Skip to main content
NCBI home page
Genetics logoLink to Genetics
. 2024 Jan 7;226(3):iyae001. doi: 10.1093/genetics/iyae001

A new hybrid incompatibility locus between Drosophila melanogaster and Drosophila sechellia

Jackson Bladen 1,#, Jacob C Cooper 2,#, Jackson T Ridges 3,#, Ping Guo 4, Nitin Phadnis 5,✉,3
Editor: A Larracuente
PMCID: PMC10917521  PMID: 38184848

Abstract

Despite the fundamental importance of hybrid incompatibilities to the process of speciation, there are few cases where the evolution and genetic architecture of hybrid incompatibilities are understood. One of the longest studied hybrid incompatibilities causes F1 hybrid male inviability in crosses between Drosophila melanogaster females and males from the Drosophila simulans clade of species—Drosophila simulans, Drosophila mauritiana, and Drosophila sechellia. Here, we discover dramatic differences in the manifestation of this lethal hybrid incompatibility among the D. simulans clade of species. In particular, F1 hybrid males between D. melanogaster and D. sechellia are resistant to hybrid rescue through RNAi knockdown of an essential hybrid incompatibility gene. To understand the genetic basis of this inter-species difference in hybrid rescue, we developed a triple-hybrid mapping method. Our results show that 2 discrete large effect loci and many dispersed small effect changes across the genome underlie D. sechellia aversion to hybrid rescue. The large effect loci encompass a known incompatibility gene Lethal hybrid rescue (Lhr) and previously unknown factor, Sechellia aversion to hybrid rescue (Satyr). These results show that the genetic architecture of F1 hybrid male inviability is overlapping but not identical in the 3 inter-species crosses. Our results raise questions about whether new hybrid incompatibility genes can integrate into an existing hybrid incompatibility thus increasing in complexity over time, or if the continued evolution of genes can gradually strengthen an existing hybrid incompatibility.

Keywords: hybrid incompatibility, genetic variation, Drosophila, genomics, speciation, evolution

Through a newly-developed triple hybrid mapping method, Bladen, Cooper, Ridges et al. reveal the existence of a previously undiscovered hybrid lethal factor between D. melanogaster and its sister species D. sechellia. This study raises questions about whether new hybrid incompatibility genes can integrate into an existing hybrid incompatibility, or if the continued evolution of genes can strengthen an existing hybrid incompatibility.

Introduction

Sturtevant's discovery of Drosophila simulans as a sister species to Drosophila melanogaster inspired more than a century of studies into the genetic basis of hybrid incompatibilities—a problem central to understanding the origins of species (Sturtevant 1919; Provine 1991; Barbash 2010). It later became clear that the D. simulans clade consists of 3 closely related species—D. simulans, D. mauritiana, and D. sechellia—which simultaneously diverged from each other between 250 and 413 thousand years ago (David 1974; Tsacas and Baechli 1981; Kliman et al. 2000; McDermott and Kliman 2008; Garrigan et al. 2012; Schrider et al. 2018; Suvorov et al. 2022) (Fig. 1a). The developmental patterns of hybrid inviability between D. melanogaster and all 3 D. simulans clade species are similar (David 1974; Sánchez and Dübendorfer 1983; Lachaise et al. 1986; Hutter et al. 1990; Sanchez et al. 1994). When D. melanogaster females are crossed to males from each of the D. simulans clade species, the resulting F1 hybrid males are inviable and F1 hybrid females are viable but sterile (Sturtevant 1920). In the reciprocal direction, when D. melanogaster males are crossed to D. simulans clade females, the resulting F1 hybrid females are inviable and F1 hybrid males are viable but sterile (David 1974; Sawamura, Taira et al. 1993, Sawamura, Yamamoto et al. 1993; Ferree and Barbash 2009).

Fig. 1.

Fig. 1.

Open in a new tab

A single dominant hybrid incompatibility underlies F1 hybrid male lethality between D. melanogaster and D. simulans. a) The relationship between D. melanogaster and the D. simulans clade species. The common ancestor of the D. simulans clade species diverged from D. melanogaster between 4.3 and 6.5 million years ago. The 3 D. simulans clade species simultaneously diverged from each other between 250 and 413 thousand years ago. b) Architecture of the hybrid incompatibility between D. melanogaster and D. simulans. When D. melanogaster females are crossed to D. simulans males, the resulting F1 hybrid males are inviable. Three incompatibility genes—Hmrmel, Lhrsim, and gfzfsim—have been identified as necessary for this inviability. Removing any single incompatible allele rescues F1 hybrid male viability.

Studies of the genetic basis of F1 hybrid male inviability between D. melanogaster females and D. simulans males have identified 3 hybrid incompatibility genes—Hybrid male rescue (Hmr), Lethal hybrid rescue (Lhr), and GST-containing FLYWCH Zinc-Finger protein (gfzf) (Pontecorvo 1943; Watanabe 1979; Hutter and Ashburner 1987; Barbash and Ashburner 2003; Brideau et al. 2006; Phadnis et al. 2015). In hybrids, only 1 allele of each gene is incompatible (Hmrmel, Lhrsim, and gfzfsim); the simultaneous presence of all incompatible alleles is required for F1 hybrid male inviability (Fig. 1b). Removing any 1 of the incompatible alleles is sufficient to restore F1 hybrid male viability. For example, D. melanogaster females carrying null mutations at Hmr produce viable F1 hybrid males in crosses with all 3 species of the D. simulans clade (Hutter and Ashburner 1987). This suggests that a single dominant hybrid incompatibility may underlie F1 hybrid male inviability between D. melanogaster and all 3 D. simulans clade species. If a single dominant hybrid incompatibility is shared in all 3 inter-species hybrids, then removal of the incompatible alleles of Lhr or gfzf should also rescue the viability of F1 hybrid males in all 3 inter-species crosses. However, hybrid rescue mutations in Lhr have only been isolated in D. simulans (Watanabe 1979). Parallel tests of the involvement of Lhr in D. melanogaster–D. mauritiana hybrids and D. melanogaster–D. sechellia hybrids are therefore not currently possible.

RNAi knockdown of gfzfsim is sufficient to rescue F1 hybrid males between D. melanogaster and D. simulans (Phadnis et al. 2015). In these hybrid rescue crosses, all necessary transgenes come from D. melanogaster and the RNAi target sequences for gfzf knockdown are shared across all species of the D. simulans clade (gfzfsib) (Fig. 2a). This allows a test whether an identical genetic architecture underlies F1 hybrid male inviability between D. melanogaster and all 3 D. simulans clade species. Here, we tested whether gfzfsib knockdown rescues F1 hybrid males between D. melanogaster–D. mauritiana and D. melanogaster–D. sechellia crosses, as it does in D. melanogaster–D. simulans crosses. We found that gfzfsib knockdown robustly rescues F1 hybrid males in D. melanogaster–D. simulans and D. melanogaster–D. mauritiana crosses. Unexpectedly, the same gfzfsib knockdown fails to rescue F1 hybrid males in D. melanogaster–D. sechellia crosses. Although this is reminiscent of a broader pattern of D. melanogaster–D. sechellia hybrids being generally worse off and harder to rescue than the other 2 inter-species hybrids with Hmr, this could also be an artifact of variation in RNAi knockdown efficiency between the 3 inter-species hybrids (Hutter and Ashburner 1987; Barbash et al. 2000; Barbash and Ashburner 2003; Matute et al. 2014). We found that the RNAi pathway is functional and gfzfsib knockdown efficiency is consistent across all 3 inter-species hybrids, confirming that D. melanogaster–D. sechellia hybrids are indeed averse to rescue by gfzfsib knockdown. Contrary to the idea of a single shared hybrid incompatibility, this implies that the genetic basis of F1 hybrid male inviability is overlapping, but not identical in all 3 inter-species crosses.

Fig. 2.

Fig. 2.

Open in a new tab

Gfzf knockdown rescues D. melanogaster hybrids with D. simulans and D. mauritiana, but not with D. sechellia. a) gfzf RNAi target sites in D. melanogaster and all 3 D. simulans clade species. The presence of a small indel enables specific targeting of the gfzfsib allele. The first gfzf RNAi target site has a perfect match for D. simulans and D. mauritiana, but not for D. sechellia. The second gfzf RNAi target site has a perfect match across all D. simulans clade species. b) Hybrid rescue crosses with multiple strains from each of the 3 D. simulans clade species. With RNAi off, little or no hybrid rescue is observed. With RNAi on, robust rescue is observed in D. simulans and D. mauritiana hybrids, but not in D. sechellia hybrids. The percent hybrid male rescue is calculated taking into account that only 25% of hybrid males receive both constructs required for gfzfsib RNAi knockdown.

To further understand why gfzfsib knockdown does not rescue D. melanogaster–D. sechellia F1 hybrid males, we devised a genetic mapping approach that exploits the inter-species variation in hybrid rescue between D. melanogaster and the D. simulans clade. We found that the genetic basis of D. sechellia aversion to hybrid rescue is partially explained by 2 major effect loci in D. sechellia. The first locus maps to the genomic location of Lhr. This raises the intriguing possibility that although both the D. simulans and D. sechellia alleles of Lhr are incompatible, functional differences between the 2 alleles make D. sechellia hybrids averse to rescue. The second locus maps to a genomic location not previously implicated in this hybrid incompatibility; we name this novel locus Sechellia aversion to hybrid rescue (Satyr). Additionally, we detect many small effect changes distributed across the D. sechellia genome that contribute to aversion to hybrid rescue. Our study provides a nuanced view of the architecture of hybrid incompatibilities, uncovers the involvement of a novel locus in this hybrid incompatibility, and provides a rare window into the continued evolution of hybrid incompatibilities after their initial formation.

Materials and methods

Fly strains

The natural populations and species stocks that we acquired for this experiment can be found in Table 1. These lines were gifts from H.S. Malik, D. Matute, or acquired from the Drosophila Species Stock Center. We generated several lines for our triple-hybrid mapping cross. First, we build a recombinant RNAi-gfzfsib, Zhr1 chromosome by recovering the products of RNAi-gfzfsib (Phadnis et al. 2015) crossed to Zhr1 (Bloomington Drosophila Stock Center 25140). We then confirmed the ability of this chromosome to rescue F1 hybrid males by crossing it to the C(1)RM (attached-X) D. simulans stock. Next, we generated 3 independent stocks of D. sechellia w (Drosophila Species Stock Center 14021-0248.15) by single pair inbreeding 3 replicates of the base stock for 5 generations. To induce our RNAi system, we crossed the RNAi-gfzfsib, Zhr1 chromosome to an Actin5C-GAL4/CyO line (Bloomington Drosophila Stock Center 25374), and crossed the resulting CyO+ F1 males to attached-X D. simulans–D. sechellia F1 hybrid females to make the triple-hybrid progeny.

Table 1.

Species and strains.

Name Species Origin
WT (07) D. simulans Wanie-Rukula, Congo
WT (08) D. simulans Wanie-Rukula, Congo
w501 D. simulans Drosophila Species Stock Center
C(1)RM yw/C(1;Y) D. simulans Drosophila Species Stock Center
iso-105 D. mauritiana Drosophila Species Stock Center
w139 D. mauritiana Malik Lab
WT (09) D. mauritiana Malik Lab
iso-75 D. mauritiana Malik Lab
w[1] D. mauritiana Drosophila Species Stock Center
w D. sechellia Drosophila Species Stock Center
WT (03) D. sechellia Drosophila Species Stock Center
NF13 D. sechellia Matute Lab
NF14 D. sechellia Matute Lab
ArvoB3 D. sechellia Matute Lab
Open in a new tab

Fly husbandry

For our initial tests of hybrid male rescue, we allowed parental flies to mate for 2 days at 25°C before flipping them to fresh media. We incubated the vials containing hybrid progeny at 18°C, as during the larval stages hybrid larvae become extremely temperature sensitive (Barbash et al. 2000). We counted the progeny at 23 days postmating. For generating the triple-hybrid flies, we found that the attached-X genotype is lethal at 25°C. For these crosses, we instead allowed mating at 21°C for 2 days, followed by incubating the progeny at 18°C until 23 days postmating.

Measuring eye pigment in w-RNAi hybrids

To test for functional variation of RNAi efficiency in hybrids, we crossed D. melanogaster females to white D. melanogaster, D. simulans, D. mauritiana, and D. sechellia males. The D. melanogaster females used in these crosses contain a functional white gene and an RNAi construct targeting whitemel (Bloomington Drosophila Stock Center 32067). To measure the pigment intensity of eyes in our different genotypes, we gathered images of both eyes from individual flies using a Lieca MC120 HD camera on a Lieca MC165 FC dissection scope with overhead illumination. To control for changes in ambient lighting, we included a piece of blue construction paper as the background, and captured the image such that segments of the construction paper were not in the shadow of the fly. We used the gray scale of these images to measure pixel intensity in ImageJ, and normalized the values to that of the construction paper in the background. We normalized all values to the mean of the wild-type control, and used a Pairwise Wilcoxon Rank Sum test in R to test for statistical significance.

Measuring gfzf expression in hybrids

To verify the presence of the RNAi construct and GAL4, we removed the head from hybrid males and performed PCR. To measure gfzf expression, we extracted RNA from the remainder of the body using the DirectZol RNA Miniprep Kit (Zymo Research) and generated cDNA using SuperScript III (Thermo Fisher Scientific). For RT-qPCR, we used iTaq Syber Green (BioRad). We measured expression levels of gfzfmel and gfzfsib using the following primers: gfzf F (both species): CCGGACATGGACCTCTCAAA, gfzfmel R: GGGACACGGATAATGATGCAG, gfzfsib R: CTTTGGGACACGGATCTGCT. We measured expression levels of Rpl32 as a loading control using the following primers: Rpl32 F: ATGCTAAGCTGTCGCACAAATG, Rpl32 R: GTTCGATCCGTAACCGATGT. To compare expression levels, we first normalized both gfzf samples to the Rpl32 control, and then determined the ratio of gfzfsib to gfzfmel expression. We checked for statistical significance in our samples using a Pairwise Wilcoxon Rank Sum test in R.

Explanation of triple-hybrid crossing scheme

We discovered that gfzfsib knockdown rescues F1 hybrid males in D. melanogaster–D. simulans hybrids but does not rescue F1 hybrid males in D. melanogaster–D. sechellia hybrids. Mapping the loci responsible for D. sechellia aversion to hybrid rescue necessitates the generation of recombinant triple-hybrid males that carry the D. melanogaster X-chromosome, 1 set of unrecombined D. melanogaster autosomes, and 1 set of recombinant D. simulans/D. sechellia autosomes. Individuals that carry D. sechellia alleles at loci that are responsible for aversion to hybrid rescue are expected to be inviable and thus under-represented or entirely missing from this pool of recombinant triple-hybrid males. In contrast, individuals that carry D. simulans alleles at these loci are expected to be viable. By sequencing pools of viable recombinant triple-hybrid males, the causal loci may be detected as those where D. simulans alleles are over-represented and D. sechellia alleles are under-represented.

A straightforward way to generate such triple-hybrid males involves crossing D. melanogaster females to recombinant D. simulans/D. sechellia males. Unfortunately, recombinant D. simulans/D. sechellia males are sterile. This approach to generate triple-hybrid recombinant males is, therefore, not feasible. D. simulans–D. sechellia F1 hybrid females are fertile and can be crossed to D. melanogaster males to generate recombinant triple-hybrid males (Lachaise et al. 1986). These triple-hybrid males, however, are of the incorrect genotype as they carry a D. simulans or D. sechellia X-chromosome (rather than a D. melanogaster X-chromosome, which is required for F1 hybrid male lethality).

To circumvent this problem in generating triple-hybrid males of the correct genotype, we generated D. simulans–D. sechellia F1 hybrid females using a D. simulans attached-X stock. The attached-X D. simulans/D. sechellia F1 hybrid females produce gametes that are recombinant for their autosomes, and carry either the D. simulans attached-X or a D. sechellia Y. When these attached-X D. simulans/D. sechellia F1 hybrid females are crossed to D. melanogaster males, this would generate triple-hybrid males with a D. melanogaster X and a D. sechellia Y and triple-hybrid females with a D. simulans attached-X. However, when D. melanogaster males are crossed with D. simulans clade females, the resulting F1 hybrid females arrest and die as embryos due to a genetic interaction involving the heterochromatic satellite repeat on the X-chromosome from D. melanogaster, Zygotic hybrid rescue (Zhr) and the cytoplasm of D. simulans (Sturtevant 1920; Sturtevant 1921; Sawamura, Yamamoto et al. 1993).

To side-step this roadblock, we recombined our RNAi-gfzfsib transgene onto the Zhr1 chromosome (Sawamura, Yamamoto et al. 1993). Normally, Zhr1 rescues F1 hybrid female embryonic lethality. In our crosses with attached-X chromosomes, we use this mutation to rescue triple-hybrid F1 male embryonic lethality resulting from the interaction between D. melanogaster Zhr and its D. simulans cytoplasm. This crossing scheme thus generates viable triple-hybrid males that carry the D. simulans alleles at loci responsible for D. sechellia aversion to hybrid rescue. The triple-hybrid females are viable regardless of whether they inherit D. sechellia or D. simulans alleles and serve as a powerful control for deviations in allele frequency arising from causes other than from loci contributing to D. sechellia aversion to F1 hybrid male rescue.

Whole fly DNA extraction for pooled genome sequencing

To extract DNA for whole genome sequencing, we used the DNeasy Blood and Tissue kit (Qiagen). We pooled and froze 350 triple-hybrid males and 350 triple-hybrid females each in liquid nitrogen and ground them with a mortar and pestle. Immediately after, the frozen ground tissue was used as the input for the DNeasy kit. We repeated this process for each of the triple-hybrid male and paired triple-hybrid female samples. For the parental lines that we sequenced, we used the same procedure to extract DNA from a pool of 25 males and 25 females.

Pooled whole genome sequencing

To measure allele frequencies in our triple-hybrid samples, we used the Illumina TruSeq DNA PCR-Free Sample Prep to create libraries and the Illumina HiSeq platform to generate paired end reads of each pooled sample. To generate accurate calls of variants in our different lines, we prepped libraries for all 6 of our parental lines using the Illumina TruSeq DNA Nano Library Prep and sequenced each sample using the Illumina NovaSeq platform. Library prep and sequencing were carried out by the Huntsman Cancer Institute High-Throughput Genomics and Bioinformatics Analysis Shared Resource (University of Utah, Salt Lake City).

Sequence alignment and allele frequency analysis

Our code can be found at github.com/jcooper036/tri_hybid_mapping. We trimmed sequencing reads for quality using Trimmomatic (Bolger et al. 2014). We aligned the reads to the D. melanogaster reference genome (r6.24 at the time of analysis) using bwa (Li and Durbin 2009). We called variants and re-aligned reads based on these variant calls using GATK 3.6 (McKenna et al. 2010). To find positions that would allow us to measure allele frequency in the 3 parental species, we wrote our own code to parse vcf files and identify tripartite SNPs. We identified SNPs that were homozygous within each species and fixed between all 3. We compared the tripartite parental SNPs to the triple-hybrid progeny and assigned a species-specific identity to each SNP. We analyzed allele frequencies in 20 kb windows and measured the relative proportions of D. melanogaster, D. simulans, and D. sechellia SNPs from high quality sites. We paired these windows between male and female samples and normalized the allele frequencies by calculating the average difference between males and females for all tripartite SNPs in each window. The plot that we report in Fig. 5 is the average allele frequency for all 3 replicates. Plots for each individual replicate are shown in Supplementary Fig. 1. Plots for each individual female replicate are shown in Supplementary Fig. 2.

Fig. 5.

Fig. 5.

Open in a new tab

D. sechellia aversion to hybrid male rescue by gfzfsib RNAi knockdown is due to 2 large effect loci and dispersed small effect loci across the genome. a) Cross for generating triple-hybrid progeny. This cross generates triple-hybrid males used for mapping D. sechellia aversion to hybrid rescue, and triple-hybrid females serve as a matched control. b) Relative frequencies of D. melanogaster, D. simulans, and D. sechellia alleles in rescued triple-hybrid males. There are 2 large-effect peaks where D. sechellia alleles are highly depleted. The peak on 2R maps to the location of Lhr, a known gene in this hybrid incompatibility. The peak on 3L corresponds to a new hybrid incompatibility locus, which we name Satyr. A slight genome-wide under-representation of D. sechellia alleles indicates that many dispersed small effect changes also contribute to D. sechellia aversion to hybrid rescue. Allele frequencies are shown in 20 kb windows, after normalization by calculating the difference in allele frequencies between triple-hybrid males and triple-hybrid females. This plot displays the average of 3 independent replicates. Plots for each individual replicate can be seen in Supplementary Fig. 1.

Results

Gfzfsib knockdown fails to rescue D. melanogaster–D. sechellia F1 hybrid males

To assay for variation in hybrid male rescue by gfzfsib knockdown across the D. simulans clade, we crossed D. melanogaster females carrying the gfzfsib RNAi knockdown constructs to males from several strains of D. simulans, D. mauritiana, and D. sechellia. We used 2 unique RNAi constructs that specifically target the D. simulans gfzf allele, but not the D. melanogaster allele (Phadnis et al. 2015) (Fig. 2a). We first sequenced the RNAi target sites from all D. simulans strains and found perfect matches for the target sequences in all strains. Similarly, the D. mauritiana strains are perfectly matched for the RNAi target sequences, with the exception of strain w140, which contains a single nucleotide mismatch for both RNAi target sequences. D. sechellia is fixed for a single nucleotide mismatch for the first RNAi target sequence but is perfectly matched for the second RNAi target sequence (Fig. 2a). We observed robust rescue of F1 hybrid males in crosses with D. melanogaster females carrying gfzfsib knockdown constructs with all D. simulans strains (Fig. 2b). We observed even better rescue of F1 hybrid males in analogous crosses with D. mauritiana strains. Surprisingly, we observed no rescue of F1 hybrid males in crosses with any D. sechellia strains with either RNAi construct. The rare males from these crosses are known to be the result of nondisjunction events in D. melanogaster females (Sturtevant 1920; Hutter and Ashburner 1987). Together, these results show that RNAi knockdown of gfzfsib is sufficient to rescue F1 hybrid males in D. melanogaster crosses with D. simulans and D. mauritiana, but not with D. sechellia.

D. sechellia aversion to rescue is not due to differences in RNAi knockdown efficiency

The D. sechellia aversion to F1 hybrid male rescue by gfzf knockdown may be an artifact of a failure to knockdown gfzfsec in D. melanogaster–D. sechellia hybrids. A functional short interfering RNA (siRNA) pathway is necessary for effective RNAi knockdown. siRNA pathway genes such as Dicer-2, Argonaute-2, and R2D2 are among the most diverged genes between D. melanogaster and the D. simulans clade species (Obbard et al. 2006; Palmer et al. 2018). If the siRNA pathway is ineffective in D. melanogaster–D. sechellia hybrids due to its divergence, this could explain the failure to rescue D. melanogaster–D. sechellia hybrid males using gfzfsib knockdown.

To test for functional variation of RNAi efficiency in hybrids between D. melanogaster and its sister species, we first tested the efficacy of RNAi in hybrids using a knockdown construct that targets the white gene (Lee et al. 2004). A complete knockdown of the white gene changes eye color from red to white, and an incomplete knockdown manifests as an intermediate eye color. To quantitatively measure the efficacy of RNAi in all the 3 inter-species hybrids, we measured the reduction in eye pigment intensity from white knockdown in D. melanogaster hybrids with D. simulans, D. mauritiana, and D. sechellia and compared them to pure D. melanogaster. Although the pigment intensity was slightly greater in all hybrids than in pure D. melanogaster, the reduction in eye pigmentation was not significantly different between the 3 inter-species hybrids (Fig. 3). This result indicates that the siRNA pathway is functional in all 3 inter-species hybrids despite the rapid divergence of its components.

Fig. 3.

Fig. 3.

Open in a new tab

The RNA interference pathway is functional in D. melanogaster–D. simulans clade hybrids. a) The top row shows eyes from wild-type D. melanogaster, D. melanogaster white knockout, and RNAi knockdown of white in pure species D. melanogaster. The bottom row shows eyes from RNAi knockdown of the D. melanogaster white allele in all 3 D. simulans clade hybrids. b) Quantification of eye color intensity in control and hybrid genotypes shown in Fig. 3a. Lettered bars indicate categories that were significantly different from each other (P < 0.05 by Pairwise Wilcoxon Rank Sum test; n = 6). Pigment intensity is significantly reduced by RNAi knockdown in all 3 hybridizations, and no hybrid eye color intensity was significantly different from any other.

To directly compare gfzfsib RNAi knockdown efficiency in all inter-species hybrids, we measured the allele specific expression levels of gfzf by RT-qPCR using primers that amplify only gfzfmel or gfzfsib in hybrid females. We found that the gfzfsib expression is reduced to comparable levels in all 3 inter-species hybrids (Fig. 4). This confirms that D. melanogaster–D. sechellia hybrids are averse to hybrid rescue using gfzfsib knockdown.

Fig. 4.

Fig. 4.

Open in a new tab

Gfzfsib RNAi shows comparable reduction in the expression of the gfzfsib allele in hybrids from all 3 D. simulans clade species. gfzfsib expression is reduced by RNAi knockdown in F1 hybrid males from all 3 D. simulans clade species, and there is no significant difference in the magnitude of the reduction in expression between hybridizations (P < 0.05 by Pairwise Wilcoxon Rank Sum test). The gfzfsib RNAi-2 construct does not target gfzfmel. Expression levels of gfzf were normalized to Rpl32 expression level, and expression level of gfzfsib is presented as the ratio of gfzfsib to gfzfmel.

The genetic basis of D. sechellia aversion to F1 hybrid male rescue

Our finding that gfzfsib RNAi knockdown fails to rescue D. melanogaster–D. sechellia F1 hybrid males implies that the genetic basis of F1 hybrid male inviability is not identical in all 3 inter-species crosses. The D. sechellia aversion to hybrid rescue is consistent with a broader pattern of D. melanogaster–D. sechellia F1 hybrid males being generally worse off and harder to rescue with D. melanogaster Hmr relative to the other 2 inter-species hybridizations (Hutter and Ashburner 1987; Barbash et al. 2000; Barbash and Ashburner 2003; Matute et al. 2014). In addition, D. sechellia is an outlier in the D. simulans clade of species in many regards, including phenotypic (e.g. ovariole and larval trichome number differences), life history traits (specialized metabolic and behavioral adaptation to the toxic Morinda fruit), etc. (Tsacas and Baechli 1981; Louis 1986; Lachaise et al. 1988; Coyne et al. 1991; Sucena and Stern 2000; Jones 2005; Orgogozo et al. 2006). D. sechellia also has a smaller effective population size and has accumulated more deleterious mutations across its genome as compared to D. mauritiana and D. simulans (Kliman et al. 2000; Garrigan et al. 2012).

Traditional recombination mapping approaches to uncover the genetic basis of D. sechellia aversion to F1 hybrid male rescue would require crosses between recombinant D. simulans–D. sechellia hybrid males and D. melanogaster females. Unfortunately, the sterility of D. simulans–D. sechellia hybrid males frustrate such approaches (Lachaise et al. 1986). To circumvent this problem, we devised a method that uses the fertility of D. simulans–D. sechellia hybrid females through a triple-hybrid mapping design (Fig. 5a). This approach allowed us to generate large numbers of triple-hybrid recombinant rescue males, which carry 1 full autosomal complement and X-chromosome from D. melanogaster, and 1 D. simulans–D. sechellia recombinant autosomal complement (Fig. 5a). Triple-hybrid males that inherit D. sechellia alleles underlying aversion to hybrid rescue are inviable. In contrast, only triple-hybrid males that inherit the alternative D. simulans alleles that allow hybrid rescue are viable. In adult pools of rescued triple-hybrid males, D. sechellia and D. simulans alleles should be present in equal proportions across the genome, except at loci that underlie aversion to hybrid male rescue. At loci underlying D. sechellia aversion to hybrid male rescue, D. sechellia alleles are expected to be under-represented relative to D. simulans alleles and can be detected through deep sequencing of pooled rescued triple-hybrid males.

If many small effect incompatibility loci distributed across the D. sechellia genome underlie its aversion to hybrid male rescue, then pooled sequencing of our triple-hybrid males should show a slight under-representation of D. sechellia alleles relative to D. simulans alleles across the genome. We generated 3 independent replicate pools of rescued triple-hybrid males and sequenced them. Our triple-hybrid design also generated matching triple-hybrid females for each replicate. Because these triple-hybrid females are viable regardless of whether they inherit D. sechellia or D. simulans alleles, they provide a powerful control for allele frequency deviations due to sources other than differences in hybrid male viability (e.g. potential female meiotic drive in D. simulans–D. sechellia hybrid females).

In our rescued triple-hybrid males, we observed a slight under-representation of D. sechellia alleles relative to D. simulans alleles across the genome. This is consistent with the idea that many small effect incompatibility loci distributed across the D. sechellia genome contribute to its aversion to hybrid male rescue. Surprisingly, there are 2 distinct regions in the genome that display massive under-representation of D. sechellia alleles relative to D. simulans, showing that 2 major effect loci underlie D. sechellia aversion to hybrid rescue. The first peak of enrichment is at 17.41 Mb on chromosome 2R (D. melanogaster coordinates), which is near the genomic location of Lhr (17.43 Mb), a known hybrid incompatibility gene in this system. At this peak, all viable triple-hybrid males carried D. simulans alleles and none from D. sechellia. The second peak is at 8.64 Mb on chromosome 3L, where no genes have previously been implicated in the D. melanogaster/D. simulans hybrid incompatibility. At this peak, ∼75% of all viable triple-hybrid males carried D. simulans alleles and only ∼25% carried D. sechellia alleles. This peak thus corresponds to a novel hybrid incompatibility locus, which we name Sechellia aversion to hybrid rescue (Satyr). Together, our results show that both distributed small effect changes along with 2 large effect changes in D. sechellia explain D. sechellia aversion to F1 hybrid male rescue by gfzfsib knockdown.

Discussion

While Sturtevant's discovery of D. simulans as the sister species to D. melanogaster opened the door to genetic analyses of hybrid incompatibilities, the later discoveries of D. mauritiana and D. sechellia provided “biological triplicates” for the study of this hybridization (Sturtevant 1919; David 1974; Tsacas and Baechli 1981). Nearly all genetic analyses of F1 hybrid male inviability in D. melanogaster crosses with the D. simulans clade species have focused only on the D. melanogaster–D. simulans hybridization. However, it has long been known that D. melanogaster–D. sechellia F1 hybrid males fare the worst among all 3 inter-species hybrids. For example, D. melanogaster–D. sechellia F1 hybrid males are harder to rescue with D. melanogaster Hmr (Hutter and Ashburner 1987; Barbash et al. 2000). D. melanogaster–D. mauritiana F1 hybrid males are easiest to rescue with D. melanogaster Hmr, D. melanogaster–D. simulans hybrids are intermediate (D. melanogaster–D. mauritiana > D. melanogaster–D. simulans > D. melanogaster–D. sechellia). Our finding that D. sechellia F1 hybrid males are completely averse to rescue by gfzfsib knockdown is a more extreme version of this broader pattern.

An important but unsettled debate in evolutionary genetics concerns the relative contribution of many small effect changes vs a few major effect changes to intrinsic barriers to gene flow (Wu and Beckenbach 1983; Coyne 1984; True et al. 1996; Wu et al. 1996; Tao, Chen et al. 2003, Tao, Zeng et al. 2003; Slotman et al. 2004). The challenges in detecting small effect changes are a well-known source of systematic bias in addressing this fundamental question. We expected to uncover many small effect incompatibility loci spread across the genome as the genetic basis of D. sechellia aversion to F1 hybrid male rescue. We indeed observed a genome-wide under-representation of D. sechellia alleles consistent with this expectation. More strikingly, our results also uncovered 2 major effect loci in the D. sechellia genome that largely account for the aversion to F1 hybrid male rescue. Our results reveal that a combination of both types of changes—many dispersed small effect and few large effect changes—underlie D. sechellia aversion to hybrid rescue.

Of the 2 major effect loci uncovered, the peak on chromosome arm 2R overlaps with the location of Lhr. While this peak of enrichment likely corresponds to Lhr, our current mapping resolution does not allow a confident assignment. If this peak corresponds to Lhr, then both D. simulans and D. sechellia alleles of Lhr are incompatible but the D. sechellia allele of Lhr causes a more penetrant version of the same hybrid incompatibility. This would imply that further changes at Lhr in the D. sechellia lineage after the initial formation of the hybrid incompatibility underlie aversion to F1 hybrid male rescue. Alternatively, less penetrant alleles of Lhr may have evolved later in D. simulans and D. mauritiana. Although this scenario may appear less parsimonious, it cannot be ruled out because D. mauritiana and D. simulans are known to share alleles through both incomplete lineage sorting and introgression (Garrigan et al. 2012; Schrider et al. 2018). The second large effect locus, Satyr, may correspond to an undiscovered gene, or closely linked genes, in the Hmr-Lhr-gfzf hybrid incompatibility, and may even be necessary for F1 hybrid male inviability in all 3 hybridizations. Indeed, a previous genetic screen to systematically identify D. simulans hybrid incompatibility genes in this hybrid lethal interaction was not carried to saturation, leaving open the possibility of the involvement of other undiscovered genes (Phadnis et al. 2015). Alternatively, D. sechellia specific modifiers, rather than more penetrant alleles of the same genes, may underlie D. sechellia aversion to F1 hybrid male rescue. The future identification of the causal genes at each of these loci will discriminate between these contrasting explanations for the observed inter-species differences in F1 hybrid male rescue.

Our study provides a proof of principle for a triple-hybrid approach to further uncover the genetic basis of inter-species differences in hybrid incompatibilities. First, by sequencing individual rescued males rather than pooled sequencing, fine mapping to identify the causal genes underlying D. sechellia aversion to rescue is possible. Second, by substituting D. sechellia with D. mauritiana in these crosses, it is possible to uncover the genetic basis of D. mauritiana known ease in hybrid male rescue (Hutter and Ashburner 1987). Third, other methods of hybrid rescue such as those with Hmr or Lhr can be substituted for gfzf rescue to investigate the congruence of this hybrid incompatibility network. Fourth, a similar design may allow the mapping and identification of the elusive Maternal hybrid recue (Mhr) locus responsible for inter-species variation in F1 hybrid female viability in crosses between D. melanogaster males and D. simulans clade females (Sawamura, Taira et al. 1993; Gérard and Presgraves 2012). Our triple-hybrid approach thus provides a versatile method to study the genetic basis of inter-species variation in hybrid phenotypes.

Our study looks past the initial formation of hybrid incompatibilities and provides a rare window into the consequences of their continued evolution. Our results raise questions about whether new hybrid incompatibility genes can integrate into an existing hybrid incompatibility thus increasing in complexity over time, or if the continued evolution of genes can gradually strengthen an existing hybrid incompatibility.

Supplementary Material

iyae001_Supplementary_Data
iyae001_supplementary_data.docx (964.9KB, docx)

Acknowledgments

We thank the labs of H. S. Malik and D. Matute for sharing their fly lines with us. We thank J. Welker for her continued support. Research reported in this publication utilized the High-Throughput Genomics and Bioinformatic Analysis Shared Resource at Huntsman Cancer Institute at the University of Utah and was supported by the National Cancer Institute of the National Institutes of Health under Award Number P30CA042014. The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH.

Contributor Information

Jackson Bladen, School of Biological Sciences, University of Utah, Salt Lake City, UT 84112, USA.

Jacob C Cooper, School of Biological Sciences, University of Utah, Salt Lake City, UT 84112, USA.

Jackson T Ridges, School of Biological Sciences, University of Utah, Salt Lake City, UT 84112, USA.

Ping Guo, School of Biological Sciences, University of Utah, Salt Lake City, UT 84112, USA.

Nitin Phadnis, School of Biological Sciences, University of Utah, Salt Lake City, UT 84112, USA.

Data availability

All of the genomic sequencing data for this project is available on the Sequence Read Archive accession number SRP190327. It can also be accessed via the BioProject accession number PRJNA530263.

Supplemental material available at GENETICS online.

Funding

This work was supported by the National Institute of Health grant R01 GM141422.

Literature cited

  1. Barbash  DA. 2010. Ninety years of Drosophila melanogaster hybrids. Genetics. 186(1):1–8. doi: 10.1534/genetics.110.121459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Barbash  DA, Ashburner  M. 2003. A novel system of fertility rescue in Drosophila hybrids reveals a link between hybrid lethality and female sterility. Genetics. 163(1):217–226. doi: 10.1093/genetics/163.1.217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barbash  DA, Roote  J, Ashburner  M. 2000. The Drosophila melanogaster hybrid male rescue gene causes inviability in male and female species hybrids. Genetics. 154(4):1747–1771. doi: 10.1093/genetics/154.4.1747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bolger  AM, Lohse  M, Usadel  B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 30(15):2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brideau  NJ, Flores  HA, Wang  J, Maheshwari  S, Wang  X, Barbash  DA. 2006. Two Dobzhansky–Muller genes interact to cause hybrid lethality in Drosophila. Science. 314(5803):1292–1295. doi: 10.1126/science.1133953. [DOI] [PubMed] [Google Scholar]
  6. Coyne  JA. 1984. Genetic basis of male sterility in hybrids between two closely related species of Drosophila. Proc Natl Acad Sci U S A.  81(14):4444–4447. doi: 10.1073/pnas.81.14.4444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Coyne  JA, Rux  J, David  JR. 1991. Genetics of morphological differences and hybrid sterility between Drosophila sechellia and its relatives. Genet Res (Camb).  57(2):113–122. doi: 10.1017/S0016672300029177. [DOI] [PubMed] [Google Scholar]
  8. David  J. 1974. Hybridation d'une nouvelle espece, Drosophila mauritiana avec D. melanogaster et D. simulans. Ann Genet.  17:235–241. [PubMed] [Google Scholar]
  9. Ferree  PM, Barbash  DA. 2009. Species-specific heterochromatin prevents mitotic chromosome segregation to cause hybrid lethality in Drosophila. PLoS Biol.  7(10):e1000234. doi: 10.1371/journal.pbio.1000234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Garrigan  D, Kingan  SB, Geneva  AJ, Andolfatto  P, Clark  AG, Thornton  KR, Presgraves  DC. 2012. Genome sequencing reveals complex speciation in the Drosophila simulans clade. Genome Res. 22(8):1499–1511. doi: 10.1101/gr.130922.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gérard  PR, Presgraves  DC. 2012. Abundant genetic variability in Drosophila simulans for hybrid female lethality in interspecific crosses to Drosophila melanogaster. Genet Res (Camb).  94(1):1–7. doi: 10.1017/S0016672312000031. [DOI] [PubMed] [Google Scholar]
  12. Hutter  P, Ashburner  M. 1987. Genetic rescue of inviable hybrids between Drosophila melanogaster and its sibling species. Nature. 327(6120):331–333. doi: 10.1038/327331a0. [DOI] [PubMed] [Google Scholar]
  13. Hutter  P, Roote  J, Ashburner  M. 1990. A genetic basis for the inviability of hybrids between sibling species of Drosophila. Genetics. 124(4):909–920. doi: 10.1093/genetics/124.4.909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jones  CD. 2005. The genetics of adaptation in Drosophila sechellia. Genetica. 123(1–2):137–145. doi: 10.1007/s10709-004-2728-6. [DOI] [PubMed] [Google Scholar]
  15. Kliman  RM, Andolfatto  P, Coyne  JA, Depaulis  F, Kreitman  M, Berry  AJ, McCarter  J, Wakeley  J, Hey  J. 2000. The population genetics of the origin and divergence of the Drosophila simulans complex species. Genetics. 156(4):1913–1931. doi: 10.1093/genetics/156.4.1913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lachaise  D, Cariou  M-L, David  JR, Lemeunier  F, Tsacas  L, Ashburner  M. 1988. Historical biogeography of the Drosophila melanogaster species subgroup. In: Hecht  MK, Wallace  B, Prance  GT, editors. Evolutionary Biology. Boston, MA: Springer US. p. 159–225. [Google Scholar]
  17. Lachaise  D, David  JR, Lemeunier  F, Tsacas  L, Ashburner  M. 1986. The reproductive relationships of Drosophila sechellia with D. mauritiana, D. simulans, and D. melanogaster from the afrotropical region. Evolution. 40:262–271. doi: 10.1111/j.1558-5646.1986.tb00468.x. [DOI] [PubMed] [Google Scholar]
  18. Lee  YS, Nakahara  K, Pham  JW, Kim  K, He  Z, Sontheimer  EJ, Carthew  RW. 2004. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell. 117(1):69–81. doi : 10.1016/S0092-8674(04)00261-2. [DOI] [PubMed] [Google Scholar]
  19. Li  H, Durbin  R. 2009. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics. 25(14):1754–1760. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Louis  J. 1986. Ecological specialization in the Drosophila melanogaster species subgroup: a case study of D. sechellia. Ecol Genet. 7:215–229. [Google Scholar]
  21. Matute  DR, Gavin-Smyth  J, Liu  G. 2014. Variable post-zygotic isolation in Drosophila melanogaster/D. simulans hybrids. J Evol Biol. 27(8):1691–1705. doi: 10.1111/jeb.12422. [DOI] [PubMed] [Google Scholar]
  22. McDermott  SR, Kliman  RM. 2008. Estimation of isolation times of the island species in the Drosophila simulans complex from multilocus DNA sequence data. PLoS One. 3(6):e2442. doi: 10.1371/journal.pone.0002442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. McKenna  A, Hanna  M, Banks  E, Sivachenko  A, Cibulskis  K, Kernytsky  A, Garimella  K, Altshuler  D, Gabriel  S, Daly  M, et al.  2010. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 20(9):1297–1303. doi: 10.1101/gr.107524.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Obbard  DJ, Jiggins  FM, Halligan  DL, Little  TJ. 2006. Natural selection drives extremely rapid evolution in antiviral RNAi genes. Curr Biol.  16(6):580–585. doi: 10.1016/j.cub.2006.01.065. [DOI] [PubMed] [Google Scholar]
  25. Orgogozo  V, Broman  KW, Stern  DL. 2006. High-resolution quantitative trait locus mapping reveals sign epistasis controlling ovariole number between two Drosophila species. Genetics. 173(1):197–205. doi: 10.1534/genetics.105.054098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Palmer  WH, Hadfield  JD, Obbard  DJ. 2018. RNA-interference pathways display high rates of adaptive protein evolution in multiple invertebrates. Genetics. 208(4):1585–1599. doi: 10.1534/genetics.117.300567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Phadnis  N, Baker  EP, Cooper  JC, Frizzell  KA, Hsieh  E, de la Cruz  AA, Shendure  J, Kitzman  JO, Malik  HS. 2015. An essential cell cycle regulation gene causes hybrid inviability in Drosophila. Science. 350(6267):1552–1555. doi: 10.1126/science.aac7504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Pontecorvo  G. 1943. Viability interactions between chromosomes of Drosophila melanogaster and Drosophila simulans. J Genet.  45(1):51–66. doi: 10.1007/BF02982774. [DOI] [Google Scholar]
  29. Provine  WB. 1991. Alfred Henry Sturtevant and crosses between Drosophila melanogaster and Drosophila simulans. Genetics. 129(1):1–5. doi: 10.1093/genetics/129.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sánchez  L, Dübendorfer  A. 1983. Development of imaginal discs from lethal hybrids between Drosophila melanogaster and Drosophila mauritiana. Wilehm Roux Arch Dev Biol. 192(1):48–50. doi: 10.1007/BF00848770. [DOI] [PubMed] [Google Scholar]
  31. Sanchez  L, Granadino  B, Vicente  L. 1994. Clonal analysis in hybrids between Drosophila melanogaster and Drosophila simulans. Roux Arch Dev Biol. 204(2):112–117. doi: 10.1007/BF00361105. [DOI] [PubMed] [Google Scholar]
  32. Sawamura  K, Taira  T, Watanabe  TK. 1993. Hybrid lethal systems in the Drosophila melanogaster species complex. I. The maternal hybrid rescue (mhr) gene of Drosophila simulans. Genetics. 133:299–305. doi: 10.1093/genetics/133.2.299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sawamura  K, Yamamoto  MT, Watanabe  TK. 1993. Hybrid lethal systems in the Drosophila melanogaster species complex. II. The Zygotic hybrid rescue (Zhr) gene of D. melanogaster. Genetics. 133(2):307–313. doi: 10.1093/genetics/133.2.307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Schrider  DR, Ayroles  J, Matute  DR, Kern  AD. 2018. Supervised machine learning reveals introgressed loci in the genomes of Drosophila simulans and D. sechellia. PLoS Genet. 14(4):e1007341. doi: 10.1371/journal.pgen.1007341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Slotman  M, Della Torre  A, Powell  JR. 2004. The genetics of inviability and male sterility in hybrids between Anopheles gambiae and An. arabiensis. Genetics. 167(1):275–287. doi: 10.1534/genetics.167.1.275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sturtevant  AH. 1919. A new species closely resembling Drosophila melanogaster. Psyche (Stuttg).  26(6):153–155. doi: 10.1155/1919/97402. [DOI] [Google Scholar]
  37. Sturtevant  AH. 1920. Genetic studies on Drosophila simulans. I. Introduction. Hybrids with Drosophila melanogaster. Genetics. 5(5):488–500. doi: 10.1093/genetics/5.5.488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sturtevant  AH. 1921. Genetic studies on Drosophila simulans. III. Autosomal genes. General discussion. Genetics. 6(2):179–207. doi: 10.1093/genetics/6.2.179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sucena  É, Stern  DL. 2000. Divergence of larval morphology between Drosophila sechellia and its sibling species caused by cis-regulatory evolution of ovo/shaven-baby. Proc Natl Acad Sci U S A. 97(9):4530–4534. doi: 10.1073/pnas.97.9.4530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Suvorov  A, Kim  BY, Wang  J, Armstrong  EE, Peede  D, D’Agostino  ERR, Price  DK, Waddell  PJ, Lang  M, Courtier-Orgogozo  V, et al.  2022. Widespread introgression across a phylogeny of 155 Drosophila genomes. Curr Biol. 32(1):111–123.e5. doi: 10.1016/j.cub.2021.10.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tao  Y, Chen  S, Hartl  DL, Laurie  CC. 2003. Genetic dissection of hybrid incompatibilities between Drosophila simulans and D. mauritiana. I. Differential accumulation of hybrid male sterility effects on the X and autosomes. Genetics. 164(4):1383–1397. doi: 10.1093/genetics/164.4.1383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tao  Y, Zeng  ZB, Li  J, Hartl  DL, Laurie  CC. 2003. Genetic dissection of hybrid incompatibilities between Drosophila simulans and D. mauritiana. II. Mapping hybrid male sterility loci on the third chromosome. Genetics. 164(4):1399–1418. doi: 10.1093/genetics/164.4.1399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. True  JR, Weir  BS, Laurie  CC. 1996. A genome-wide survey of hybrid incompatibility factors by the introgression of marked segments of Drosophila mauritiana chromosomes into Drosophila simulans. Genetics. 142(3):819–837. doi: 10.1093/genetics/142.3.819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Tsacas  L, Baechli  G. 1981. Drosophila sechellia, n. sp., huitieme espece du sous-groupe melanogaster des iles Sechelles (Diptera, Drosophilidae). Rev Francaise Entomol. 3:146–150. [Google Scholar]
  45. Watanabe  TK. 1979. A gene that rescues the lethal hybrids between Drosophila melanogaster and D. simulans. Jpn J Genet. 54(5):325–331. doi: 10.1266/jjg.54.325. [DOI] [Google Scholar]
  46. Wu  C-I, Johnson  NA, Palopoli  MF. 1996. Haldane’s rule and its legacy: why are there so many sterile males?  Trends Ecol Evol (Amst).  11(7):281–284. doi: 10.1016/0169-5347(96)10033-1. [DOI] [PubMed] [Google Scholar]
  47. Wu  CI, Beckenbach  AT. 1983. Evidence for extensive genetic differentiation between the sex-ratio and the standard arrangement of Drosophila pseudoobscura and D. persimilis and identification of hybrid sterility factors. Genetics. 105(1):71–86. doi: 10.1093/genetics/105.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

iyae001_Supplementary_Data
iyae001_supplementary_data.docx (964.9KB, docx)

Data Availability Statement

All of the genomic sequencing data for this project is available on the Sequence Read Archive accession number SRP190327. It can also be accessed via the BioProject accession number PRJNA530263.

Supplemental material available at GENETICS online.

Articles from Genetics are provided here courtesy of Oxford University Press

RESOURCES