels at Golgi and endosomes but not at the PM. As for PI(4,5)P2, it was tested at dorsal PM, but not at the ventral area where FA disassembly occurs. These measurements should be done. For PI(4)P, it would be wise to use the P4M-SiDM probe (PMID 24711504), rather than OSBP-PH which seems highly recruited to the Golgi but not to other membranes.

As suggested by the Reviewer, we have now added some data on PI(4)P using the P4M-SiDM probe (Figure 3D-E). As for PI(4, 5)P2, we observed lower amounts of PI(4)P at the plasma membrane of VAPA KO cells. We have tried to assess the local regulation of PI(4,5)P2 and PI(4)P on the ventral area where FA disassembly occurs, but we were not able to see any variations, probably because the events we were trying to catch are very transient.

Moreover, previous studies showed that not only VAPB but also VAPA is present at ER-Golgi and ER-endosome contacts in different cell types (by binding to CERT, OSBP, ORPs), with striking effects on PI(4)P modulation. How do the authors explain this apparent discrepancy?

Our finding that VAPA depletion doesn’t have any effect on PI(4)P at the Golgi is, in fact, not in contradiction with published work. Indeed, in the 4 studies that we cite in the manuscript (Lines 7680), the authors depleted both VAPA and VAPB and observed, depending on the cell type and organism, either a reduction (Peretti et al., 2008) or an accumulation (Mao et al., 2019; Wakana et al., 2021) of PI4P levels in the Golgi membranes and its redistribution on endosomes (Dong et al., 2016). The main difference with our study is that we depleted only VAPA. As discussed in lines 159-169 and 265-277, our results can be explained by a possible redundancy of VAPA and VAPB in these 2 compartments. In other words, in our VAPA KO cells, the presence of VAPB would be enough to maintain the levels of PI4P at the Golgi and endosomes. This is corroborated by the results of P. di Camilli’s group (Dong et al., 2016) who did not observe any defect in the intra-cellular distribution of PI4P in cells expressing only VAPB (see Figure S1D in their paper).

5) For statistics it is highly recommended to use superplots (PMID 32346721). In addition, showing data with only ~10 cells analyzed per condition, as in Figure 3, is hardly acceptable.

Most of the data that were represented as bar graphs have been modified to Scatter plots or Box and Whiskers, to allow the visualization of individual events. As suggested by the Reviewer, we increased the number of cells analyzed in Figure 3C.

Other points:

6) The two sets of images in Fig5E are difficult to compare because the starting point of FA formation is different. The rate of FA assembly appears to be 10 min longer in VAPA KO than in the control, which is not consistent with quantification. It is also difficult to judge the delay in disassembly. The time-lapse images should be comparable by showing the same acquisition times.

We thank the Reviewer for pointing out this mistake. As suggested, we have now represented image sequences with the same starting point of FA formation and the same acquisition times in Control and VAPA KO cells (Figure 5A). They are also more representative of the phenotypes observed in the quantification.

7) The authors claim that "contacts" are created between ER-PM contact sites and FA based on a one-pixel overlap (Fig6A, B), but whether the resolution of the image used here allows going that far is questionable.

We fully agree with the Reviewer that “contacts” is not the appropriate word here, considering the resolution used. We have now removed this word from the manuscript. Using a super resolutive SIM microscope, we were able to determine that GFP-MAPPER foci and FA were distant of around 50150nm (Figure 6—figure supplement 1A). Moreover, the analysis of GFP-MAPPER foci dynamics revealed that in Control cells, they persisted several minutes (in average 6 minutes) in the vicinity of FA (Figure 6F), suggesting that they were either directly or indirectly anchored to FA.

8) The authors must show the effect on microtubule network during the washout experiment in Fig5F. The loss of FA size is difficult to see based on the images. The bar chart should be replaced by a panel in which individual measurements are shown (see point 5).

We have now added images of the microtubules network at different time points of the washout experiment (Figure 5—figure supplement 1A). They show a relatively fast recovery of the microtubule network after washout of nocodazole. As suggested by the Reviewer, we put more representative images of FA staining in Figure 5E and replaced the bar graph by Scatter plots in Figure 5F.

– Line 55. VAP not only binds to lipid transfer proteins.

We have modified the 2 sentences in question (Lines 57-62).

– Line 185. To a non-specialist, it can be difficult to understand why the microtubule network comes into play here.

We have now added a sentence explaining why we addressed the role of microtubules (Lines 216221)

References

Chang CL, Hsieh TS, Yang TT, Rothberg KG, Azizoglu DB, Volk E, Liao JC, Liou J. 2013. Feedback regulation of receptor-induced Ca2+ signaling mediated by e-syt1 and nir2 at endoplasmic reticulum-plasma membrane junctions. Cell Rep 5:813–825. doi:10.1016/j.celrep.2013.09.038

Dong R, Saheki Y, Swarup S, Lucast L, Harper JW, De Camilli P. 2016. Endosome-ER Contacts Control Actin Nucleation and Retromer Function through VAP-Dependent Regulation of PI4P. Cell 166:408–423. doi:10.1016/j.cell.2016.06.037

Doyle AD, Nazari SS, Yamada KM. 2022. Cell-extracellular matrix dynamics. Phys Biol 19. doi:10.1088/1478-3975/AC4390

Gupton SL, Waterman-Storer CM. 2006. Spatiotemporal Feedback between Actomyosin and FocalAdhesion Systems Optimizes Rapid Cell Migration. Cell 125:1361–1374. doi:10.1016/j.cell.2006.05.029

Kim DH, Wirtz D. 2013. Focal adhesion size uniquely predicts cell migration. FASEB J 27:1351–1361. doi:10.1096/FJ.12-220160

Mao D, Lin G, Tepe B, Zuo Z, Tan KL, Senturk M, Zhang S, Arenkiel BR, Sardiello M, Bellen HJ. 2019. VAMP associated proteins are required for autophagic and lysosomal degradation by promoting a PtdIns4P-mediated endosomal pathway. Autophagy 15:1214–1233. doi:10.1080/15548627.2019.1580103

Peretti D, Dahan N, Shimoni E, Hirschberg K, Lev S. 2008. Coordinated lipid transfer between the endoplasmic reticulum and the golgi complex requires the VAP proteins and is essential for Golgi-mediated transport. Mol Biol Cell 19:3871–3884. doi:10.1091/mbc.E08-05-0498

Wakana Y, Hayashi K, Nemoto T, Watanabe C, Taoka M, Angulo-Capel J, Garcia-Parajo MF, Kumata H, Umemura T, Inoue H, Arasaki K, Campelo F, Tagaya M. 2021. The er cholesterol sensor scap promotes carts biogenesis at er–golgi membrane contact sites. J Cell Biol 220. doi:10.1083/JCB.202002150/VIDEO-1

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Table containing the raw data used for the quantifications in Figure 1A, E, F, G, I, J and L.
    Figure 1—source data 2. Folder containing the 2 original files of the full raw unedited blots for VAPA and Tubulin presented in Figure 1A and a figure with the uncropped annotated blots.
    Figure 1—figure supplement 1—source data 1. Table containing the raw data used for the quantifications Figure 1—figure supplement 1A.
    Figure 1—figure supplement 1—source data 2. Folder containing the 2 original files of the full raw unedited blots for VAPB and Tubulin presented in Figure 1—figure supplement 1A and a figure with the uncropped annotated blots.
    Figure 2—source data 1. Table containing the raw data used for the quantifications Figure 2B, C, D, F, G and H.
    Figure 3—source data 1. Table containing the raw data used for the quantifications Figure 3C, D, E, G, H and I.
    Figure 4—source data 1. Table containing the raw data used for the quantifications Figure 4F and G.
    Figure 4—figure supplement 1—source data 1. Table containing the raw data used for the quantifications Figure 4—figure supplement 1A and D and 1E.
    Figure 5—source data 1. Table containing the raw data used for the quantifications Figure 5B, C, D and F.
    Figure 6—source data 1. Table containing the raw data used for the quantifications Figure 6B, D, E, F and H.
    Figure 6—figure supplement 1—source data 1. Table containing the raw data used for the quantifications Figure 6—figure supplement 1A.
    MDAR checklist
    Supplementary file 1. Complete list of materials used in this study indicating the references and dilutions used for the antibodies.
    elife-85962-supp1.xlsx (17.3KB, xlsx)

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting files; Source Data files have been provided for all figures.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES