Abstract
Osteoporosis is a common metabolic old age disorder characterised by low bone mass content (BMC) and mineral density (BMD) with micro-architectural deterioration of the extracellular matrix, further increasing bone fragility risk. Several traditional remedies, including plant extracts and herbal formulations, are used worldwide by local healers to improve the overall bone health and metabolism as an excellent osteoregenerative agent. Pteropsermum rubiginosum is an underexplored medicinal plant used by tribal peoples of Western Ghats, India, to treat bone fractures and associated inflammation. The proposed study evaluates the elemental profiling and phytochemical characterisation of P. rubiginosum methanolic bark extract (PRME), along with detailed In vitro and In vivo biological investigation in MG-63 cells and Sprague–Dawley (SD) rats. AAS and ICP–MS analysis showed the presence of calcium, phosphorus, and magnesium and exceptional levels of strontium, chromium, and zinc in PRME. The NMR characterisation revealed the presence of vanillic acid, Ergost-4-ene-3-one and catechin. The molecular docking studies revealed the target pockets of isolated compounds and various marker proteins in the bone remodelling cycle. In vitro studies showed a significant hike in ALP and calcium content, along with upregulated mRNA expression of the ALP and COL1, which confirmed the osteoinductive activity of PRME in human osteoblast-like MG-63 cells. The in vivo evaluation in ovariectomised (OVX) rats showed remarkable recovery in ALP, collagen and osteocalcin protein after 3 months of PRME treatment. DEXA scanning reports in OVX rats supported the above in vitro and in vivo results, significantly enhancing the BMD and BMC. The results suggest that PRME can induce osteogenic activity and enhance bone formation with an excellent osteoprotective effect against bone loss in OVX animals due to estrogen deficiency.
Supplementary Information
The online version contains supplementary material available at 10.1007/s13205-024-03942-7.
Keywords: Bone diseases, Bone mineral density, Osteocalcin, Osteoporosis, Pteropsermum rubiginosum, Trace elements
Introduction
Bone is a metabolically active tissue comprising approximately 35% proteins and 65% mineral matrix, possessing a unique regeneration ability. Bone regeneration is a dynamically controlled cyclic process aided by depositing several proteins, growth factors, enzymes, and trace minerals on the matrix of newly formed bone cells; this renewal process will continue throughout healthy adulthood. Bone metabolism involves a homeostatic balance between bone resorption and the formation process; it is well maintained by osteoclasts and osteoblasts, respectively, along with connective tissue and extracellular matrix (Bates et al. 2018). Along with potassium, manganese, magnesium, calcium, and phosphorus mineral salts in the osteoid matrix and the enzyme phosphatases present in osteoblast release phosphate ions to form a crystalline framework of calcium hydroxyapatite [Ca10 (PO4)6 (OH)2], which provides strength and rigidity to bones (Gomes et al. 2019). The human body requires metallic and non-metallic elements as co-factors within a permissible limit to grow and function hormones and enzymes properly. The trace minerals essential for proper bone health include silicon, strontium, vanadium, chromium, phosphorus, boron, zinc, copper, magnesium, and fluorine; very rarely (nickel and selenium) also regulate bone metabolism (Gaffney-Stomberg 2019).
Primary healthcare practitioners, including traditional healers, have used different types of natural products including medicinal plants as novel combinations or as fresh herbal extracts to treat various ailments. The efficacy of these formulations might be due to the synergetic action of diverse phytochemicals and trace elements. Every part of the medicinal plant varies in elemental composition and biological efficiency due to the structural and functional properties of phytocompounds present in them (Gomes et al. 2019; Crockett et al. 2011). Since both curative and toxic properties of plant extracts depend on the level of trace elements, the quantitative estimation of these elements is a crucial step for determining the effectiveness of medicinal formulations in therapeutic applications. The plants (primary producers) absorb all the mineral elements from the soil and pass them to next-level consumers, including humans. Bioaccumulation of any toxic minerals causes severe health problems, including hepato-renal toxicity and cellular damage (Ali et al. 2019).
The elemental analysis of medicinal plants is essential for understanding their nutritive importance, which also helps scientists to optimise the herbal drug dosage with accurate elemental concentration (Abugassa 2008). To understand the interactive mechanism of these phytochemicals, it is necessary first to acquire knowledge of their molecular and elemental composition. Molecular docking is a fast and inexpensive tool in structural chemistry, molecular biology, and computer-assisted drug discovery with excellent pharmaceutical applications (Meng et al. 2011). The computer-aided modelling technique predicts a ligand's predominant binding mode(s) (phytochemical or drug moiety) with a protein of known three-dimensional structure. The ligand–protein interaction helps to reveal the nature of chemical bonding and stability (Stanzione et al. 2021). The docking studies, combined with other computational approaches and wet lab experiments, provide an excellent scientific base for appreciating these plants' therapeutic potential.
Pterospermum is a combination of two Greek words, "Pteron" and "Sperma," meaning "winged seed". Pterospermum rubiginosum B. Heyne, belonging to the Malvaceae family, is an indigenous tree with high therapeutic values found in the least polluted environments of Western Ghats, India. The P. rubiginosum (locally "Ellotti, Edinjal) in Malayalam and its bark is used by local Kani tribal healers as "Ellooripatta" is commonly used by tribal healers of Western Ghats for treating bone fractures and relieving associated pain and inflammation by applying bark paste at the fracture site along with the consumption of bark boiled extract (Anish et al. 2021a; Vijayan et al. 2007). It is an evergreen tropical, medicinal tree having a height of 25–28 m with a pink hard and close-grained flaky wood having a bark thickness of 5–6 mm with brown exfoliating outer red bark, found up to an altitude of 2500–3000ft at evergreen forests endemic to India especially Karnataka and Kerala regions of the Western Ghats. Flowering and fruiting mainly occurs during the period from November to July (Anish et al. 2021a; Nayar et al., 2006).
Based on the experiences and traditional knowledge of Kani healers, the current study was proposed to determine the elemental composition and phytochemical characterisation of the bark extract of P. rubiginosum. The study's objective also includes molecular docking analysis and the osteogenic evaluation of PRME on MG 63 osteoblast-like cell lines in in vitro and SD rats in in vivo study, respectively.
Materials and methods
Plant collection and sample preparation
The p. rubiginosum (Malvaceae) bark was collected from the Kottur forest range, Thiruvananthapuram district of Kerala (Western Ghats) with the help of tribal people, during the month of January. The plant specimen was authenticated by the curator (Dr. Valsaladevi), and the voucher specimen was kept in the herbarium of the Department of Botany, University of Kerala, Thiruvananthapuram, India, with a specimen number KUBH 6189. After removing the mature outer bark, the inner fresh bark of P. rubiginosum was collected and shade-dried for 3–4 weeks. About 1.2 kg of the bark was powdered using a mixer grinder. The powder was extracted with alcohol (3 × 3 L) at RT. After extraction, the extract was sieved and concentrated under reduced pressure to yield a bark crude extract (78 g). Column chromatography used 100–200 and 230–400 mesh size silica gel (Merck, Darmstadt, Germany). For thin-layer chromatography (TLC.), Merck pre-coated silica gel F254 plates were used. Spots were detected on TLC under UV light. The crude extract was packed on silica gel of mesh size (100–200), and column chromatography was performed by using different solvents based on polarity (n-hexane, n-hexane–ethyl acetate-acetone-methanol gradients), various fractions were collected, pooled and subjected to further structural characterisation.
Structural characterisation study
NMR spectroscopy is primarily related to the magnetic properties of atomic nuclei, such as the hydrogen atom (proton) and anisotope of carbon. NMR spectroscopy provides a perfect indication of the related positions of these nuclei in the molecule and atoms in neighbouring groups, which further leads to structural elucidation of molecules. The 1H (500 MHz) and 13C (125 MHz) NMR spectra were recorded from Bruker AMX500 MHz, using acetone-d6 as the solvent and the chemical shifts are expressed in δ (ppm) using tetramethylsilane as standard. The high-resolution electrospray ionisation mass spectrometry (HRESIMS) data were obtained from Thermo Scientific'sexactive mass spectrometer.
Elemental analysis
CHNS/O Analyzer (Perkin Elmer, series II 2400, USA) was used to analyse the concentration of organic molecules in PRME. The analyser is fully automated and includes a 60-position auto sampler. The EA Data Manager software adds powerful capabilities that assist in streamlining data collection and analyses.
Atomic absorption spectroscopy
Analyst AA-200(Perkin Elmer, U.S.A.) was utilised in this study to determine the elemental concentration in PRME (Bulska and Ruszczyńska 2017). For the macro-elemental analysis, (2 ppm, 4 ppm and 6 ppm) standards, for microelements, (1 ppm, 2 ppm and 3 ppm) were commonly used. The sample analysis is performed in manual or automated mode; the high-efficiency solid-state detector identifies the samples' peaks and can be displayed on the screen. The calibration curve is used to predict the unknown analyte concentration based on the correlation coefficient of the known standards.
Trace element analysis by ICP-MS
The inductively coupled plasma mass spectrometry (ICP-MS) is an analytical technique used to quantify trace elements at ppm levels in plant samples (Bulska and Ruszczyńska 2017); the external calibration solutions were prepared from standard certified multielement solution (MERCK). The ion optics were tuned using a Thermo scientific Tune-B ICAP-Q solution. Reagents used for the ICP-MS analysis were suprapur grade (Merck, U.S.A.) and high purity water (Thermo Scientific, Barnstead, Smart 2 pure) for dilution and sample preparation. For microwave digestion (Anton Paar, Multiwave 3000), 0.1 g of the sample was mixed with nitric acid (7 ml and hydrogen peroxide (1 ml). The digested samples were used for analysis.
Molecular docking analysis
The molecular interaction study between the selected targets and ligands was conducted using Biovia Discovery Studio v.20. Initially, the proteins' binding sites were predicted using the 'define and edit binding site' option in the software based on the PDB site records. For the molecular interaction study, the LibDock protocol (Diller and Merz 2001) linked with high-throughput docking algorithm was used to find various ligand conformations in the protein active site based on polar interaction sites (hotspots). CHARMM was the force field that uses positional relationships between atoms to determine the energy and forces acting on each particle of the system. The binding pose with the lowest docked energy and excellent docking score was selected for further analysis. The molecule alendronic acid (2088) was used as the standard ligand for the docking studies.
Cell lines
MG63 (Human Osteosarcoma) cells were initially procured from the National Centre for Cell Sciences, Pune, India and maintained Dulbecco's modified Eagles medium, DMEM (Sigma Aldrich, USA). The MG63 cells were cultured and used for experiments at 1:3 passages. Cell lines were cultured in a minimal essential medium boost up with 10% fetal bovine serum, L-glutamine, sodium bicarbonate and an antibiotic mixture solution containing 1% penicillin, streptomycin (100 µg/ml), and amphotericin-B (2.5 µg/ml). The cultured cell lines were maintained in a humidified environment with 5% CO2 at 37 °C. The viability of cells was monitored and evaluated by direct observation of cells by Inverted phase contrast microscopy followed by MTT assay.
Cell viability assay by MTT method
MTT assay is a cytotoxic assay used to evaluate the cellular viability of any plant samples. The cytotoxicity effect of PRME in MG63 cell lines was measured using the 3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay (Sampath et al. 2017).
Measurement of ALP activity and Sirius red staining
ALP activity of PRME was measured by investigating the rate of p-nitrophenyl phosphate (Sigma) hydrolysis. MG-63 cells were seeded at a density (1 × 105 cells/well) in 48-well plates and pre-incubated overnight to allow them to adhere to the plates. The cells were treated with PRME dissolved in DMEM at a concentration of (10 µg/mL); DMEM alone (control), positive control (alendronate). The assay was performed using an ALP kit manufactured by Coral Clinical Systems (India). Sirius red staining for collagen deposition was performed by the method of Kiernan (2011), with slight modifications.
Bone mineralisation analysis and Alizarin red staining
Calcium content was measured by the Asernazo III method, a calcium kit (Coral Clinical Systems, India) (Takagishi et al. 2006). The formation of calcium phosphate by MG63 osteoblast-like cells was determined using the Alizarin red-S assay, the method adapted from Gregory et al.(2004).
Gene expression study of osteogenic markers
MG 63 cell lines were seeded in 6-well plates at a density of 6–7 × 105 cells/dish, and after 24 h, the culture plate was changed with fresh medium and added working concentration of PRME (10 µg/mL), leaving untreated control cells, incubated for 14 days. Gene expression of OCN on the 7th and 14th day of culture was determined through a reverse transcription-polymerase chain reaction (RT-PCR) assay, and GAPDH was used as a housekeeping gene. Total ribonucleic acid (RNA) was extracted from different samples with TRIzol reagent (Invitrogen, USA). The cDNA synthesis was performed using a verso cDNA synthesis kit. The reaction mixture of 50 µL consists of 25 µL of PCR master mix, 2 µL of forward and reverse primer, 5 µL of template DNA and made up to 50 µL with sterile distilled water (nuclease-free). The denaturation step was followed by annealing for 30 s and extension (72 °C for 1 min), repeated for 35 cycles, and the final extension (72 °C for 5 min). After the amplification, the PCR product was separated by agarose gel electrophoresis. Oligonucleotide primer for PCR amplification of ALP-forward (5′-CCGTGGCAACTCTATCTTTGG-3′); reverse (5′-GATGGCAGTGAAGGGCTTCTT-3′); Collagen Type I-forward (5′-AGCGCTGGTTTCGACTTCAGCTTCC-3′); reverse (5'-CATCGGCAGGGTCGGAGCCCT-3') osteocalcin-forward (5' CCCAGGCGCTACCTGTATCAA 3'); reverse (5' GGTCAGCCAACTCGTCACAGTC 3') and GAPDH forward (5'AGGGCTGCTTTTAACTCTGGT3'); reverse (5' CCCCACTTGATTTTGGAGGGA 3'), respectively.
In vivo study
Ethical clearance for the use of animals for the current study was obtained from the Department of Biochemistry, University of Kerala. Animals were treated as per CPCSEA guidelines; the experimental protocol was approved by Institutional animal ethical committee (IAEC-2-KU-01/2018–19-BCH-AAR (13); the experimental study was conducted in agreement with OECD guidelines. All the animal studies were performed with the help of vetenery surgeon, Department of Biochemistry, University of Kerala.
Female Sprague–Dawley (SD) rats weighing 295 ± 45 g were used for this study. The rats were divided into four groups containing six animals each. The groups were as follows: Group I—Sham control (SC), Group II—Ovariectomised rat (OVX), Group III—Osteoporotic + PRME, and Group IV—Osteoporotic + Alendronic acid. In group 1 rats, a single ventral transversal skin incision was made and sutured, except the ovaries were pointed out and then placed back in the lower abdominal cavity. Postmenopausal osteoporosis (PMO) was experimentally induced in groups II to IV SD rats by midventral ovariectomy after confirming the osteoporotic status using a serum marker study and DEXA scan. The groups III and IV animals were orally administered (gastric gavage technique) with PRME (50 mg/kg body weight), alendronic acid (10 mg/kg body weight), with standard rat pellet diet and ad libitum water for 90 days. Every month, blood was collected from the experimental animals from jugular or saphenous veins for serum biochemical study.
Serum mineral study and ELISA analysis
The quantitative determination of calcium in serum, plasma-modified Arsenazo III method (AGAPPE-12011007). At a neutral pH, the Ca2+ form with Arsenazo III a complex, the colour intensity directly proportional to the calcium content in the sample. This reagent is intended for quantitatively determining serum, plasma, and urine phosphorous.—Phosphomolybdate methodology (AGAPPE-12023016). Enzyme immunoassay for the quantitative evaluation of rat osteocalcin (KLR0270), bone alkaline phosphatase (KLR0271), collagen alpha-1(I) chain, (KLR1916) was quantified as per kit manufacturers' instructions (Krishgenbiosystems. Mumbai, India).
DEXA scanning
DEXA is a non-invasive, simple, and quick method used to diagnose osteoporotic bone status and assess an individual's risk for developing osteoporosis. Using DEXA, whole-body imaging within 10 min allows us to assess the total body composition. The experimental rats were anesthetised before the scanning procedure and kept in a midline alignment position in the scanner bed. All the animals were scanned on a GE Healthcare Lunar Prodigy in a routine clinical manner per manufacturer recommendations.
Statistical analysis
The standard deviation, two-way analysis of variance (ANOVA), and IC50 values were calculated. Pearson correlation coefficients and p values < 0.05 were considered significant. Values expressed are means of three replicate determinations ± standard deviation. SPSS version 17 (SPSS, Inc., Chicago, IL, USA) performed a one-way ANOVA. Duncan's post hoc multiple-comparison tests determined significant differences among groups. P < 0.05 was considered to be significant.
Results and discussion
Structural characterisation of PRME.
CHNS/O analysis is an ideal technique for rapidly determining any natural product's carbon, hydrogen, nitrogen, sulphur, and oxygen content. The analysis showed the concentration of carbon (43.21 ± 0.05%), hydrogen (5.48 ± 0.01%), and oxygen (0.56 ± 0.01%) content of PRME (Table 1), which provide novel insights in nomenclature and for the overall characterisation of biomolecules. Thirteen fractions of 300 mL each were collected and concentrated under reduced pressure. Fraction-2 was subjected to column chromatographic (CC) separation using 100–200 mesh-sized silica gel with n-hexane- EtOAc-Metpolarities, isolating compound 1 (5 mg). The fraction pool 3 taken for CC afforded compound 2(12 mg) and compound 3 (16 mg) obtained from fraction pool 5 using hexane–EtOAc-Metpolarity. The pure compounds vanillic acid, ergost-3-one-4ene, and catechin (Fig. 1; S1-S6) are novelly isolated from this medicinal plant using NMR and HRESIM spectroscopy, and to the best of our knowledge, no previous literatures are available on molecules isolated from P. rubiginosum.
Table 1.
Elemental analysis of PRME by AAS and ICP-MS
| AAS | ICP-MS | ||||
|---|---|---|---|---|---|
| Elements | PPM level | Elements | PPM level | Elements | PPM level |
| Calcium | 25,224.95 ± 0.13 | Strontium | 97.42 ± 0.020 | Aluminum | 510.94 ± 0.041 |
| Potassium | 1299.99 ± 0.19 | Chromium | 2.96 ± 0.025 | Iron | 138.97 ± 0.043 |
| Magnesium | 885.54 ± 0.51 | Nickel | 5.13 ± 0.015 | Lead | 0.68 ± 0.01 |
| Sodium | 499.80 ± 0.26 | Zinc | 5.98 ± 0.07 | Lithium | 0.98 ± 0.02 |
| Phosphorus | 351.12 ± 0.14 | Barium | 67.17 ± 0.015 | Cobalt | 0.20 ± 0.005 |
| Manganese | 13.59 ± 0.40 | Selenium | 0.29 ± 0.005 | Beryllium | ND |
| Copper | 9.52 ± 0.05 | Cadmium | 0.98 ± 0.005 | Arsenic | ND |
| Cesium | 0.02 ± 0.005 | Indium | ND | ||
| Titanium | 0.08 ± 0.005 | Silver | ND | ||
Where; ppm parts per million, PRME Pterospermum rubiginosum methanolic bark extract; values are expressed as mean ± standard deviation (n = 3)
Fig. 1.

Pure compounds isolated from PRME. Where, compound 1, 2 and 3 as vanillic acid; ergost-4-ene-3-one and (-) catechin respectively
Compound:1; Vanillicacid:white powder; mp: 215–223 0C 1H NMR (500 MHz, CD3COCD3): δ 8.03 (1 H, s), 7.60 (1 H, dd, J = 8.2, 1.9 Hz), 7.57 (1 H, d, J = 1.9 Hz), 6.92 (1 H, dd, J = 7.3, 5.2 Hz), 3.91 (3H, s) ppm.13C NMR (125 MHz): δ 166.6, 151.2, 147.2, 123.9, 122.0, 114.6, 112.6, 55.4 ppm. ( +)-HRESIMS m/z 191.0325. [M + Na]+ (calcd for C8H8NaO4, 191.0320).
Compound:2; Ergost-4-ene-3-one: White solid; mp:153–158 0C; 1H (500 MHz, CDCl3): δ 5.72 (1 H, s), 2.44–2.37 (2 H, m), 2.35 (1 H, t, J = 4.0 Hz), 2.33–2.29 (1 H, m), 2.29–2.23 (1 H, m), 2.02 (3 H, m), 1.85 (2 H, m), 1.73–1.66 (3 H, m), 1.55–1.48 (4 H, m), 1.33–1.28 (3 H, m), 1.25 (3 H, s), 1.18 (3 H, s), 1.15–1.10 (3 H, m), 1.02 (3 H, m), 0.92 (4 H, m), 0.84 (3 H, d, J = 6.9 Hz), 0.81 (3 H, d, J = 6.8 Hz), 0.71 (3 H, s) ppm. 13C NMR (125 MHz): δ 199.6, 171.6, 123.7, 56.0, 55.9, 53.8, 45.8, 42.4, 39.6, 38.6, 36.1, 35.7, 35.6, 33.9, 32.9, 32.1, 29.2, 28.2, 26.1, 24.2, 23.1, 21.0, 19.8, 19.0, 18.7, 17.4, 11.9, 11.9 ppm; ( +)-HRESIMS m/z 321. 0982[M + H]+ (calcd for C28H46NaO, 421.3446).
Compound:3; (-) Catechin:Pale yellow powder; mp:180–196. 1H (500 MHz, MeOD): δ 6.86 (1 H, d, J = 1.8 Hz), 6.78 (1 H, d, J = 8.1 Hz), 6.74 (1 H, dd, J = 8.1, 1.9 Hz), 5.95 (1 H, d, J = 2.3 Hz), 5.87 (1 H, d, J = 2.2 Hz), 4.58 (1 H, d, J = 7.5 Hz), 3.99 (1 H, td, J = 7.9, 5.5 Hz), 2.87 (1 H, dd, J = 16.1, 5.4 Hz), 2.52 (1 H, dd, J = 16.1, 8.2 Hz) ppm; 13CNMR (125 MHz): δ 156.4, 156.2, 155.5, 144.8, 130.7, 118.6, 114.6, 113.8, 99.4, 94.8, 94.1, 81.4, 67.4, 27.1 ppm; ( +)-HRESIMS m/z 313.0692 [M + Na]+ (calcd for C15H14NaO6, 313.0688).
Three secondary phytochemicals were isolated and characterized from PRME using the available NMR data and compared with published literature. Compounds 1, 2 and 3 were identified as vanillic acid (VA), ergost-3-one-4ene (Prachayasittikul et al. 2009) and catechin (Abd El-Razek 2007), respectively (Fig. 1; S1–S6). The catechin-rich oil palm leaf extract increased BMD in OVX-rats via modulating ALP, bone calcium, and total mineral content, promoting osteoblast activity and regulating bone remodelling (Bakhsh et al. 2013). The role of VA in bone remodelling is well recognised, and the mechanism of action via ERE-independent and MAPK-mediated nongenomic activation of ER signalling promotes osteoblastic activation and inhibits osteoclastogenesis (Xiao et al. 2014). Tanaka et al. (2019) studied the mechanism of action of VA in both murine monocytic RAW264.7 cells (in vitro) and ovariectomised mice (in vivo) conditions, revealed the mechanism of action via estrogen receptor-mediated pathway and confirmed the anti-osteoporotic efficacy. Similarly, administration of resveratrol, curcumin, and quercetin modulate bone turnover mechanism via inhibiting matrix metalloproteases (MMP-9), promoting bone formation markers, regulating mesenchymal cell differentiation and RANK-RANKL signalling. These diverse mechanisms protect bone cells and prevent BMD parameters and prevent pathological complication such as osteoporosis and osteopenia (Inchingolo et al. 2022). Recent studies in natural product derivatives revealed that, different plant molecules activate diverse signalling pathways to promote bone defect healing and repair mechanisms. Administration of apigenin (10 mg/kg), curcumin (10 mg/kg), and resveratrol (10 mg/kg), in unilateral cranial bone defect (diameter, 5 mm) rats for 30 days revealed that apigenin treatment can induce remarkable bone healing in critical-size defects in SD rats via, upregulating RUNX2, SMAD5, and collagen genes (Lorusso et al. 2023). These isolated pure compounds, such as VA, ergost-3-one-4ene, and catechin, showed excellent bone protection activity, which may also be attributed to the biological potency of PRME. Recently, seven more molecules were isolated from PRME and identified as 3,7-dimethyl naphthalen-1-ol, 4-O-methyl gallic acid, beta-sitosterol, beta-sitosterol glucoside, E-resveratrol, 4′-O-methylgallocatechin, and gallocatechin with excellent anti-inflammatory activity (Anish et al. 2023a, b).
Elemental analysis of PRME
Atomic absorption spectrometry (AAS) is an analytical technique that measures the concentrations of elements quantified in the range of parts per billion of a gram by measuring the absorbance. The macro-elemental concentration of calcium, potassium, phosphorus, magnesium, zinc, manganese, and copper was evaluated, and the results were summarised (Table 1). Elemental analysis by AAS showed the presence of calcium, potassium, phosphorus, magnesium, zinc, manganese, and copper in PRME. The significant quantity of calcium (25,224.95 ± 0.13 ppm) may be one of the reasons behind this medicinal bark extract's potent biological activity of fracture healing. Calcium is a master regulator of cellular physiological state, along with vitamin D and protein, which can affect collagen synthesis, bone differentiation, and maturation, including bone calcification, muscle contraction, and nerve transmission with the help of diverse growth factors and specific hormones (Zofkova et al. 2017). PRME contains high levels of magnesium (885.54 ± 0.51 ppm), another crucial element for maintaining healthy bones. Due to the sparing action of Mg on Ca, without Ca, our body cannot utilise Mg effectively, even if the Mg is available in surplus levels. Mg regulates vitamin D metabolism and homeostasis and aids in muscle relaxation and regulate nerve functions (Rajput et al. 2018). The detailed elemental profiling of PRME showed a significant amount of phosphorus (351.12 ± 0.14 ppm), along with calcium and magnesium, which can also promote hydroxyapatite crystal formation. Even though the higher concentration of these minerals reaches a living system, the biological system has a homeostatic mechanism to take the administrated minerals to an optimum level by making them bioavailable to the body. Second, the living system removes the excess minerals entered our body and regulate overall mineral homeostasis; however, lower levels of these minerals will result in severe disorders. Therefore, regulating a healthy mineral pool within the optimum level is crucial for maintaining cellular and enzymatic activities associated with metabolic signaling and for overall wellbeing and health (Manivannan et al. 2022; Weyh et al. 2022).
Using ICPMS, the nanogram quantity of the trace elements can be detected from PRME (Table 1). The ICPMS analysis exhibited a significant strontium level (97.42 ± 0.020 ppm), indicating that the molecules derived from PRME can promote bone health. Strontium is an essential trace element with a dual mode of action in bone metabolism, i.e., it can promote osteoblastogenesis and inhibit osteoclastogenesis (Marie et al. 2011). The chromium level in PRME was 2.96 ± 0.025 ppm, and Shah et al. (2015) reported chromium's dual bone protective mechanism by promoting collagen synthesis or reducing the bone resorption process. In animal toxicity evaluation, the PRME extract administered to animals notably increases the level of superoxide dismutase enzyme along with glutathione peroxidase and reduced glutathione content (Anish and Rauf 2021b), possibly due to the significant copper content. PRME showed zinc(Zn) concentration of (5.98 ± 0.07 ppm) plays a crucial dual role in bone metabolism and simultaneously promotes osteoblastic activity and collagen synthesis to form the structural network of calcium phosphate crystals. It is essential for the action of alkaline phosphatase enzyme in bone mineralisation; fracture healing and higher levels are found at bone repair sites (Huang et al. 2020); deficiency of Zn results in delayed bone growth and leads to bone erosion and osteoporosis.
Selenium is present at a permissible level (0.29 ± 0.005 ppm) in PRME. Selenium promotes bone metabolic turnover in favour of bone formation, stimulates bone-specific alkaline phosphatase activity, and positively enhances the interaction with Zn2+ and Mg2+ in UMR106 cell lines (Fernández et al. 2014). The tolerable nickel level in adult humans averages about 0.5 mg per 70 kg, and the PRME exhibited an excellent correlation with standard RDA. WHO (2007) does not define any permissible limit for nickel in raw herbs or medicinal formulations. Similarly, PRME is rich in iron (138.97 ± 0.043 ppm) and acts as a co-factor in 25-hydroxy cholecalciferol hydroxylase, transforming vitamin D into an active form, thereby affecting calcium absorption and bone health. Shirin et al. (2009) reported the iron values in Withania somnifera shoot and seed as 3750.2 and 2380.1 ppm, respectively, with excellent biological efficacy. However, several other nutrients and trace elements, such as boron, selenium, iron, Zn, and copper, play a key role in bone metabolism and maintaining proper bone integrity (Gaffney-Stomberg 2019). About 90% of the bone mineral matrix is comprised of Ca and phosphorus; deficiency of these elements impairs a series of biological processes such as osteoblastogenesis and bone remodelling, which lead to a scenario of consequences such as loss of BMD, altered crystal formation, collagen maturation, osteopenia, and osteoporosis (Faibish et al. 2006).
Similarly, Ficus carica, Morus nigra and Morus alba are good sources of many macro-nutrients such as Ca, K, Mg, P, B, Cr, Fe, Mn, Ni, Sr and Zn; and are rich sources of essential nutrients for the human diet (Ullah et al. 2023). M. alba treatment in OVX-rats decreased oxidative stress and osteoclast density but enhanced osteoblast density and cortical thickness via increased growth formation and the suppression of bone resorption (Sungkamanee et al. 2014). Administration of F. carica fruit extract @ 50 mg/kg and 100 mg/kg in OVX-rats significantly reduced C-telopeptide of type 1 collagen levels and improved bone parameters in postmenopausal osteoporosis (PMO) (Izzaty et al. 2019). From the AAS and ICP-MS analysis, it was evident that the PRME contains an ample quantity of macro- and micro-mineral elements necessary for regulating bone growth, especially calcium, phosphorous, strontium and magnesium, which may enhance the extracellular matrix of growing osteoblast cells.
Molecular docking study
Docking interaction with 1KB6 protein and compounds isolated from PRME are summarised (Table 2). During the protein–ligand interaction, 183 poses of the selected ligands in the docked complexes were generated. The highest binding affinity corresponded to vanillic acid, followed by catechin and ergost-4-ene-3-one(Fig. 2). IKB6 is the crystal structure of the VDR DNA-binding domain bound to rat OCN response element is a vitamin D receptor (VDR) and forms homo- or heterodimers on response elements separated by spacer DNA. The VDR DNA-binding region in the regulatory complex has significant interactions with response elements of promoters, osteopontin and OCN (Shaffer and Gewirth 2002). These VDR mediates the cellular actions of 1,25(OH)2D. Cell-specific recruitment of co-regulatory combinations by liganded VDR leads to variations in gene expression that result in distinct physiological actions by 1,25(OH)2D and affect bone metabolism and remodelling cycle (Bikle et al., 2020). The docked complex of 1KB6 with vanillic acid ligand was analysed to study non-bond interactions between the target and the ligand molecule; vanillic acid showed significant binding affinity to OCN structural unit (A Polypeptide and D nucleic acid chain residues) with the binding energy of -6.5644 kcal/mol. Similarly, with hydrogen bonding, vanillic acid active derivatives showed high binding affinity towards OCN protein residues (ARG310, GLN77, ALA56, SER51). The docked complex of 1KB6 with catechin (73,160) showed different interacting residues (D: DT427:O-5) with hydrogen and (C: DA413) hydrophobic bonds of interactions with good binding energy. The ligand ergost-4-en-3-one (25,200,612) formed a docking complex with OCN and found hydrogen bonding of interaction with HIS75:HD1 (A) and HIS75:HE1 (A) residues and several hydrophobic interactions with an amino acid such as ALA56, LEU295, LYS303, ARG302, MET306, LEU57, PHE58 (Table 2). The computational analysis results exhibited an excellent ligand–aminoacid interaction and positively moved to a higher level wet lab study.
Table 2.
Interactive residues and bonding nature of ligand isolated from PRME against OCN protein
| Sl No | PubChem ID | Binding Energy (Kcal/Mol) | Interacting Residues | Bond Distance | Nature of Bonding |
|---|---|---|---|---|---|
| 1 | 8468 (Vanillic acid) | -6.5644 |
B:ARG310:NH1—8468:O3 A:GLN77:HE22—8468:O2 D:DT427:H3'—8468:O2 A:ALA56:HA—8468:O4 8468:H16—8468:O2 8468:H17—A:SER51:OG A:PHE58—8468 8468—A:ALA56 |
5.54422 2.4914 2.5872 2.0976 1.92944 2.7905 4.3633 3.60906 |
Electrostatic Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrophobic Hydrophobic |
| 2 | 73,160 (Catechin) | 37.2972 |
73,160:H24—D:DT427:O5' 73,160:H26—C:DG412:N3 C:DG412:H4'—73,160:O6 D:DT427:H4'—73,160:O1 C:DA413 – 73,160 |
3.01151 2.39609 2.95116 2.06376 5.59696 |
Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrophobic |
| 3 | 25,200,612 (Ergost-4-en-3-one) | 46.5173 |
A:HIS75:HD1—25,200,612:O1 A:HIS75:HE1—25,200,612:O1 A:ALA56—25,200,612:C28 A:ALA56—25,200,612:C29 B:LEU295—25,200,612 B:LYS303—25,200,612 25,200,612:C20—B:ARG302 25,200,612:C20—B:LYS303 25,200,612:C27—B:ARG302 25,200,612:C27—B:MET306 25,200,612:C28—B:MET306 25,200,612:C29—A:LEU57 25,200,612:C29—B:MET306 A:PHE58—25,200,612:C14 |
2.27374 3.06936 3.17387 4.40991 4.91908 5.42733 4.8078 4.30829 4.05717 4.70663 4.47031 5.30964 4.59387 4.88684 |
Hydrogen Bond Hydrogen Bond Hydrophobic Hydrophobic Hydrophobic Hydrophobic Hydrophobic Hydrophobic Hydrophobic Hydrophobic Hydrophobic Hydrophobic Hydrophobic Hydrophobic |
| 4 |
2088 (Alendronic acid) |
-25.4610 |
C:DG412:H22—2088:O6 C:DG412:H22—2088:O9 2088:H16—C:DA413:O4' 2088:H20—D:DT428:O4' 2088:H21—C:DT411:O2 2088:H21—D:DT427:O2 C:DG412:H4'—2088:O4 C:DG412:H1'—2088:O9 D:DA426:H2—2088:O6 2088:H27—C:DT411:O2 |
2.43994 2.57252 2.10275 1.98272 2.30904 1.98139 2.31342 2.6587 2.9243 2.45617 |
Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrogen Bond Hydrogen Bond |
Fig. 2.
2D represenatation of OCN docking interaction with compounds isolated from PRME; where; a Catechin; b Vanillic acid;) Ergost-4-en-3-one; d) Alendronate ligand interactions with the various ligands
In vitro study
The MG-63 cells are human osteosarcoma-derived cells, a well-characterised cell line to evaluate osteoblast adhesion and proliferation; these cell lines can exhibit the phenotypic markers of osteogenic activity (Staehlke et al. 2019). Due to their rapid proliferation and easy cultivation, MG-63 cells serve well as an in vitro model cell line for initial cytocompatibility and adhesion assays (Dvorakova et al. 2023). The cytotoxic effect of PRME on the MG-63 cell line was assessed using MTT assay and showed significant cellular competency with an IC50 value of 62.8113 µg/mL (calculated using ED50 PLUS V1.0 Software). Inverted phase contrast tissue culture microscopy did not reveal any change in cell morphology, such as shrinking of cells and cellular changes in the cytoplasm, with no significant morphological cytotoxicity. The deposition of calcium by MG-63 osteoblasts was quantitatively determined by colourimetric measurement. The in vitro study showed that calcium content linearly increased on the 7th and 14th day to 5.1766 ± 0.3177 mg/dL and 6.0941 ± 0.3493 mg/dL, respectively (Table 3). In addition, alizarin red staining showed significantly increased calcium deposition in the treated group compared to control groups and exhibited a positive correlation with calcium concentration and bioactivity (Fig. 3).
Table 3.
In vitro analysis of ALP and calcium content
| Treatment period | Sample code | Calcium concentration (mg/dL) | ALP Activity(U/L) |
|---|---|---|---|
| DAY 7 | Control | 4.1494 ± 0.2422 | 34.0866 ± 0.8901 |
| PRME | 5.1766 ± 0.3177 | 44.3709 ± 1.1960 | |
| Alendronate | 5.3474 ± 0.3503 | 51.2585 ± 1.0190 | |
| DAY 14 | Control | 4.5568 ± 0.4449 | 56.7055 ± 1.5684 |
| PRME | 6.0941 ± 0.3493 | 75.4896 ± 1.2429 | |
| Alendronate | 6.6287 ± 0.4524 | 83.1011 ± 1.6357 |
Values are expressed as mean ± standard deviation (n = 3). Where; PRME Pterospermum rubiginosum methanolic bark extract, mg/dL milligrams per deciliter, U/L Units per litre
Fig. 3.
Alizarin red staining for calcium deposition. Where; a control; b PRME; c Alendronate (7th days treatment); and d control; e PRME; f alendronate (14th days treatment). PRME- Pterospermum rubiginosum methanolic bark extract
Similarly, lupeol isolated from Clinacanthus nutans promoted calcium deposition (bone mineralisation) confirmed by Alizarin red-S staining, and detailed osteogenic marker evaluation revealed the osteogenic activity via MAPK signalling pathway relating to osteoblast differentiation (Nguyen et al. 2021). The polyphenolic compounds from Bacopa procumbens 80 mg/mL and 160 mg/mL in the excisional wound model of Wistar rats showed enhanced fibroblasts and collagen content. Picrosirius Red staining revealed deposition and orientation of the collagen fibres, indicating that the coarse fibres are predominantly composed of type I collagen (Martínez-Cuazitl et al. 2022). The calcium deposition detection by Alizarin red staining (Fig. 3) and collagen content were assessed by Sirius red staining (Fig. 4), exhibiting an increased quantification in the PRME treatment group comparing to the control group.
Fig. 4.
Sirius red staining for collagen deposition. Where; a control; b PRME; c Alendronate (7th days treatment); and d control; e PRME; f alendronate (14th days treatment). PRME- Pterospermum rubiginosum methanolic bark extract
The MG-63 is an osteoblast-like cell which can produce bone-specific proteins such as alkaline phosphatase (ALP) and OCN. The MG-63 cell, with its characteristic osteoblasts, helps to assess the biological effects of samples in osteoblast mineralisation (Lajeunesse et al. 1991) by evaluating the ALP. ALP is released by osteogenic precursor cells as an early sign of osteoblastic differentiation and is considered one of the markers of the early osteogenesis of osteoblasts (Lajeunesse et al. 1991; Dvorakova et al. 2023). ALP is a Zn-containing metalloenzyme in bone mineralisation and maturation; two Zn ions and one Mg ion in the active site are essential for optimal enzyme activity. The significant level of Mg and Zn in PRME may support the alkaline phosphatase activity in MG-63 cell lines. Osteoblasts express ALP as a phenotypic and early marker for the initial stages of bone extracellular matrix mineralisation. The PRME-treated cells showed good ALP activity of (44.3709 ± 1.1960 U/L) on the 7th day and a significant increase to (71.7388 ± 2.5994 U/L) on the 14th day, compared to standard drug alendronate (74.4895 ± 2.2424 U/L) (Table 3). High ALP can stimulate the synthesis of collagen fibres and bone mineralisation, probably due to good elemental interaction with osteoblast cells, which can indirectly influence osteoclast receptors through chemical or hormonal signals signalling, which can minimise osteoclastic action (Golub et al. 2007). Alendronate (ALN) administration (0.01 mg/kg body weight per day for 8 weeks) notably increased the total bone area, promoted bone formation by autogenous bone graft in the rat calvarial defect model, and inhibited osteoclastic activity (Toker et al. 2012). Studies revealed ALN release from calcium phosphate cement promotes bone regeneration in bone defect rat models in osteoporotic animals (van Hout et al., 2018). Collagen-hydroxyapatite composite scaffolds encapsulated with ALN and biodegradable microspheres of BMP-2 significantly increase osteogenic activity and bone regeneration owing to the synergistic effect of BMP-2 and ALN (Lee et al. 2021).
Effect of PRME on osteogenic gene expression
The bone formation process is associated with the increased expression of specific markers released by osteoblasts, and these cross-linked genes play crucial roles in extracellular matrix formation and mineral deposition. For evaluating the anabolic effect of PRME, the mRNA expressions of ALP (alkaline phosphatase), COL1A1 (collagen, type 1, alpha 1), and osteocalcin (OCN) in MG-63 cells were measured by RT-PCR. The variations in expression levels of osteogenic genes under different time intervals and the relative expression of both the ALP enzyme and collagen type-I exhibited a linear upgradation from the 7th and 14th day of the study (Fig. 5). Gene expression study demonstrated the efficiency of PRME by upregulated the genes responsible for bone formation, such as ALP, type 1 collagen, and bone turnover marker OCN. OCN is a crucial biomarker in fracture healing and bone remodelling; any agent enhancing OCN secretion can promote bone regeneration (Moser and van der Eerden 2019). Similarly, stromal vascular fraction application in murine models aids the healing process in a murine model with bone defects (Dradjat et al. 2021). Collagen is an early marker of pre-osteoblast lineage, progressively expressing ALP during the bone maturation stage and OCN during the mineralisation phase (Thu et al. 2018). The results suggest that the PRME may play a vital role at an early stage of osteoblast differentiation and enhance the COL1A1, ALP, gene expression. The PRME can also enhance the collagen and calcium deposition level in MG-63 cells, as Alizarin red and Sirius red staining demonstrated, stimulating the mineralisation phase. The in vitro study showed the osteogenic efficacy of PRME, then moved to the animal (invivo) evaluation study.
Fig. 5.
Graphical and photographic representations of mRNA expressions of osteogenic genes on MG63 osteoblast-like cells treated with PRME. Results were presented as mean ± SD, n = 3 with Significance accepted p ≤ 0.05. Group: I—control, group: II—PRME treated cells, group: III—Standard drug (alendronic acid) treated cells. ALP alkaline phosphatase, OCN osteocalcin, PRME Pterospermum rubiginosum methanolic bark extract. Where, ‘a’ indicates values are significantly differs from normal control groups. ‘b’ indicates values are significantly differs from PRME treated groups
In vivo serum mineral and marker study
The mid-ventral ovariectomy was performed to standardise the animal model similar to postmenopausal osteoporosis by in-house protocol (Fig. 6) (Anish et al. 2023b). After confirming the osteoporotic status of animals, PRME administration begins @ 50 mg/kg body weight dosage for 3 months. The serum mineral evaluation was performed monthly in SD rats to monitor the incremental variations in serum calcium and phosphorus concentration. The mineral levels were significantly correlated with bone mineral matrix, and the variations can be easily monitored. The serum calcium and phosphorus showed a linear increase from 6.86 ± 1.55 mg/dL to 8.12 ± 1.05 mg/dL and 3.46 ± 0.74 mg/dL to 4.18 ± 0.83 mg/dL, respectively, from first to third month of study (Table 4). The bone formation enzyme marker, BALP is a glycoprotein found on the surface of osteoblasts, exhibited a significant increase during PRME administration ranging from 2.36 ± 0.51 to 3.99 ± 0.69 ng/mL (Fig. 7). BALP regulates bone mineralisation and provides inorganic phosphate from pyrophosphate for hydroxyapatite synthesis (Michigami and Ozono 2019). The OCN is a highly osteoblast-specific protein directly involved in bone mineralisation and can enhance bone mineral maturation (Moser and van der Eerden 2019). The OVX animals exhibited a moderate increase in OCN in the range of 6.95 ± 1.45 ng/mL to 9.93 ± 1.68 ng/mL. The values are notable compared to group II animals (Fig. 8). Studies revealed that ALP, collagen and OCN mineralisation affect pre-osteoblast function by enhancing circulating osteoblast lineage cells, especially osteocalcin-positive (OCN+) cells, in the peripheral blood. These osteoblast markers were significantly detected in OCN+ cells, suggesting the mechanism of action of the bone marrow-derived OCN+ cells at the bone repair and regeneration sites (Abe et al. 2019; Grue and Veres 2022). The collagen peptides can promote osteoblast mineralisation; interaction between peptides and integrin α5β1 may be responsible for osteoblast mineralisation stimulation activity. The phosphorylation modification of collagen peptide enhanced calcium-binding capacity in docking evaluation study and pro-mineralisation activity and improved bone health (Wang et al. 2023; Qi et al. 2024). During PRME administration, COL1A1 also showed a significant increase in serum values in the range of 3.95 ± 0.46 to 4.80 ± 1.14 ng/mL from the 1st to 3rd month of the study, similar to BALP. The serum marker showed an overall improvement in PRME-administered animals during the study.
Fig. 6.
Mid-ventral ovariectomy Where; a. Primary skin incision; b. Deep muscle incision; c. Identification of both right and left ovaries; d. Excised ovaries; e. Muscle suturing using degradable suture; f. skin suturing and wound seal application
Table 4.
Serum mineral evaluation of bone markers on experimental rats during study period
| Experimental period | Calcium (mg/dl) | Phosphorus (mg/dl) | ||||||
|---|---|---|---|---|---|---|---|---|
| SC | OVX | OVX + PRME | OVX + Std | SC | OVX | OVX + PRME | OVX + Std | |
| 1st month | 10.87 ± 1.27 | 6.34 ± 0.69 | 6.86 ± 1.66 | 6.69 ± 1.45 | 6.19 ± 0.60 | 2.86 ± 0.36 | 3.46 ± 0.74 | 3.31 ± 0.91 |
| 2nd month | 11.19 ± 1.10 | 6.76 ± 0.60 | 7.79 ± 0.94 | 7.09 ± 1.60 | 6.30 ± 0.59 | 2.89 ± 0.59 | 3.82 ± 0.57 | 3.70 ± 0.59 |
| 3rd month | 10.91 ± 1.21 | 6.39 ± 0.81 | 8.12 ± 1.05 | 7.30 ± 1.09 | 5.96 ± 0.45 | 2.95 ± 0.41 | 4.18 ± 0.83 | 3.96 ± 0.67 |
Where; OVX ovariectomized rat, SC Sham control, OVX + PRME ovariectomized rat + Pterospermum rubiginosum methanolic extract, OVX + std ovariectomized rat + alendronic acid, mg/dl milligrams per decilitre
Fig. 7.
Graphical representation of serum BALP and COL1A1 values during PRME treatment period. Where; SC Sham control, OC osteoporotic control (ovariectomized rat), OVX Ovariectomized rat, PRME Pterospermum rubiginosum methanolic bark extract, AA Alendronic acid, ng/ml nanogram per milliliter. Readings of different experimental groups during 1st month of study period (SC-1; OC-1; OVX + PRME-1; OVX + AA-1); 2nd month of study period (SC-2; OC-2; OVX + PRME-2; OVX + AA-2); 3.rd month of study period (SC-3; OC-3; OVX + PRME-3; OVX + AA-3)
Fig. 8.

Graphical representation of serum OCN during PRME treatment period. Where; SC Sham control, OC osteoporotic control (ovariectomized rat), OVX Ovariectomized rat, PRME Pterospermum rubiginosum methanolic bark extract, AA Alendronic acid, ng/ml nanogram per milliliter. Readings of different experimental groups during 1st month of study period (SC-1; OC-1; OVX + PRME-1; OVX + AA-1); 2nd month of study period (SC-2; OC-2; OVX + PRME-2; OVX + AA-2); 3rd month of study period (SC-3; OC-3; OVX + PRME-3; OVX + AA-3)
DEXA scan
A DEXA scan was performed to confirm the recovery of SD rats from PMO after PRME administration. After 3 months of PRME treatment, the animals showed an overall recovery in bone mineral density (BMD) and bone mineral content (BMC) (Table 5). In each region, especially the arms, ribs, spine, and pelvis, an incremental increase in BMD and BMC values was observed in Group III and Group IV rats (Table 6). DEXA scan was performed to evaluate the bone density and recovery status from osteoporotic conditions after PRME administration. After the treatment period, DEXA reports displayed a remarkable recovery in total BMD (g/cm2) values in the PRME in the range of 0.170 ± 0.006 g/cm2, where the sham control animals showed a higher value of 0.183 ± 0.006 g/cm2 and the osteoporotic animals with 0.163 ± 0.004 g/cm2. The BMC also exhibited a close similarity with total BMD values in the administered group, 7.37 ± 0.46 g, compared to osteoporotic control group 6.97 ± 0.21 g (Table 6). Various studies in natural product derivatives, including medicinal plant extracts, improve BMC, and BMD and promote bone regeneration in PMO. Ginger and curcumin administration for 4 months improved OCN, ALP, hs-CRP, and SOD levels in women with PMO (Salekzamani et al. 2023). From the DEXA data, we confirmed that the PRME significantly increased both BMD and BMC, strengthening the vital role of PRME in bone remodelling mechanisms. The in vitro and in vivo studies revealed the role of PRME in inducing osteoblast differentiation by stimulating the enzyme alkaline phosphatase and promoting bone formation markers like BALP, COL1A1, and OCN.
Table 5.
BMD evaluation during PRME administration period
| Regions | SC (g/cm2) | OVX (g/cm2) | OVX + PRME (g/cm2) | OVX + Std (g/cm2) |
|---|---|---|---|---|
| Head | 0.302 ± 0.013 | 0.290 ± 0.010 | 0.299 ± 0.002 | 0.297 ± 0.009 |
| Arms | 0.147 ± 0.023 | 0.114 ± 0.029 | 0.128 ± 0.017 | 0.143 ± 0.009 |
| Legs | 0.154 ± 0.004 | 0.134 ± 0.003 | 0.147 ± 0.008 | 0.143 ± 0.011 |
| Trunk | 0.160 ± 0.006 | 0.132 ± 0.007 | 0.141 ± 0.012 | 0.153 ± 0.008 |
| Ribs | 0.151 ± 0.008 | 0.116 ± 0.007 | 0.124 ± 0.017 | 0.138 ± 0.017 |
| Spine | 0.165 ± 0.008 | 0.140 ± 0.006 | 0.144 ± 0.020 | 0.160 ± 0.005 |
| Pelvis | 0.161 ± 0.005 | 0.134 ± 0.011 | 0.150 ± 0.012 | 0.154 ± 0.012 |
| Total | 0.183 ± 0.006 | 0.164 ± 0.004 | 0.170 ± 0.006 | 0.174 ± 0.006 |
Where: OVX ovariectomized rat, SC Sham control, OVX + PRME ovariectomized rat + Pterospermum rubiginosum methanolic extract, OVX + std ovariectomized rat + alendronic acid, bone mineral density—BMD; Grams per Square Centimetre—g/cm2
Table 6.
BMC evaluation during PRME administration period
| Regions | SC (g) | OVX (g) | OVX + PRME (g) | OVX + Std (g) |
|---|---|---|---|---|
| Arms | 0.87 ± 0.12 | 0.33 ± 0.17 | 0.47 ± 0.35 | 0.58 ± 0.34 |
| Legs | 1.87 ± 0.31 | 2.1 ± 0.66 | 1.98 ± 0.82 | 1.76 ± 0.84 |
| Trunk | 2.9 ± 0.52 | 1.93 ± 0.38 | 2.32 ± 0.51 | 2.78 ± 0.54 |
| Total | 8.03 ± 0.35 | 6.97 ± 0.21 | 7.37 ± 0.46 | 7.6 ± 0.39 |
| TBLH | 5.63 ± 0.21 | 4.4 ± 0.53 | 4.8 ± 0.68 | 5.12 ± 0.54 |
Where; OVX ovariectomized rat, SC Sham control, OVX + PRME variectomized rat + Pterospermum rubiginosum methanolic extract, OVX + std ovariectomized rat + alendronic acid; bone mineral content—BMC, g grams
Limitations of study
Despite advances in research, detailed characterisation of elements and understanding the effect of each trace element on bone cells is found challenging and time consuming. Detailed in silico and in vivo interactive studies may open new insights into single and elemental combinations in bone metabolism and health. Due to the resource limitations, the authors could not study the biological efficacy of single macro and microelements in the bone remodelling cycle. The plant bark is rich in healthy elements for bone health, so we do not align to the toxicological aspects of elements present in PRME.
Future prospective
Further elaborative invivo studies are proposed to be carried out in our animal lab to identify the molecular signalling of PRME behind the bone remodelling mechanism. It is worth to explore the single elements or elemental combinations present in PRME and its biological interactions with different osteo-proteins in the bone remodelling cycle may also open vast possibilities to enhance BMD during ageing. The toxicological elemental studies may also provide new insights in pharmaceutical approaches for drug formulations.
Conclusions
In summary, the structural characterisation study revealed the presence of vanillic acid, ergost-4-en-3-one, and catechin in PRME, which exhibited good binding energy and interactions with OCN on computational analysis. Biological studies revealed that both macro and micro-minerals elements present in PRME can promote bone growth and metabolism. The ALP and Ca assay, along with Sirius red and Alizarin red staining, gene expression results exhibited an excellent osteogenic activity of PRME. The in vivo studies and DEXA scanning confirmed the ability of PRME to promote osteoblastic activity and support the bone remodelling mechanism. In conclusion, our results exhibited that PRME has a significant osteoprotective effect against bone loss induced by midventrally ovariectomized estrogen-deficient SD rats.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
I would like to thank Department of Biochemistry, University of Kerala, and, Department of Organic chemistry, National Institute of Interdisciplinary Science and Technology (CSIR), Trivandrum, Kerala, India for providing infrastructural facility to perform the experiments.
Author contributions
RJA: conceptualization, methodology, investigation, study design, writing—original draft preparation. BM: data curation, software, visualisation, investigation. AN: conceptualisation, resources, writing—original draft preparation. KVR: software, validation, manuscript editing. AAR: supervision, manuscript editing, funding acquisition. All the authors contributed to manuscript preparation, reviewed the article, edited, and approved the manuscript.
Funding
The University of Kerala and the Department of Biochemistry 2017–2021, India, funded this research.
Data availability
The data that support the findings of this study are available on request.
Declarations
Conflict of interest
The authors declare that they have no known competing financial or personal interests.
Ethical approval
Ethical clearance for the use of animals for the current study was obtained from the Department of Biochemistry, University of Kerala. Animals were treated as per CPCSEA guidelines; the experimental protocol was approved by the Institutional Animal Ethical Committee (IAEC-2-KU-01/2018–19-BCH-AAR (13); the experimental study was conducted in agreement with OECD guidelines.
Contributor Information
Rajamohanan Jalaja Anish, Email: anishrj@keralauniversity.ac.in.
Arun A. Rauf, Email: arunarauf@keralauniversity.ac.in
References
- Abe Y, Chiba M, Yaklai S, Pechayco RS, Suzuki H, Takahashi T. Increase in bone metabolic markers and circulating osteoblast-lineage cells after orthognathic surgery. Sci Rep. 2019;9(1):20106. doi: 10.1038/s41598-019-56484-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Abugassa IO, Bashir AT, Doubali K, Etwir RH, Abu-Enawel M, Abugassa SO. Characterisation of trace elements in medicinal herbs by instrumental neutron activation analysis. J Radioanal Nucl Chem. 2008;278:559–563. doi: 10.1007/s10967-008-1005-z. [DOI] [Google Scholar]
- Ali H, Khan E, Ilahi I (2019) Environmental chemistry and ecotoxicology of hazardous heavy metals: environmental persistence, toxicity, and bioaccumulation. J. Chem 6730305.
- Anish RJ, Rauf AA. In vitro anti-inflammatory and antioxidant evaluation of an indigenous medicinal plant – Pterospermum rubiginosum. J Exp Biol Agric Sci. 2021;9(5):687–696. doi: 10.18006/2021.9(5).687.696. [DOI] [Google Scholar]
- Anish RJ, Mohanan B, Aswathy TR, Nair A, Radhakrishnan KV, Rauf AA. An integrated approach to the structural characterisation, long-term toxicological and anti-inflammatory evaluation of Pterospermum rubiginosum bark extract. J Ethnopharmacol. 2023;308:116262. doi: 10.1016/j.jep.2023.116262. [DOI] [PubMed] [Google Scholar]
- Anish RJ, SoumyaNPP NA, Rauf AA. Standardization of Sprague-Dawley rats as a postmenopausal osteoporotic model through biochemical marker evaluation and Dexa scan. ExplorAnim Med Res. 2023;13(1):39–48. [Google Scholar]
- Anish RJ, Sajeetha S, Rauf AA (2021a) Cytotoxic evaluation and phytochemical screening of an ethnomedicinal plant: Pterospermum rubiginosum from southern Western Ghats. J.Med.Plant Res 9(5): 51–58.
- Bakhsh A, Mustapha NM, Mohamed S. Catechin-rich oil palm leaf extract enhances bone calcium content of estrogen-deficient rats. Nutrition. 2013;29(4):667–672. doi: 10.1016/j.nut.2012.09.005. [DOI] [PubMed] [Google Scholar]
- Bates P, Yeo A, Ramachandran M(2018) Bone injury, healing andgrafting. Basic Orthop Sci205–222.
- Bikle D, Christakos S. New aspects of vitamin D metabolism and action—Addressing the skin as source and target. Nat Rev Endocrino l. 2020;16(4):234–252. doi: 10.1038/s41574-019-0312-5. [DOI] [PubMed] [Google Scholar]
- Bulska E, RuszczyńskaA(2017). Analytical techniques for trace element determination. Physical Sciences Reviews, Inorganic Trace Analytics 2:1–14.
- Crockett JC, Rogers MJ, Coxon FP, Hocking LJ, Helfrich MH. Bone remodelling at a glance. J Cell Sci. 2011;124:991–998. doi: 10.1242/jcs.063032. [DOI] [PubMed] [Google Scholar]
- Diller DJ, MerzJr KM(2001) High throughput docking for library design and library prioritisation, Proteins: Struct.Funct.Genet43:113–124. [DOI] [PubMed]
- Dradjat RS, Sananta P, Rosandi RD, Siahaan LD. Osteocalcin biomarker level evaluation on fracture healing with bone defect after stromal vascular fraction application in murine model. Ann Med Surg. 2021;71:103020. doi: 10.1016/j.amsu.2021.103020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dvorakova J, Wiesnerova L, Chocholata P, Kulda V, Landsmann L, Cedikova M, Kripnerova M, Eberlova L, Babuska V. Human cells with osteogenic potential in bone tissue research. Biomed Eng Online. 2023;22(1):1–28. doi: 10.1186/s12938-023-01096-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- El-RazekMH A. NMR assignments of four catechinepimers. Asian J Chem. 2007;19:4867. [Google Scholar]
- Faibish D,OttSM, Boskey AL(2006). Mineral changes in osteoporosis a review. Clin. Orthop. Relat. Res 443:28. [DOI] [PMC free article] [PubMed]
- Fernández JM, Molinuevo MS, McCarthy AD, Cortizo AM. Strontium ranelate stimulates the activity of bone-specific alkaline phosphatase: interaction with Zn2+ and Mg2+ Biometals. 2014;27(3):601–607. doi: 10.1007/s10534-014-9733-8. [DOI] [PubMed] [Google Scholar]
- Gaffney-Stomberg E (2019) The impact of trace minerals on bone metabolism.Biol.Trace Elem.Res188:26–34. [DOI] [PubMed]
- Golub EE, Boesze-Battaglia K (2007) The role of alkaline phosphatase in mineralisation. CurrOpinOrthop18(5):444–448.
- Gomes DS, Santos AMC, Neves GA, Menezes RR. A brief review on hydroxyapatite production and use in biomedicine. Cerâmica. 2019;65:282–302. doi: 10.1590/0366-69132019653742706. [DOI] [Google Scholar]
- Gregory CA, Gunn WG, Peister A, Prockop DJ. An Alizarin red-based assay of mineralisation byadherent cells in culture: comparison with cetylpyridinium chloride extraction. Anal Biochem. 2004;329:77–84. doi: 10.1016/j.ab.2004.02.002. [DOI] [PubMed] [Google Scholar]
- Grue BH, Veres SP. Effect of increasing mineralization on pre-osteoblast response to native collagen fibril scaffolds for bone tissue repair and regeneration. J Appl Biomater Funct Mater. 2022;20:22808000221104000. doi: 10.1177/22808000221104000. [DOI] [PubMed] [Google Scholar]
- Huang T, Yan G, Guan M. Zinc homeostasis in bone: zinc transporters and bonediseases. Int J Mol Sci. 2020;21(4):1236. doi: 10.3390/ijms21041236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Inchingolo AD, Inchingolo AM, Malcangi G, Avantario P, Azzollini D, Buongiorno S, Viapiano F, Campanelli M, Ciocia AM, De Leonardis N, de Ruvo E, Ferrara I, Garofoli G, Montenegro V, Netti A, Palmieri G, Mancini A, Patano A, Piras F, Marinelli G, Di Pede C, Laudadio C, Rapone B, Hazballa D, Corriero A, Fatone MC, Palermo A, Lorusso F, Scarano A, Bordea IR, Di Venere D, Inchingolo F, Dipalma G. Effects of resveratrol, curcumin and quercetin supplementation on bone metabolism-a systematic review. Nutrients. 2022;14(17):3519. doi: 10.3390/nu14173519. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Izzaty RN, Adlina MN, Dzulkhairi MR, Shamsir MA, Nadia ME (2019) The Effects of Ficus Carica Fruit on Bone Markers and Oestrogen Level of Post-Menopausal Osteoporotic Rats. Int. Med. J. Malays 18(1)
- Kiernan JA(2011) Sirius Red for collagen staining protocol. Department of Anatomy and Cell Biology, The University of Western Ontario, london, Canada
- Lajeunesse D, Kiebzak GM, Frondoza C, SacktorB(1991) Regulation of osteocalcin secretion by human primary bone cells and by the human osteosarcoma cell line MG-63. Bone and mineral 14(3):237–250. [DOI] [PubMed]
- Lee J, Jung H, Park N, Park SH, Ju JH. Induced osteogenesis in plants decellularized scaffolds. Sci Rep. 2019;9(1):20194. doi: 10.1038/s41598-019-56651-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee D, Wufuer M, Kim I, Choi TH, Kim BJ, Jung HG, Jeon B, Lee G, Jeon OH, Chang H, Yoon DS. Sequential dual-drug delivery of BMP-2 and alendronate from hydroxyapatite-collagen scaffolds for enhanced bone regeneration. Sci Rep. 2021;11(1):746. doi: 10.1038/s41598-020-80608-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lorusso F, Scarano A, Fulle S, Valbonetti L, Mancinelli R, Di Filippo ES. Effectiveness of Apigenin, Resveratrol, and Curcumin as Adjuvant Nutraceuticals for Calvarial Bone Defect Healing: An In Vitro and Histological Study on Rats. Nutrients. 2023;15(5):1235. doi: 10.3390/nu15051235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Manivannan C, Viswanathan G, Sundaram KM. Calcium bioavailability in leafy vegetables and medicinal plants. Int J Health Sci. 2022;6(S2):8802–8810. [Google Scholar]
- Marie PJ, Felsenberg D, Brandi ML. How strontium ranelate, via opposite effects on bone resorption and formation, prevents osteoporosis. Osteoporos in. 2011;22:1659–1667. doi: 10.1007/s00198-010-1369-0. [DOI] [PubMed] [Google Scholar]
- Martínez-Cuazitl A, Gómez-García MD, Hidalgo-Alegria O, Flores OM, Núñez-Gastélum JA, Martínez ES, Ríos-Cortés AM, Garcia-Solis M, Pérez-Ishiwara DG. Characterization of polyphenolic compounds from Bacopa procumbens and their effects on wound-healing process. Molecules. 2022;27(19):6521. doi: 10.3390/molecules27196521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Meng XY, Zhang HX, Mezei M, Cui M. Molecular docking: a powerful approach for structure-based drug discovery. CurrComput Aided Drug Des. 2011;7(2):146–157. doi: 10.2174/157340911795677602. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Michigami T, OzonoK(2019) Roles of phosphate in skeleton. Front.Endocrinol 10:180. [DOI] [PMC free article] [PubMed]
- Moser SC, van der Eerden BC. Osteocalcin-a versatile bone-derived hormone. Front Endocrinol. 2019;9:794. doi: 10.3389/fendo.2018.00794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nguyen MT, Ngo QV, Nguyen HT, Pham QM, Dinh TH, Nguyen HT, V. Tinh N, Nguyen PT (2021) Osteogenic activity of Lupeol isolated from Clinacanthusnutans Lindau: activity and mode of action. J.Chem 2021:1-8
- Prachayasittikul S, Suphapong S, Worachartcheewan A, Lawung R, Ruchirawat S, Prachayasittikul V. Bioactive metabolites from Spilanthes acmella Murr. Molecules. 2009;14:850–867. doi: 10.3390/molecules14020850. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qi L, Wang K, Zhou J, Zhang H, Guo Y, Zhang C. Phosphorylation modification of bovine bone collagen peptide enhanced its effect on mineralization of MC3T3-E1 cells via improving calcium-binding capacity. Food Chem. 2024;433:137365. doi: 10.1016/j.foodchem.2023.137365. [DOI] [PubMed] [Google Scholar]
- Rajput R, Wairkar S, Gaud R. Nutraceuticals for better management of osteoporosis: an overview. J Funct Foods. 2018;47:480–490. doi: 10.1016/j.jff.2018.06.013. [DOI] [Google Scholar]
- Salekzamani Y, Shakouri SK, Dolatkhah N, Saleh P, Hashemian M. The effect of ginger and curcumin co-supplementation in postmenopausal women with osteoporosis: a randomised, triple-blind, placebo-controlled clinical trial. J Herb Med. 2023;42:100746. doi: 10.1016/j.hermed.2023.100746. [DOI] [Google Scholar]
- Sampath S, Veeramani V, Krishnakumar GS, Sivalingam U, Madurai SL, Chellan R. Evaluation of in vitro anticancer activity of 1, 8-Cineole–containing n-hexane extract of Callistemon citrinus (Curtis) Skeels plant and its apoptotic potential. Biomed Pharmacother. 2017;93:296–307. doi: 10.1016/j.biopha.2017.06.056. [DOI] [PubMed] [Google Scholar]
- Shaffer PL, Gewirth DT. Structural basis of VDR-DNA interactions on direct repeat response elements. EMBO J. 2002;21(9):2242–2252. doi: 10.1093/emboj/21.9.2242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shah KM, Wilkinson JM, Gartland A. Cobalt and chromium exposure affects osteoblast function and impairs the mineralisation of prosthesis surfaces In vitro.J. Orthop Res. 2015;33:1663–1670. doi: 10.1002/jor.22932. [DOI] [PubMed] [Google Scholar]
- Shirin K, Imad S, Shafiq S, Fatima K. Determination of major and trace elements in the indigenous medicinal plant Withaniasomnifera and their possible correlation with therapeutic activity. J Saudi Chem Soc. 2010;14:97–100. doi: 10.1016/j.jscs.2009.12.015. [DOI] [Google Scholar]
- Staehlke S, Rebl H, Nebe B. Phenotypic stability of the human MG-63 osteoblastic cell line at different passages. Cell Biol Int. 2019;43(1):22–32. doi: 10.1002/cbin.11073. [DOI] [PubMed] [Google Scholar]
- Stanzione F, Giangreco I, Cole JC. Use of molecular docking computational tools in drug discovery. Prog Med Chem. 2021;60:273–343. doi: 10.1016/bs.pmch.2021.01.004. [DOI] [PubMed] [Google Scholar]
- Sungkamanee S, Wattanathorn J, Muchimapura S, Thukham-mee W. Antiosteoporotic effect of combined extract of Morus alba and Polygonum odoratum. Oxid Med Cell Longev. 2014;2014:579305. doi: 10.1155/2014/579305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Takagishi Y, Kawakami T, Hara Y, Shinkai M, Takezawa T, Nagamune T(2006) Bone-like tissue formation by three-dimensional culture of MG63 osteosarcoma cells in gelatin hydrogels using calcium-enriched medium Tissue Eng 12:927–937. [DOI] [PubMed]
- Tanaka T, Onuma H, Shigihara T, Kimura E, Fukuta Y, Shirasaka N, Moriyama T, Homma Y. Anti-osteoporotic effects of syringic acid and vanilic acid in the extracts of waste beds after mushroom cultivation. J Biosci Bioeng. 2019;128(5):622–629. doi: 10.1016/j.jbiosc.2019.04.021. [DOI] [PubMed] [Google Scholar]
- Thu HE, Mohamed IN, Hussain Z, Shuid AN. Exploring molecular mechanism of bone-forming capacity ofEurycomalongifolia: evidence of enhanced expression of bone-related biomarkers. J Ayurveda Integr Med. 2018;9:272–280. doi: 10.1016/j.jaim.2017.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Toker H, Ozdemir H, Ozer H, Eren K. Alendronate enhances osseous healing in a rat calvarial defect model. Arch Oral Biol. 2012;57(11):1545–1550. doi: 10.1016/j.archoralbio.2012.06.013. [DOI] [PubMed] [Google Scholar]
- Ullah A, Anjum S, Masood A, Batool H, Kakar H, Shafique MA, Nadeem S, Ponya Z, Ismail T (2023) Nutritional prospects of some wild edible medicinal plants of district harnaibalochistan, pakistan. Food Sci. Technol 43.
- Van Houdt CI, Gabbai-Armelin PR, Lopez-Perez PM, Ulrich DJ, Jansen JA, Renno AC, van den Beucken JJ. Alendronate release from calcium phosphate cement for bone regeneration in osteoporotic conditions. Sci Rep. 2018;8:15398. doi: 10.1038/s41598-018-33692-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vijayan A, John JV, ParthipanB RC. Traditional remedies ofKani tribes of Kottoor reserve forest, Agasthyavanam, Thiruvananthapuram. Kerala Indian J Tradit Knowl. 2007;6:589–594. [Google Scholar]
- Wang J, Li H, Zhang T, Sun D, Lu W, Zhang W, Wang Y, Ma M, Cao X, Zhang B, Guo Y. Isolation and characterization of bovine bone collagen peptides with stimulatory effects on mineralization in osteoblasts. Food Chem Adv. 2023;3:100410. doi: 10.1016/j.focha.2023.100410. [DOI] [Google Scholar]
- Weyh C, Krüger K, Peeling P, Castell L. The Role of Minerals in the Optimal Functioning of the Immune System. Nutrients. 2022;14(3):644. doi: 10.3390/nu14030644. [DOI] [PMC free article] [PubMed] [Google Scholar]
- World Health Organization(2007) WHO guidelines for assessing quality of herbal medicines with reference to contaminants and residues 1–105, Geneva
- Xiao HH, Gao QG, Zhang Y, Wong KC, Dai Y, Yao XS, Wong MS. Vanillic acid exerts oestrogen-like activities in osteoblast-like UMR 106 cells through MAP kinase (MEK/ERK)-mediated ER signaling pathway. J Steroid BiochemMol Biol. 2014;144:382–391. doi: 10.1016/j.jsbmb.2014.08.002. [DOI] [PubMed] [Google Scholar]
- Zofkova I, Davis M, Blahos J (2017) Trace elements have beneficial, as well as detrimental effects on bone homeostasis.Physiol.Res 66:391–402 [DOI] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data that support the findings of this study are available on request.






