Skip to main content
G3: Genes | Genomes | Genetics logoLink to G3: Genes | Genomes | Genetics
. 2024 Jan 23;14(3):jkad298. doi: 10.1093/g3journal/jkad298

Knockdown of Kmt2d leads to growth impairment by activating the Akt/β-catenin signaling pathway

Huakun Shangguan 1, Xiaozhen Huang 2, Jinduan Lin 3, Ruimin Chen 4,✉,2
Editor: D Bannasch
PMCID: PMC10917512  PMID: 38263533

Abstract

The KMT2D variant–caused Kabuki syndrome (KS) is characterized by short stature as a prominent clinical characteristic. The initiation and progression of body growth are fundamentally influenced by chondrocyte proliferation. Uncertainty persists regarding the possibility that KMT2D deficiency affects growth by impairing chondrocyte proliferation. In this study, we used the CRISPR/Cas13d technique to knockdown kmt2d in zebrafish embryos and lentivirus to create a stable Kmt2d gene knockdown cell line in chondrocytes (ATDC5 cells). We also used CCK8 and flow cytometric studies, respectively, to determine proliferation and cell cycle state. The relative concentrations of phosphorylated Akt (ser473), phosphorylated β-catenin (ser552), and cyclin D1 proteins in chondrocytes and zebrafish embryos were determined by using western blots. In addition, Akt inhibition was used to rescue the phenotypes caused by kmt2d deficiency in chondrocytes, as well as a zebrafish model that was generated. The results showed that a knockdown of kmt2d significantly decreased body length and resulted in aberrant cartilage development in zebrafish embryos. Furthermore, the knockdown of Kmt2d in ATDC5 cells markedly increased proliferation and accelerated the G1/S transition. In addition, the knockdown of Kmt2d resulted in the activation of the Akt/β-catenin signaling pathway in ATDC5 cells. Finally, Akt inhibition could partly rescue body length and chondrocyte development in the zebrafish model. Our study demonstrated that KMT2D modulates bone growth conceivably via regulation of the Akt/β-catenin pathway.

Keywords: KMT2D, Akt/β-catenin, growth, chondrocyte

Graphical Abstract

Graphical abstract.

Graphical abstract

Introduction

Yoshikazu Kuroki and Norio Niikawa initially named and documented Kabuki syndrome (KS; OMIM#147920) in the early 1980s (Adam et al. 2019). About 70% of people with KS have genetic variations in the KMT2D and KDM6A genes, with the former being more prevalent. As a histone (H3) lysine methyltransferase protein, the KMT2D encodes an epigenetic factor that controls chromatin shape and gene transcription by methylating lysine 4 on histone H3 (Jefri et al. 2022). A distinctive facial characteristic of patients with KS was the eversion of the lateral third of the lower eyelids, as well as long palpebral fissures, a flattened nasal tip, and enormous ears (Usluer et al. 2022). Short stature, cerebral impairments, cardiac issues, small hands, and clinodactyly of the fifth finger are additional primary clinical traits of KS (Adam et al. 2019).

The cause of the short stature in KS is still unresolved. Reduced body length in all 3 strains of Kmt2d−/+ mice that were separately developed (Fahrner et al. 2019; Huisman et al. 2021). The Kmt2d−/+ mouse exhibits a growth delay phenotype in one of the strains and has impaired growth hormone–releasing hormone neuron function (Huisman et al. 2021). Nonetheless, many documented accounts of growth hormone deficiency in KMT2D patients are scant (van Montfort et al. 2021). Chondrocyte proliferation contributes to the initiation and development of body growth. The enhanced chondrocyte differentiation caused by the loss of Kmt2d has also been linked to growth impairment (Fahrner et al. 2019). The question whether KMT2D deficiency inhibits linear growth by impairing chondrocyte proliferation is an unsettled one.

Prokaryotes’ adaptive immune system, which was employed to protect against phage viral invasion, was encoded by CRISPR/Cas loci. Prokaryotes can precisely recognize gene sequences that resemble phages or other invaders using the CRISPR system, and then they can employ CRISPR-associated proteins (Cas) to target these sequences for destruction (Knott and Doudna 2018). A novel technique called CRISPR/Cas13 uses RNA editing to knockdown genes without changing the genome (Cox et al. 2017). Six distinct Cas13 variants have been found so far, and Cas13d, one of the smallest single-effector Cas enzymes, has been isolated and identified (Zhang et al. 2018). Zebrafish (Danio rerio) serve as an adaptive and reliable model for genetic and developmental research. The CRISPR/Cas13d technique was initially used by Kushawah to examine gene activity in a zebrafish model in 2020, and the results demonstrated remarkable efficiency and specificity (Kushawah et al. 2020).

In this study, we investigated the molecular mechanisms behind the KMT2D gene deficiency–related short stature. Our results found that KMT2D modulates growth possibly via activating the Akt/β-catenin signaling pathway.

Materials and methods

Zebrafish maintenance and cell cultivation

The wild-type AB strain of zebrafish used in this experiment was obtained from the laboratory of School of Biological Engineering, Fuzhou University. Adult wild-type AB strains of zebrafish were maintained under standard laboratory conditions (28.5°C and 14 h/10 h light–dark cycle). Live images were captured using an SMZ 1500 stereomicroscope (Nikon), and body length was determined by image-based morphometric analysis using NIS-Elements D3.1 software.

The murine chondrogenic cell line ATDC5 was obtained from an American-type culture collection. The cell line was incubated in a Dulbecco’s modified eagle medium (DMEM) complete medium (Thermo Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Gibco, Thermo Scientific) and 1% penicillin/streptomycin solution (Solarbio Science & Technology, Beijing, China) at 37°C in an atmosphere containing 5% CO2 in air.

Evolutionary comparison of KMT2D proteins

Sequences of proteins belonging to the KMT2D families were identified in genomes by using the NCBI (https://www.ncbi.nlm.nih.gov/) and Ensembl (http://www.ensembl.org/index.html). For the analysis of KMT2D, all data were collated and mapped onto a phylogenetic tree by MEGA 6.0.

Guide RNA and Cas13d mRNA generation

Briefly, 3 guide RNAs (gRNAs) were designed to disrupt the kmt2d gene in zebrafish with the following sequences: gRNA1: CTCAGCAGAGCTTGGCTGGGAGG; gRNA2: CGGCCTATCAAAACTGAACCTGG; gRNA3: CTGCTAAGCTCCTCTTCGCTGGG.

A DNA template to generate gRNA mRNA was generated by fill-in PCR. For RNA synthesis, PCR amplicons were purified and used as templates using T7 RNA polymerase (MAXIscript T7 Kit, Invitrogen) according to the manufacturer’s instructions. Cas13d were PCR-amplified using primers (Cas13d-SP6-kozak-F: 5′- ATTTAGGTGACACTATAGAAGTGCCGCCACCATGAGCCCCAAGAAGAAG-3′ and Cas13d-WPRE-R: 5′-ATTGCTACTTGTGATTGCTCCATG-3′) and also using addgene plasmid # 109049 (a gift from Pr. Lisa Li) as the template. Then, the Cas13d mRNA was synthesized using the mMACHINE SP6 Transcription Kit (Invitrogen). To increase mRNA depletion, the 3 gRNAs targeting the kmt2d gene were co-injected. One nanoliter containing 200 ng of Cas13d mRNA and 100 ng of gRNA mRNA were co-injected into the 1-cell stage zebrafish embryos.

Zebrafish Alcian blue and Alizarin red staining zebrafish staining

The cartilage and bone of zebrafish at 5-day postfertilization (dpf) were double-stained with Alizarin red/Alcian blue at the same time, according to a previously reported method to observe the bone morphology (Nagy et al. 2009). Images were analyzed under a dissecting microscope (Zeiss, German).

Generation of Kmt2d knockdown cells by short hairpin RNA

The sequences of the short hairpin RNA (shRNA) were cloned into the lentiviral vector pLKO-puro, which could express shRNA and inhibit the expression of a specific gene by the RNA interference mechanism. Lentiviral particles were produced in HEK293T cells, and subsequently, the ATDC5 cells were transduced. The sequences of the shRNA targeting the Kmt2d gene were as follows:

  • Kmt2d-sh1: 5′-CCTTGCCAGTTCACCATTAAT-3′

  • Kmt2d-sh2: 5′-GTTCATCGAGTTGCGACATAA-3′

  • Kmt2d-NC: 5′-TTCTCCGAACGTGTCACGTAA-3′

qRT-PCR and western blot

In the study, 15 embryos per biological replicate were obtained at 6 h postfertilization (hpf), and the expression level of kmt2d mRNA was validated by qRT-PCR. We used the FreeZol Reagent kit (Vazyme, China) to extract the total RNA of zebrafish embryos or cells and reverse-transcribed it into cDNA following the manufacturer’s protocol. The expression level of mRNA was assessed by qRT-PCR using specific primers and ChamQ SYBR qPCR Master Mix (Vazyme). The level of mRNA was calculated by using the 2−ΔΔCt method. Because the level of cdk2ap2 mRNA does not change during the first 6 h of zebrafish development, we used it as a control when measuring the mRNA level in zebrafish (Kushawah et al. 2020). The quantitative PCR primers are as follows:

  • kmt2d-F(zebrafish): 5′-GCACGAGTATGTCCAAAGCC-3′

  • kmt2d-F(zebrafish): 5′-CAGTCGACGGTACTGAGAGG-3′

  • cdk2ap2-F(zebrafish): 5′-AGGATCTTGTGGCTCTTCTCCATCAC-3′

  • cdk2ap2-R(zebrafish): 5′-TTTCACGGCTCATCTCCTCAATGAC-3′

  • Kmt2d-F(mus): 5′-ACCGAGTGGAAGAACAATGTG-3′

  • Kmt2d-R(mus): 5′-CGAATGATGGTGCCGATGTA-3′

  • Gapdh-F(mus): 5′-CTCCTGCACCACCAACTG CTTAG-3′

  • Gapdh-R(mus): 5′-GACGCCTGCTTCACCACC TTC-3′

The primary antibodies of rabbit monoclonal antihistone H3 (monomethyl K4; Abcam, ab8895), antihistone H3 (trimethyl K4; Abcam, ab8580), histone H3K4me3 (trimethyl Lys4) antibody (GeneTex, GTX128954), rabbit monoclonal anti-p-Akt (ser473; Cell Signaling, #4060), Akt (phospho Ser473) antibody (GeneTex, GTX11901), rabbit monoclonal anti-p-β-catenin (ser552; Cell Signaling, #5651), and rabbit monoclonal anti-cyclin D1 (Abcam, ab16663) were used to perform western blot analysis under standard protocol. Protein expression levels were quantitated by using Photoshop CS4 software (Adobe Company, USA).

CCK-8 assay and cell cycle

The cell counting kit-8 (CCK-8) assays were conducted using the CCK-8 kit (Beyotime, China) to measure the proliferation of ATDC5 cells. Flow cytometry was used to detect changes in the cell cycle through the Cell Cycle Analysis Kit (Beyotime). These experiments were performed following the manufacturer’s protocol and in triplicate.

Statistical analysis

The experimental data were statistically analyzed using GraphPad Prism 8 software. Data were expressed as mean ± standard deviation (SD), and the t-test was used for intergroup comparison. A score of P < 0.05 was considered statistically significant.

Results

Zebrafish kmt2d is highly conserved across multiple species

An analysis of multiple sequence alignments can help generate essential clues for genomic data analysis and reveal functionally important regions in proteins. KMT2D’s enzymatic activity is controlled by its SET domain—zebrafish, humans, and mice differ in only 7 amino acids (Supplementary Fig. 1a). Additionally, we used MEGA 6.06 to perform an evolutionary tree analysis, and the findings revealed that zebrafish kmt2d had the most prominent evolutionary connections to Bufo gargarizans, humans, and mice (Supplementary Fig. 1b). The findings suggest that zebrafish kmt2d is highly conserved, particularly in the catalytic domain and across a variety of species.

The influence of kmt2d deficiency in zebrafish embryos

Zebrafish larvae were utilized to assess the effects of kmt2d deficiency in order to investigate the role of KMT2D on growth. The CRISPR/Cas13d system was used to knock down the kmt2d gene in zebrafish (Supplementary Fig. 2; Hernandez-Huertas et al. 2021). By at least 6 hpf, the CRISPR/Cas13d system triggered kmt2d mRNA degradation (Cas13d alone vs Cas13d and gRNAs, P < 0.05, Fig. 1a). Concurrently, the H3K4me3 level was decreased in these embryos with a kmt2d deficit (Fig. 1b and c). The rate of morphological abnormalities was higher when Cas13d and 3 gRNAs targeting the kmt2d mRNA were co-injected into 1 cell-stage zebrafish embryo (65.7 vs 2.9%, P < 0.0001; Fig. 1e). Small eyes, a curved body, pericardial effusion, a mandibular deformity, a modest tail curvature, and a reduced yolk extension were among the morphological imperfections (Fig. 1d). In terms of growth, zebrafish in the knockdown group had a shorter body length than that in the control group (3.023 ± 0.2856 vs 3.298 ± 0.1003, P < 0.0001; Fig. 1f).

Fig. 1.

Fig. 1.

The influence of kmt2d deficiency in zebrafish embryos. a) Fifteen embryos per biological replicate were collected for zebrafish qRT-PCR at 6 h post injection. b and c) The level of the H3K4me3 protein. The band density was quantified and expressed as the relative gray value (compared with the control) by arbitrarily setting the control value as 1. Data were pooled from 3 independent experiments, and the results were represented as mean ± SD. d and e) Abnormal phenotypes including small eyes, curved body, pericardial effusion, mandibular deformity, slight tail curvature, and shortened yolk extension were observed in 3 dpf stage. n = 35 for each group. f) Body length was reduced in the kmt2d knockdown zebrafish. n = 19 for each group. g) Dysplasia formation in Meckel’s cartilage, ceratohyals, and ethmoid bones in the embryos with a co-injection of Cas13d mRNA and 3 gRNAs. n = 7 for each group. h) Quantification of length between Meckel’s cartilage and ceratohyal. kmt2d knockdowns were shorter when compared with those of control embryos. n = 7 for each group. eth, ethmoid plate; Cb, ceratobranchial; Ch, ceratohyal; M, Meckel’s cartilage; Pq, palatoquadrate. Scale bar: b) 1,000 μm; e) 500 μm. *P < 0.5, **P < 0.001, ***P < 0.0001.

Defects in bone development are pathological causes of short stature (Lui 2020). Because of its highly conserved endochondral ossification, the zebrafish are ideally suited for the genetic causes of short stature (Garcia et al. 2016). To identify skeletal alterations, the entire skeleton is stained with Alizarin red and Alcian blue. In comparison with embryos injected with Cas13d mRNA alone at 5 dpf, those with a co-injection of Cas13d mRNA and 3 gRNAs targeting kmt2d (6/7; 85.7%) failed to form the cranial bone, such as the ethmoid plate (Fig. 1g, red arrow). Additionally, visceral cartilages in zebrafish with kmt2d deficiency were considerably impacted (Fig. 1g, black arrow). The structures of the ceratobranchial that support the delicate gill tissues (Fig. 1g; Cb1-5) were completely absent in kmt2d knockdowns (7/7; 100%). The cartilage, which forms the lower jaw, was deformed (Fig. 1f, Meckel’s cartilage; 42.8%) or lacking (28.6%; Fig. 1g, palatoquadrate and ceratohyal). Meckel’s cartilage and the ceratohyal had an average length of 0.11 ± 0.007 mm in normal embryos (Fig. 1h, orange arrow; n = 7), whereas kmt2d knockdowns had a much shorter configuration with an average length of 0.09 ± 0.006 mm (Fig. 1h; n = 7). The incorrect use of the staining procedure led to eye defects in the kmt2d deficient embryos depicted in Fig. 1g. Co-injective of full-length kmt2d cDNA with Cas13d plus 3 gRNAs would be instructive to ascertain whether the phenotypes are caused by a downregulation of kmt2d. However, it proved difficult since the zebrafish kmt2d gene comprises 53 exons and a 17.6 kb mRNA that codes for a 362.7 kDa protein, making the extraction of full-length cDNA difficult. Overall, these findings showed that kmt2d was necessary for endochondral ossification to occur normally in zebrafish.

Kmt2d knockdown promoted ATDC5 cell cycle progression and proliferation in vitro

Increased proliferation may have an impact on the formation of bones and cartilage (Lui 2020). The ATDC5 cell line, isolated from mouse teratocarcinoma cells, is a chondrogenic cell line with a sequential process analogous to chondrocyte differentiation. Therefore, it is considered as a promising in vitro model to explore signaling pathways related to bone growth (Yao and Wang 2013). The proliferation of ATDC5 cells was then examined in relation to KMT2D. We created an ATDC5 cell line with Kmt2d permanently silenced by transfecting it with lentiviruses that expressed 2 Kmt2d-specific shRNAs, as shown in Fig. 2a. Additionally, the levels of both the H3K4me1 and the H3K4me3 proteins were steadily declining (Fig. 2b–f). The kmt2d knockdown group had increased proliferation of undifferentiated ATDC5 cells (Fig. 2g), which may be attributed to the increased expression of cell cycle–related molecular markers (cyclin D1, Fig. 3e). Previous research suggested that faulty cell cycle progression led to unchecked cellular proliferation and begot abnormal chondrogenesis (Beier 2005). We observed that a reduced expression of Kmt2d in ATDC5 cells accelerated the G1/S transition and increased cell cycle progression (Fig. 2h and i). Together, our findings suggest that KMT2D may play a crucial role in cell proliferation and cycle progression throughout the development of cartilage.

Fig. 2.

Fig. 2.

Kmt2d knockdown promoted ATDC5 cell cycle progression and proliferation in vitro. a) The level of Kmt2d mRNA in the ATDC5 cells. b–f) The levels of H3K4me1 and H3K4me3 proteins. The band density was quantified and expressed as the relative gray value (compared with the control) by arbitrarily setting the control value as 1. Data were pooled from 3 independent experiments, and the results were represented as mean ± SD. g) CCK-8 assay was performed to measure the proliferation of ATDC5 cells. The proliferation of the cells was enhanced in the knockdown of Kmt2d groups. h and i) Cell distribution in the G1, S, and G2/M phases of the sh-NC cells compared with those of the sh-Kmt2d cells. *P < 0.05, **P < 0.001, ***P < 0.0001.

Fig. 3.

Fig. 3.

Kmt2d knockdown resulted in Akt/β-catenin pathway activation in vitro. a and b) The relative p-Akt (Ser473) protein level decreased in the knockdown group. c and d) The relative p-β-catenin (Ser552) protein level decreased in the knockdown group. e and f) The relative cyclin D1 protein level decreased in the knockdown group. The band density was quantified and expressed as the relative gray value (compared with the control) by arbitrarily setting the control value as 1. Data were pooled from 3 independent experiments, and the results were represented as mean ± SD. *P < 0.05, **P < 0.001, ***P < 0.0001.

Knockdown of Kmt2d resulted in the Akt/β-catenin pathway activated in vitro

We have demonstrated a connection between KMT2D and the control of cell proliferation and cycle progression. Additionally, we propose that Akt signaling controls chondrocyte proliferation, and altering the activation of Akt may cause growth delay in a mouse model (Fukai et al. 2010). Also, of relevance, Akt activity can be fully activated by phosphorylation at serine 473 (Persad et al. 2001). In this study, western blot was used to detect p-Akt (ser473), and the results suggested that Kmt2d knockdown increased the expression level of p-Akt (ser473) compared with that of the control group (Fig. 3a and b). A β-catenin-dependent upregulation of cyclin D1 transcription and faster cell cycle entry can occur when Akt directly phosphorylates β-catenin at serine 552 (Han et al. 2021). Correspondingly, the knockdown group exhibited increased expression levels of p-β-catenin (ser552) and its downstream target gene cyclin D1, when compared with the control group (Fig. 3c–f). The findings herein suggest that the knockdown of the Kmt2d gene leads to the activation of the Akt/β-catenin signaling pathway.

To further investigate the involvement of the Akt/β-catenin signaling pathway, ATDC5 cells in the sh1-Kmt2d and sh2-Kmt2d groups were treated with 5 μmol/mL ZSTK474 (an Akt inhibitor, Beyotime) for a duration of 12 h. The results depicted in Fig. 4a–g demonstrate that the effects of reduced Kmt2d expression on Akt-induced transcriptional factor p-β-catenin (ser552), cyclin D1, and cell proliferation were reversed upon the administration of ZSTK474. These observations indicate that KMT2D may be positioned upstream, rather than downstream, of the Akt/β-catenin signaling pathway. In summary, the data presented in this study indicate that the knockdown of Kmt2d resulted in enhanced cell proliferation through the activation of the Akt/β-catenin signaling pathway.

Fig. 4.

Fig. 4.

The effect of Akt inhibition on β-catenin signaling in the group of Kmt2d knockdown chondrocytes. a–f) Cells in the groups of sh1-Kmt2d and sh2-Kmt2d were pretreated with ZSTK474 (5 μmol). The cell lysates of each group were prepared and probed for p-Akt (Ser473), p-β-catenin (Ser552), and cyclin D1 by western blot. The band density was quantified and expressed as the relative gray value (compared with the control) by arbitrarily setting the control value as 1. Data were pooled from 3 independent experiments, and the results were represented as mean ± SD. g) The enhanced cell proliferation caused by a low expression of Kmt2d could be partly reversed by Akt inhibition. *P < 0.05, **P < 0.001.

Inhibitor of Akt partially rescues the growth delay and chondrocyte malformation caused by kmt2d knockdown

We then asked whether p-Akt (ser473) and p-β-catenin (ser552) were affected in kmt2d deficiency embryos and the pharmacological inhibition of Akt/β-catenin signaling could rescue the growth delay and chondrocyte malformation caused by kmt2d knockdown. Western blot was used to detect p-Akt (ser473) and p-β-catenin (ser552), and the expression levels of both increased in the knockdown group compared with the control group (Fig. 5a and b). Zebrafish with the knockdown of kmt2d were subjected to treatment with a concentration of 5 μmol/mL of ZSTK474 from 24 hpf to 5 dpf, and 0.1% of the DMSO control was utilized. We observed that the diminished body length in kmt2d knockdowns was partially mitigated by the administration of ZSTK474, as depicted in Fig. 5c. Alcian blue staining of 5 dpf kmt2d knockdowns treated with ZSTK474 showed a rescue of the lower jaw in most embryos (Fig. 5e; Meckel’s cartilage and palatoquadrate; 9/10). Similarly, the average distance length between Meckel’s cartilage and ceratohyal also demonstrated a rescue effect, which was attributed to the rescue of the cartilage (Fig. 5d and Fig. 5e; n = 10). Similarly, the fin ceratobranchial elements of 5 dpf kmt2d knockdowns treated with ZSTK474 showed rescue in some embryos (Fig. 5d; Cb1-5; 6/10). In addition, the kmt2d knockdowns exposed to the compounds showed a recovery of craniofacial structures in a few embryos (Fig. 5d; 4/10). Thus, the inhibition of Akt in the kmt2d knockdowns could partially rescue the growth impairment and aberrant cartilage phenotypes observed in the zebrafish model of KS.

Fig. 5.

Fig. 5.

The growth delay and chondrocyte malformation induced by kmt2d deficiency can be partially alleviated by the inhibition of Akt. a and b) The levels of the p-Akt (ser473) and p-β-catenin (ser552) proteins. The band density was quantified and expressed as the relative gray value (compared with the control) by arbitrarily setting the control value as 1. Data were pooled from 3 independent experiments, and the results were represented as mean ± SD. c) The reduced body length in kmt2d knockdowns was partially alleviated by ZSTK474. n = 10 for each group. d and e) The asymmetrical morphology ceratohyal and Meckel’s cartilage in kmt2d knockdowns was partially corrected. n = 10 for each group. Scale bar: d) 100 μm. *P < 0.05, **P < 0.001, ***P < 0.0001. Cb, ceratobranchial; Ch, ceratohyal; M, Meckel’s cartilage; Pq, palatoquadrate.

Discussion

Short stature is a common feature in individuals with KS (Barry et al. 2022). Because rare diseases are extreme manifestations of genetic disorders, a study of these cases will help elucidate the understanding of the mechanism of human disease and promote potential new treatments. In this zebrafish and chondrocyte study, expression and functional studies were undertaken to explore the mechanism of low expression of the Kmt2d gene leading to short stature through an activated Akt/β-catenin signal pathway.

The CRISPR/Cas13d system can serve as an effective additional knockdown tool in zebrafish embryos. This study found that the CRISPR/Cas13d system can disrupt kmt2d function in the zebrafish embryonic model. Previous investigations have demonstrated that the administration of Morpholino (MO)s specifically targeting kmt2d mRNA resulted in the development of craniofacial abnormalities in zebrafish embryos (Bögershausen et al. 2015; Van Laarhoven et al. 2015). Similarly, embryos co-injected with Cas13d and 3 gRNAs targeting kmt2d mRNA displayed a significant reduction in kmt2d mRNA levels and H3K4me3 protein level, as well as related craniofacial defects. Interestingly, cranium bones, such as ethmoid plate, have defects akin to those reported in kmt2d MO-injected embryos (Van Laarhoven et al. 2015). Specifically, visceral cartilage anomalies in embryos co-injected with Cas13d plus kmt2d mRNA gRNAs were also observed in kmt2d MO-injected embryos (Bögershausen et al. 2015). Finally, similar to previous kmt2d MO-treated experiments, we also detected a shorter distance between Meckel’s cartilage and ceratohyal when kmt2d mRNA was targeted using Cas13d (Bögershausen et al. 2015). The results of this study provide further basis for studying the etiology of developmental defects in KS by using a CRISPR/Cas13d system to disrupt the kmt2d gene based on RNA editing.

During the process of endochondral ossification, bones are formed through the development of cartilage templates. Chondrocytes within these templates undergo proliferation and differentiation, eventually transforming into hypertrophic chondrocytes. Over time, these hypertrophic chondrocytes are gradually replaced by bone (Wuelling and Vortkamp 2010). Disruption of the G1/S checkpoint is a critical step in chondrocyte proliferation and skeletal growth (Stegen et al. 2022). KMT2D has been identified as a regulator of proliferation and cell cycle with varying outcomes depending on the specific cell type. Pang et al. (2021) conducted a study in which they observed that a knockdown of the Kmt2d gene resulted in a reduction in proliferation and induced a G1 phase arrest in dental epithelial cells. This effect was achieved through the activation of the Wnt/β-catenin signaling pathway. The upregulation of cyclin D1 and subsequent promotion of proliferation were observed in oral squamous cell carcinoma cells upon an overexpression of Kmt2d (Wang et al. 2022). Conversely, the conditional deletion of Kmt2d in mice during early B-cell development resulted in an enhanced proliferation of B cells (Zhang et al. 2015). Additionally, it was observed that cutaneous squamous cell carcinoma lacking KMT2D exhibited heightened cell proliferation and a faster G1/S transition in the cell cycle (Dauch et al. 2022). Our findings revealed a noteworthy enhanced proliferation in ATDC5 cells. The results of a flow cytometric analysis showed that the percentage of chondrocytes in the G1 phase was markedly decreased, whereas the percentage of chondrocytes in the S phase was significantly increased in Kmt2d gene knockdown cells compared with control cells. This leads to the inference that a knockdown of Kmt2d promotes proliferation via the promotion of G1/S progression in ATDC5 cells.

Kmt2d was shown to induce precocious chondrocyte differentiation in vitro, involving the loss of KMT2D-mediated H3K4me3 at the Shox2 gene and release of Sox9 inhibition (Fahrner et al. 2019). Our study focused on the impact of Kmt2d deficiency on chondrocyte proliferation, which is the initial and key process in endochondral ossification. However, the observation that the knockdown of Kmt2d resulted in an increase in both proliferation and differentiation of chondrocytes is paradoxical, as it is generally understood that cells undergo cell cycle arrest before entering the differentiation process. For example, pRb reduced proliferation and promoted chondrocyte differentiation by regulating cells exiting the cell cycle (Vale-Cruz et al. 2008). Additionally, deletion of Cdk1 inhibits the proliferation and accelerates the differentiation of chondrocytes (Saito et al. 2016). Perhaps, KMT2D has dual roles in chondrogenesis, promoting cell proliferation while enhancing differentiation. This concept is buttressed by the action of other genes, which affect both cartilage proliferation and differentiation. For example, Cdc5l enhanced proliferation by inhibiting Wee1 expression along with eliciting differentiation in ATDC5 cells; both of these effects were mediated by modulating pre-mRNA splicing (Jokoji et al. 2021). Secondly, the overexpression of the Flrt2 gene in ATDC5 cells resulted in an accelerated proliferation rate and enhanced chondrogenic differentiation (Xu et al. 2011). Finally, neuropeptide W can promote proliferation and differentiation in ATDC5 cells (Wang et al. 2019). As the physiological role of KMT2D in the endochondral ossification process in vivo remains unresolved, conducting studies on cartilage-specific Kmt2d knockout mice or zebrafish studies could provide invaluable insights. The mechanism by which KMT2D coordinates chondrocyte proliferation and differentiation during endochondral bone development remains elusive.

As described previously, both Akt and β-catenin were frequently dysregulated in mice with dwarfism and delayed bone development (Chen et al. 2001; Xia et al. 2019). In our study, we focused on the role of Akt/β-catenin in the effects of KMT2D on chondrocyte proliferation. β-Catenin plays a pivotal role in the proliferation of chondrocytes and the formation of the skeletal system (Xia et al. 2019). The western blot results revealed that the knockdown of the Kmt2d gene induced β-catenin activation and caused an upregulation of its targets including cyclin D1. Akt, a prosurvival factor, has garnered significant attention in the scientific community due to its central role in various physiological processes and pathological conditions. Previous studies have established the function of Akt in chondrocytes during endochondral ossification. The deletion of Akt1 resulted in a delay in calcification, whereas the activation of Akt in embryonic chondrocytes facilitated chondrocyte proliferation and hindered hypertrophic differentiation (Ford-Hutchinson et al. 2007). In addition, there is evidence that a study also indicated the regulation of β-catenin by Akt in chondrocyte cells (Wang et al. 2010). Phosphorylation of β-catenin by Akt facilitates its nuclear localization and enhances transcription of its target genes. By extension, further experiments are necessary to further elucidate the role of the Akt/β-catenin pathway as a mediator between KMT2D and chondrocyte development.

Conclusion

Our results explored the role of KMT2D protein in chondrocyte functions and demonstrated, for the first time, that KMT2D modulates bone growth conceivably via regulation of the Akt/β-catenin pathway.

Supplementary Material

jkad298_Supplementary_Data

Acknowledgments

The authors offer their sincere thanks to Prof. Weng Zuquan, who provided a zebrafish research platform, as well Xia Wei, Lisha Li, and Yan Zeng, for their assistance. The authors also thanks the Molecular Evolutionary Genetics Analysis (MEGA) software, which was used to molecular evolutionary genetic analysis.

Contributor Information

Huakun Shangguan, Department of Endocrinology, Genetics and Metabolism, Fuzhou Children’s Hospital of Fujian Medical University, Fuzhou 350000, China.

Xiaozhen Huang, Department of Endocrinology, Genetics and Metabolism, Fuzhou Children’s Hospital of Fujian Medical University, Fuzhou 350000, China.

Jinduan Lin, Department of Endocrinology, Genetics and Metabolism, Fuzhou Children’s Hospital of Fujian Medical University, Fuzhou 350000, China.

Ruimin Chen, Department of Endocrinology, Genetics and Metabolism, Fuzhou Children’s Hospital of Fujian Medical University, Fuzhou 350000, China.

Data availability

The data supporting the findings of this study are available within the article and supplementary material. The data that support the findings of this study are made available.

Supplemental material available at G3 online.

Funding

This work was sponsored by the Natural Science Foundation of Fujian Province (no. 2020J01125).

Author contributions

H.S. performed the experiment, conducted the data analysis and interpretation, and wrote the manuscript. X.H. and J.L. helped in conducting the qRT-PCR experiment and generating gRNA and Cas13d mRNA. R.C. contributed to the study design, helped in data analysis, and was involved in revision of the first draft.

Ethics approval and consent to participate

According to the new EU Directive 2010/63/EU on the protection of animals used for scientific purposes, 0–5 dpf of zebrafish embryos are not defined as protected and, therefore, do not fall into the regulatory frameworks dealing with animal experimentation (Strähle et al. 2012).

Literature cited

  1. Adam M, Banka S, Bjornsson H, Bodamer O, Chudley A, Harris J, Kawame H, Lanpher B, Lindsley A, Merla G, et al. 2019. Kabuki syndrome: international consensus diagnostic criteria. J Med Genet. 56(2):89–95. doi: 10.1136/jmedgenet-2018-105625. [DOI] [PubMed] [Google Scholar]
  2. Barry KK, Tsaparlis M, Hoffman D, Hartman D, Adam MP, Hung C, Bodamer OA. 2022. From genotype to phenotype-a review of Kabuki syndrome. Genes (Basel). 13(10):1761. doi: 10.3390/genes13101761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Beier F. 2005. Cell-cycle control and the cartilage growth plate. J Cell Physiol. 202(1):1–8. doi: 10.1002/jcp.20111. [DOI] [PubMed] [Google Scholar]
  4. Bögershausen N, Tsai IC, Pohl E, Kiper P, Beleggia F, Percin EF, Keupp K, Matchan A, Milz E, Alanay Y, et al. 2015. RAP1-mediated MEK/ERK pathway defects in Kabuki syndrome. J Clin Invest. 125(9):3585–3599. doi: 10.1172/jci80102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen WS, Xu PZ, Gottlob K, Chen ML, Sokol K, Shiyanova T, Roninson I, Weng W, Suzuki R, Tobe K, et al. 2001. Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev. 15(17):2203–2208. doi: 10.1101/gad.913901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cox DBT, Gootenberg JS, Abudayyeh OO, Franklin B, Kellner MJ, Joung J. 2017. RNA editing with CRISPR-Cas13. Science. 358(6366):1019–1027. doi: 10.1126/science.aaq0180 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dauch C, Shim S, Cole MW, Pollock NC, Beer AJ, Ramroop J, Klee V, Allain DC, Shakya R, Knoblaugh SE, et al. 2022. KMT2D loss drives aggressive tumor phenotypes in cutaneous squamous cell carcinoma. Am J Cancer Res. 12(3):1309–1322. [PMC free article] [PubMed] [Google Scholar]
  8. Fahrner JA, Lin WY, Riddle RC, Boukas L, DeLeon VB, Chopra S, Lad SE, Luperchio TR, Hansen KD, Bjornsson HT. 2019. Precocious chondrocyte differentiation disrupts skeletal growth in Kabuki syndrome mice. JCI Insight. 4(20):e129380. doi: 10.1172/jci.insight.129380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ford-Hutchinson AF, Ali Z, Lines SE, Hallgrímsson B, Boyd SK, Jirik FR. 2007. Inactivation of Pten in osteo-chondroprogenitor cells leads to epiphyseal growth plate abnormalities and skeletal overgrowth. J Bone Miner Res. 22(8):1245–1259. doi: 10.1359/jbmr.070420. [DOI] [PubMed] [Google Scholar]
  10. Fukai A, Kawamura N, Saito T, Oshima Y, Ikeda T, Kugimiya F, Higashikawa A, Yano F, Ogata N, Nakamura K, et al. 2010. Akt1 in murine chondrocytes controls cartilage calcification during endochondral ossification under physiologic and pathologic conditions. Arthritis Rheum. 62(3):826–836. doi: 10.1002/art.27296. [DOI] [PubMed] [Google Scholar]
  11. Garcia GR, Noyes PD, Tanguay RL. 2016. Advancements in zebrafish applications for 21st century toxicology. Pharmacol Ther. 161:11–21. doi: 10.1016/j.pharmthera.2016.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Han J, Lin K, Zhang X, Yan L, Chen Y, Chen H, Liu J, Liu J, Wu Y. 2021. PTEN-mediated AKT/β-catenin signaling enhances the proliferation and expansion of Lgr5+ hepatocytes. Int J Biol Sci. 17(3):861–868. doi: 10.7150/ijbs.56091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hernandez-Huertas L, Kushawah G, Diaz-Moscoso A, Tomas-Gallardo L, Moreno-Sanchez I, Pescador G, Bazzini AA, Moreno-Mateos MA. 2021. Optimized CRISPR-RfxCas13d system for RNA targeting in zebrafish embryos. STAR Protoc. 3(1):101058. doi: 10.1016/j.xpro.2021.101058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Huisman C, Kim Y, Jeon S, Shin B, Choi J, Lim S, Youn S, Park Y, Medha KC, Kim S, et al. 2021. The histone H3-lysine 4-methyltransferase Mll4 regulates the development of growth hormone-releasing hormone-producing neurons in the mouse hypothalamus. Nat Commun. 12(1):256. doi: 10.1038/s41467-020-20511-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jefri M, Zhang X, Stumpf P, Zhang L, Peng H, Hettige N, Theroux J, Aouabed Z, Wilson K, Deshmukh S, et al. 2022. Kabuki syndrome stem cell models reveal locus specificity of histone methyltransferase 2D (KMT2D/MLL4). Hum Mol Genet. 31(21):3715–3728. doi: 10.1093/hmg/ddac121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jokoji G, Maeda S, Oishi K, Ijuin T, Nakajima M, Tawaratsumida H, Kawamura I, Tominaga H, Taketomi E, Ikegawa S, et al. 2021. CDC5L promotes early chondrocyte differentiation and proliferation by modulating pre-mRNA splicing of SOX9, COL2A1, and WEE1. J Biol Chem. 297(2):100994. doi: 10.1016/j.jbc.2021.100994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Knott GJ, Doudna JA. 2018. CRISPR-Cas guides the future of genetic engineering. Science. 361(6405):866–869. doi: 10.1126/science.aat5011 [DOI] [PMC free article] [PubMed]
  18. Kushawah G, Hernandez-Huertas L, Abugattas-Nuñez Del Prado J, Martinez-Morales JR, DeVore ML, Hassan H, Moreno-Sanchez I, Tomas-Gallardo L, Diaz-Moscoso A, Monges DE, et al. 2020. CRISPR-Cas13d induces efficient mRNA knockdown in animal embryos. Dev Cell. 54(6):805–817.e807. doi: 10.1016/j.devcel.2020.07.013. [DOI] [PubMed] [Google Scholar]
  19. Lui JC. 2020. Home for a rest: stem cell niche of the postnatal growth plate. J Endocrinol. 246(1):R1–R11. doi: 10.1530/joe-20-0045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Nagy A, Gertsenstein M, Vintersten K, Behringer R. 2009. Alizarin red staining of post-natal bone in mouse. Cold Spring Harb Protoc. 2009(3):pdb.prot5171. doi: 10.1101/pdb.prot5171 [DOI] [PubMed]
  21. Pang L, Tian H, Gao X, Wang W, Wang X, Zhang Z. 2021. KMT2D deficiency disturbs the proliferation and cell cycle activity of dental epithelial cell line (LS8) partially via Wnt signaling. Biosci Rep. 41(11):BSR20211148. doi: 10.1042/bsr20211148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Persad S, Attwell S, Gray V, Mawji N, Deng JT, Leung D, Yan J, Sanghera J, Walsh MP, Dedhar S. 2001. Regulation of protein kinase B/Akt-serine 473 phosphorylation by integrin-linked kinase: critical roles for kinase activity and amino acids arginine 211 and serine 343. J Biol Chem. 276(29):27462–27469. doi: 10.1074/jbc.M102940200. [DOI] [PubMed] [Google Scholar]
  23. Saito M, Mulati M, Talib SZ, Kaldis P, Takeda S, Okawa A, Inose H. 2016. The indispensable role of cyclin-dependent kinase 1 in skeletal development. Sci Rep. 6:20622. doi: 10.1038/srep20622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Stegen S, Loopmans S, Stockmans I, Moermans K, Carmeliet P, Carmeliet G. 2022. De novo serine synthesis regulates chondrocyte proliferation during bone development and repair. Bone Res. 10(1):14. doi: 10.1038/s41413-021-00185-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Strähle U, Scholz S, Geisler R, Greiner P, Hollert H, Rastegar S, Schumacher A, Selderslaghs I, Weiss C, Witters H, et al. 2012. Zebrafish embryos as an alternative to animal experiments–a commentary on the definition of the onset of protected life stages in animal welfare regulations. Reprod Toxicol. 33(2):128–132. doi: 10.1016/j.reprotox.2011.06.121. [DOI] [PubMed] [Google Scholar]
  26. Usluer E, Sayın G, Güneş N, Kasap B, Tüysüz BJ. 2022. Investigation of genetic and phenotypic heterogeneity in 37 Turkish patients with Kabuki and Kabuki-like phenotype. Am J Med Genet A. 188(10):2976–2987. doi: 10.1002/ajmg.a.62944. [DOI] [PubMed] [Google Scholar]
  27. Vale-Cruz DS, Ma Q, Syme J, LuValle PA. 2008. Activating transcription factor-2 affects skeletal growth by modulating pRb gene expression. Mech Dev. 125(9–10):843–856. doi: 10.1016/j.mod.2008.06.010. [DOI] [PubMed] [Google Scholar]
  28. Van Laarhoven PM, Neitzel LR, Quintana AM, Geiger EA, Zackai EH, Clouthier DE, Artinger KB, Ming JE, Shaikh TH. 2015. Kabuki syndrome genes KMT2D and KDM6A: functional analyses demonstrate critical roles in craniofacial, heart and brain development. Hum Mol Genet. 24(15):4443–4453. doi: 10.1093/hmg/ddv180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. van Montfort L, Gerver WJM, Kooger BLS, Plat J, Bierau J, Stumpel CTRM, Schott DA. 2021. Follow-up study of growth hormone therapy in children with Kabuki syndrome: two-year treatment results. Horm Res Paediatr. 94(7–8):285–296. doi: 10.1159/000519963 [DOI] [PubMed]
  30. Wang X, Li R, Wu L, Chen Y, Liu S, Zhao H, Wang Y, Wang L, Shao Z. 2022. Histone methyltransferase KMT2D cooperates with MEF2A to promote the stem-like properties of oral squamous cell carcinoma. Cell Biosci. 12(1):49. doi: 10.1186/s13578-022-00785-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wang L, Shao YY, Ballock RT. 2010. Thyroid hormone-mediated growth and differentiation of growth plate chondrocytes involves IGF-1 modulation of beta-catenin signaling. J Bone Miner Res. 25(5):1138–1146. doi: 10.1002/jbmr.5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wang R, Zheng C, Jiang W, Xie X, Liao R, Zhou G. 2019. Neuropeptide W regulates proliferation and differentiation of ATDC5: possible involvement of GPR7 activation, PKA and PKC-dependent signalling cascades. J Cell Mol Med. 23(3):2093–2102. doi: 10.1111/jcmm.14118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wuelling M, Vortkamp A. 2010. Transcriptional networks controlling chondrocyte proliferation and differentiation during endochondral ossification. Pediatr Nephrol. 25(4):625–631. doi: 10.1007/s00467-009-1368-6. [DOI] [PubMed] [Google Scholar]
  34. Xia C, Wang P, Fang L, Ge Q, Zou Z, Dong R, Zhang P, Shi Z, Xu R, Zhang L, et al. 2019. Activation of β-catenin in Col2-expressing chondrocytes leads to osteoarthritis-like defects in hip joint. J Cell Physiol. 234(10):18535–18543. doi: 10.1002/jcp.28491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Xu Y, Wei K, Kulyk W, Gong SG. 2011. FLRT2 promotes cellular proliferation and inhibits cell adhesion during chondrogenesis. J Cell Biochem. 112(11):3440–3448. doi: 10.1002/jcb.23271. [DOI] [PubMed] [Google Scholar]
  36. Yao Y, Wang Y. 2013. ATDC5: an excellent in vitro model cell line for skeletal development. J Cell Biochem. 114(6):1223–1229. doi: 10.1002/jcb.24467. [DOI] [PubMed] [Google Scholar]
  37. Zhang J, Dominguez-Sola D, Hussein S, Lee JE, Holmes AB, Bansal M, Vlasevska S, Mo T, Tang H, Basso K, et al. 2015. Disruption of KMT2D perturbs germinal center B cell development and promotes lymphomagenesis. Nat Med. 21(10):1190–1198. doi: 10.1038/nm.3940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhang C, Konermann S, Brideau NJ, Lotfy P, Wu X, Novick SJ, Strutzenberg T, Griffin PR, Hsu PD, Lyumkis D. 2018. Structural basis for the RNA-guided ribonuclease activity of CRISPR-Cas13d. Cell. 175(1):212–223.e17. doi: 10.1016/j.cell.2018.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

jkad298_Supplementary_Data

Data Availability Statement

The data supporting the findings of this study are available within the article and supplementary material. The data that support the findings of this study are made available.

Supplemental material available at G3 online.


Articles from G3: Genes|Genomes|Genetics are provided here courtesy of Oxford University Press

RESOURCES