Skip to main content
NCBI home page
ACS Omega logoLink to ACS Omega
. 2024 Feb 22;9(9):10276–10285. doi: 10.1021/acsomega.3c07619

Strategies to Enhance l-Isoleucine Synthesis by Modifying the Threonine Metabolism Pathway in Escherichia coli

HaoJie Zhang †, Tong Ye †, Liu Fengmin †, Xiangjun Zhang ‡,†, Jipeng Wang †, Xiaobo Wei †, Yun Ping Neo §, Huiyan Liu †, Haitian Fang †,*
PMCID: PMC10918650  PMID: 38463329

Abstract

graphic file with name ao3c07619_0006.jpg

l-threonine as an important precursor substance of l-isoleucine and improving its accumulation in Escherichia coli became an important idea to construct a chassis strain with high l-isoleucine production. Meanwhile, the effect of l-threonine metabolic pathway disruption in E. coli for the improved production of l-isoleucine remains unrevealed. In the present study, a mutant strain of E. coli was engineered by inactivating specific metabolic pathways (e.g., Δtdh, ΔltaE, and ΔyiaY) that were associated with l-threonine metabolism but unrelated to l-isoleucine synthesis. This was done with the aim to reduce the breakdown of l-threonine and, thereby, increase the production of l-isoleucine. The results obtained demonstrated a 72.3% increment in l-isoleucine production from 4.34 to 7.48 g·L–1 in the mutant strain compared with the original strain, with an unexpected 10.3% increment in bacterial growth as measured at OD600. Transcriptome analysis was also conducted on both the mutant strain NXU102 and the original strain NXU101 in the present study to gain a comprehensive understanding of their physiological attributes. The findings revealed a notable disparity in 1294 genes between the two strains, with 658 genes exhibiting up-regulation and 636 genes displaying down-regulation. The activity of tricarboxylic acid (TCA) cycle-related genes was found to decrease, but oxidative phosphorylation-related genes were highly up-regulated, which explained the increased activity of the mutant strain. For instance, l-lysine catabolism-related genes were found to be up-regulated, which reconfigured the carbon flow into the TCA cycle. The augmentation of acetic acid degradation pathway-related genes assisted in the reduction in acetic acid accumulation that could retard cell growth. Notably, substantial up-regulation of the majority of genes within the aspartate pathway could potentially account for the increased production of l-isoleucine in the present study. In this paper, a chassis strain with an l-isoleucine yield of 7.48 g·L–1 was successfully constructed by cutting off the threonine metabolic pathway. Meanwhile, transcriptomic analysis revealed that the cutting off of the threonine metabolic pathway induced perturbation of genes related to the pathways associated with the synthesis of l-isoleucine, such as the tricarboxylic acid cycle, glycolysis, and aspartic acid pathway.

Introduction

l-isoleucine is referred to as a branched chain amino acid together with l-valine and l-leucine. It is a high-value-added amino acid with muscle repair function, which is also often used to treat cirrhosis, obesity, coma, and other conditions.1−4l-isoleucine has received much attention in recent years as a synthetic precursor for the antiglycolytic drug 4-hydroxyisoleucine.5,6 Fermentation is the primary method for industrial production of l-isoleucine; meanwhile, chemical synthesis and extraction from hair also play a key role in its production.7−9 Additionally, metabolic engineering of the l-isoleucine biosynthesis pathway in Corynebacterium glutamicum and E. coli has also been widely used for the industrial production of this amino acid.

As highlighted earlier, E. coli has been used for the production of l-isoleucine. Figure 1 shows the biosynthesis pathway, regulatory mechanism, and transport system of l-isoleucine in E. coli. Briefly, glucose will undergo a series of reactions to generate aspartic acid, followed by l-aspartic acid being sequentially converted to l-threonine through a five-step enzymatic reaction catalyzed by l-aspartate kinase (AK), aspartate semialdehyde dehydrogenase (ASD), high serine dehydrogenase (HDH), high serine kinase (HSK), and threonine synthase (TS). l-threonine is transformed into l-isoleucine via another five-step enzymatic reaction catalyzed by threonine dehydratase encoded by ilvA. In order to increase the accumulation of l-isoleucine, it becomes particularly important to attenuate the metabolism of its important precursor, l-threonine (Figure 1).

Figure 1.

Figure 1

Open in a new tab

l-isoleucine biosynthetic pathway in E. coli and strain modification idea/background.

At present, there are three established pathways for the degradation of threonine within E. coli cells. These three genes are tdh, which is responsible for encoding threonine 3-dehydrogenase, ltaE, which is responsible for encoding threonine aldolase, and yiaY, which is responsible for encoding l-threonine dehydrogenase. Notably, the gene encoded by tdh assumes a pivotal function in the process of threonine degradation.10,11 The elimination of this particular gene has been demonstrated to positively impact the augmentation of l-threonine. Another NAD-dependent threonine dehydrogenase encoded by the yiaY gene, along with knockdown of the ltaE gene encoding threonine aldolase, are also suggested to improve the l-threonine production,12,13 whereas the ilvA and tdcB genes encoding threonine dehydratase play important roles in l-isoleucine production.14,15 Numerous researchers have shown that in E. coli, a single knockdown of nonessential genes such as yiaY, tdh, and ltaE that are related to the threonine metabolic pathway contribute to the l-threonine production. As a result, we boldly chose to knock down these three genes simultaneously in the current study to fully understand their effects on the physiological properties of the bacterium itself.

To improve the production of l-isoleucine, we constructed a mutant strain with Δtdh, ΔltaE and ΔyiaY by knocking out genes related to threonine degradation using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (CRISPR/Cas9) gene editing technology. The mutant strain exhibited an augmentation in the synthesis of l-isoleucine, which was accompanied by a corresponding enhancement in the bacterial growth activity. We elucidated the effect of inactivation of the threonine metabolic pathway on the genetic characteristics of E. coli using transcriptomics, which further showed that the inactivated pathway had increased energy metabolism and a carbon flow bias toward l-isoleucine. We found that the mutant strain E. coil NXU102 l-isoleucine production was higher than the starting strain E. coil NXU101 (72.3%), while the biomass (OD600) was higher than the starting strain (10.3%). These results suggested that attenuating the l-threonine metabolic pathway could serve as one of the strategies to construct l-isoleucine high-yielding production strains.

Materials and Methods

Strains, Plasmids, and Reagents

All strains, plasmids, and primers used in this study are listed in Tables 1 and 2. The recombinant E. coli NXU101 (ΔLeuA, Met– + Lys–) strain constructed previously in our laboratory was used as the starting strain,16 while E. coli DH5α was used for cloning and plasmid construction. All bacterial strains were grown in an LB liquid medium or on an LB agar plate at 37 °C. The OPA derivatization reagent was prepared by dissolving 0.2014 g of OPA in 10 mL of methanol, and the solution was transferred to a 50 mL amber volumetric flask. Approximately 10 mL of β-mercaptoethanol was added to the flask, and the final volume was made up to 50 mL using methanol. For the preparation of pH 10.4 borate buffer, 6.19 g of boric acid and 6.52 g of KOH were dissolved in 200 mL of ultrapure water, and the solution pH was adjusted to 10.4 using metaphosphoric acid.

Table 1. Sources and Characteristics of Strains and Plasmids Used in This Study.

strains relevant characteristics sources
E. coli K12 MG1655 wild type laboratory collection16
E. coli NXU101 MG1655, ΔleuA/Met– + Lys laboratory collection16
E. coli NXU102 MG1655, ΔleuA/Met– + Lys–/Δtdh/ΔltaE/ΔyiaY this study
plasmids    
pCas repA101(Ts) kan Pcas-Red lacIqPtcr-sgRNA-pMB1 this study
pTargetF pMB1 aadA sgRNA this study
pTargetF-tdh pMB1 aadA sgRNA-tdh this study
pTargetF-ltaE pMB1 aadA sgRNA-ltaE this study
pTargetF-yiaY pMB1 aadA sgRNA-yiaY this study
Open in a new tab

Table 2. Primers Used in This Experiment.

primers primer sequences (5′–3′)
gRNA-tdh-S CTGGTGAAAAAGGCTCCAA
gRNA-tdh-A CGTCATTGGGACCAACAGG
tdh-up-S AGATAAAAGGGCTGGAATACCAGCCCTTGTTCGTGTTAATCCCAG
CTCAGCATATGAATATCCTCCTTAGTTCCTATTC
tdh-down-A GTAAACAACTGGGCGTTATCGCCTGAGGATGTGAGATGAAAGCG
TTATCCGAGCTGCTTCGAAGTTCCTA
tdh-outF CAGGTGAGAGAGTCACTTCAGGG
tdh-outR CGGTTTCTTCTATCCGGTCGTTC
gRNA-ltaE-S GTCAAGATGCGTCACCAGG
gRNA-ltaE-A GACGTCTCGCGCGAACAAC
ItaE-up-S GTTGCGGCACGTCTCTCTCCTTAACGCGCCAGGAATGCACGCCA
GTGGGCGAGCTGCTTCGAAGTTCCTA
ItaE-down-A AAGGGTGGCATTTCCCGTCATAATAAGGACATGCCATGATTGATT
TACGCCATATGAATATCCTCCTTAGTTCCTATTC
ItaE-outF GTTGCAGCTTTGCAAGCCTGTC
ItaE-outR CATTCCACCGCAGATCAAACTCGAAC
gRNA-tdh-S ATCGGGTTAGTAAAGCCAC
gRNA-tdh-A GTGAAAGAAGAAGATTTCG
yiaY-up-S GATAGTTGAAAAAGCGGCTAACAATTTGCCAGCCGTTGTGGAA
ATGATGACATATGAATATCCTCCTTAGTTCCTATTC
yiaY-down-A AAAATCCTCAGTAAGCTGCCCGCCCTTTTTTACACTTTCAGGAG
TGTGTTGAGCTGCTTCGAAGTTCCTA
yiaY-outF GTGTGAGGTATAACAAGGGTAGA
yiaY-outR GATAATCAATAATACTGATCATATTTTCGAATG
Open in a new tab

Culture Medium and Culture Conditions

The strains were cultivated in LB medium, which consisted of 10 g of tryptone, 5 g of yeast extract, and 5 g of NaCl per liter. The pH of the medium was adjusted to 7.0 using 1 mol·L–1 NaOH. To solidify the medium, 1.5% (w/v) agar powder (Wako Pure Chemical Co., Ltd., Osaka, Japan) was added prior to autoclaving at 121 °C for 20 min. The defined medium for seed cultivation in the present study contained 5.0 g of glucose, 10.0 g of tryptone, 2.0 g of (NH4)2SO4, 5.0 g of yeast powder, and 0.002 g of biotin per liter (Tianjin Damao Chemical Reagent Co. Ltd., Tianjin, China). The fermentation medium for l-isoleucine production contained 110.0 g of glucose, 21.0 g of corn pulp, 2.0 g of KH2PO4, 3.0 g of K2HPO4, 2 g of lysine, 20.5 g of (NH4)2SO4, 0.01 g of FeSO4 and 2.0 g of MgSO4 per liter (Tianjin Damao Chemical Reagent Co. Ltd., Tianjin, China). The pH of both the seed and the fermentation media was adjusted to 7.0 using a 4.0 mol·L–1 NaOH solution.

The mutant strain NXU102 and the starting strain NXU101 were inoculated onto the LB solid medium and incubated overnight at 37 °C. Then, single colonies of each strain were picked from the LB solid medium, inoculated into seed medium, sealed with sterile gauze, and incubated at 37 °C for 12 h in a shaker at 200 rpm. Finally, the fermentation incubation was carried out under the same conditions for 40 h.

Genome Editing

Genetic deletion was performed by using the CRISPR/Cas9 system. The procedure has been described using tdh knockout as an example in this section. First, a gRNA expression plasmid (pTargetF-tdh) was constructed by using the pTargetF plasmid as a template and gRNA-tdh-S and gRNA-tdh-A as primers. Donor DNA fragments for the tdh deletion were prepared. Two pairs of primers, tdh-up-S and tdh-down-A, were used to amplify upstream homologue arm M1 and downstream homologue arm M2. Second, M1 and M2 were ligated via overlapping extension PCR, generating a donor DNA fragment (DNA-tdh). Third, pTargetF-tdh and DNA-tdh were cotransformed into E. coli NXBG-11–3 competent cells containing a pCas plasmid via electrotransformation. The incubated bacterial suspension was spread on LB plates with kanamycin and chloramphenicol to confirm the presence of the pTargetF-tdh and pCas plasmids. Positive colonies were validated using colony PCR, and mutations were confirmed through DNA sequencing. Then, positive colonies verified by PCR were inoculated in LB medium containing kanamycin and IPTG and cultured overnight at 42 °C to destroy the temperature-sensitive pCas plasmid of the mutant. The appropriate tdh knockout strain was obtained by PCR verification. Finally, the appropriate tdh knockout strain was obtained by PCR verification.

Analytical Methods

Cell density was monitored by measuring the absorbance at 600 nm by using a V-5100 ultraviolet spectrophotometer (Metash, Shanghai, China). The concentration of residual glucose in the fermentation medium was detected by using a biosensor analyzer (SBA-40E, Shandong, China). The content of l-isoleucine in the fermentation medium was measured using high-performance liquid chromatography (HPLC) (UFLC0303062304, Shimadzu, Japan) on an Agilent C18 column (4.6 mm × 250 mm, 5 μm, Agilent, Shanghai, China) at 30 °C, with mobile phase consisting of acetonitrile/water at a flow rate of 1.0 mL·min–1. Approximately 20 μL of fermentation broth supernatant was measured, and 20 μL of an internal reference solution (ultrapure water or 10 μmol·L–1 l-isoleucine standard solution) was added to the broth supernatant, followed by 10 μL of the OPA derivatization reagent after thorough mixing. The derivatization reaction was carried out for 2 min and was immediately diluted to 100 μL with a 1:9 mixture of anhydrous ethanol and borate buffer solution. An HPLC injection volume for all samples was 20 μL. All data were expressed as the mean ± standard deviation of three replicates.

Whole-Genome Transcriptional Analysis

The starting strain E. coli NXU101 and the mutant strain NXU102 were inoculated in LB liquid medium, and the precipitates of the log phase (OD600 value of 0.8–1.0) were collected, snap-frozen in liquid nitrogen, and stored at −80 °C.

Total RNA was extracted from E. coli NXU101 and the mutant strain using TRNzol Universal Reagent (DP424, Tiangen Biotech (Beijing) Co., Ltd.) according to the manufacturer’s instructions. The concentration and purity of RNA were detected using a Nano Drop 2000 microspectrophotometer, RNA integrity was detected through agarose gel electrophoresis, and RQN values were analyzed with an Agilent 5300 Fragment Analyzer (Agilent, Technologies, CA). The RNA samples were sent to Majorbio (Shanghai, China) for transcriptome sequencing using the Illumina HiSeq-4000 sequencing platform. The genome of E. coli K-12 MG1655 (NC_000913.3) was used as the reference genome to assemble and analyze the RNA-seq data. Differentially expressed genes (DEGs) were functionally annotated by using the public Kyoto Encyclopedia of Genes and Genomes (KEGG) and gene ontology (GO) databases.

The expression levels of genes and transcripts were quantified using the quantitative software RSEM with TPM. After obtaining read counts of the genes, DESeq2, DEGseq, and edgeR were used to analyze the differential expression of genes between samples and between groups. Genes, in which the P-value and FDR (q-value) were lesser than 0.05 and the amount of change in expression was greater than 2-fold, were identified as significantly differentially expressed (PRJNA990347).

Results

Construction of the Mutant Strain NXU102

The results of the tdh, ltaE, and yiaY gene knockout by CRISPR gene-editing technology are shown in Figures S1–S3. The length of the starting strain amplification products was found to be 1567, 1106, and 1567 bp, respectively, when PCR was performed with primer pairs on the outer side of the genome homologous arms. The length of the amplification products for these primers was reduced to 405, 416, and 306 bp when the tdh, ltaE, and yiaY genes were knockout, respectively.

Mutant Strain NXU102 Shake Flask Fermentation Culture

The biomass and glucose consumption by the starting strain E. coli NXU101 and the mutant strain NXU102 were measured, and the results are displayed in Figure S1. The growth trends of the mutant strain and the starting strain were basically the same for the first 10 h. After 10 h, the two strains demonstrated different growth states, where the mutant strain NX102 continued to accumulate, while the starting strain NX101 began to stabilize. Surprisingly, sugar consumption of the mutant strain did not change significantly compared to the starting strain E. coli NXU101. Overall, the resulting mutant strain NXU102 exhibited the highest final glucose consumption of 106.7 ± 0.2 g·L–1 and a maximum cell density of 0.862 ± 0.008 at OD600 (the OD value was reduced by a factor of 10 to better represent the data in this study). On the other hand, the resulting starting strain E. coli NXU101 exhibited the highest final glucose consumption of 110.2 ± 0.2 g·L–1 and a maximum cell density of 0.781 ± 0.008 at OD600. Both the E. coli NXU101 starting strain and the NXU102 mutant strain were fermented simultaneously, and the supernatant samples were centrifuged for the determination of l-isoleucine yields. Interestingly, the amount of l-isoleucine produced by E. coli NXU101 was 4.34 ± 0.08 g·L–1 while the mutant strain NXU102 was 72.3% higher than the starting strain at 7.48 ± 0.01 g·L–1 after 40 h of fermentation (Figure 2).

Figure 2.

Figure 2

Open in a new tab

Comparison of batch fermentation results of the mutant strain NXU102 (A) and the starting strain E. coli NXU101 (B). Error bars represent standard deviations from three parallel replicates.

Transcriptional Analysis of E. coli NXU101 and E. coli NXU102

Transcriptome sequencing was performed on the starting strain E. coli NXU101 and the mutant strain NXU102 from distinct groups in this study. Subsequently, the expression matrices were assembled based on the original sequencing outcomes, where the expression matrix of the mutant strain NXU102 was investigated and analyzed. The reliability of the subsequent differentially expressed genes (DEGs) was confirmed through the examination of expression distribution (Figure 3A), sample correlation (Figure 3B), and PCA analysis (Figure 3D). Venn analysis among the samples revealed that there were 100 specifically expressed genes in group A and 183 specifically expressed genes in group C. The volcano map of differential expression showed up to 1294 DEGs between the starting strain E. coli NXU101 and the mutant strain NXU102 (Figure 3E). Among them, a total of 658 genes were up-regulated, and 636 were down-regulated. The DEGs identified in this study underwent further bioinformatics analysis to determine their functional characteristics. This analysis included COG classification, GOG enrichment analysis, and histogram of KEGG. The COG classification results indicated that 152 genes/transcripts within this gene set that correspond to 9.6% of the total DEGs were classified as poorly characterized. Despite this, 47.6% of the DEGs were classified as metabolism category that was involved in the metabolic pathways (Figure 3G), including 173 DEGs, which were annotated to “carbohydrate transport and metabolism,” 132 DEGs, which were annotated to “energy production and conversion,” and 141 DEGs, which were annotated to “amino acid transport and metabolism” (Figure 3F). Figure 3H shows the GO analysis that revealed the top 20 most enriched GO terms on the basis of the P-value (P = 0), where reductase activity, acting on CH or CH2 groups, and NAD or NADP as acceptor were found to be the important pathway.

Figure 3.

Figure 3

Open in a new tab

Alterations of E. coli gene expression induced by inactivation of the threonine metabolic pathway, where A is E. coli NXU101 and C is the mutant strain E. coli NXU102. (A) Boxplot indicated the gene expression distribution of each sample. (B) Plot indicated a correlation between biological repetitions. (C) Análisis del diagrama de Ven de los genes expresados diferencialmente (D) PCA (principal component analyses) of the mutant strain NXU102 gene expression profiles. PC1, principal component 1; PC2, principal component 2. Explained variants PC1:86.09% and PC2:7.86%. (E) Volcano plot of the up- and down-regulated genes by the mutant strain NXU102. (F) COGs (clusters of orthologous groups) function classification figure; C: energy production and conversion; D: cell cycle control, cell division, chromosome partitioning; E: amino acid transport and metabolism; F: nucleotide transport and metabolism; G: carbohydrate transport and metabolism; H: coenzyme transport and metabolism; I: lipid transport and metabolism; J: translation, ribosomal structure, and biogenesis; K: transcription; L: replication, recombination, and repair; M: cell wall/membrane/envelope biogenesis; N: cell motility; O: posttranslational modification, protein turnover, chaperones; P: inorganic ion transport and metabolism; Q: secondary metabolites biosynthesis, transport, and catabolism; R: general function prediction only; S: function unknown; T: signal transduction mechanisms; U: intracellular trafficking, secretion, and vesicular transport; V: defense mechanisms; W: extracellular structures; X: mobilome; and Z: cytoskeleton. (G) KEGG categories indicated significantly enriched functions for DEGs: the starting strain E. coli NXU101 vs the mutant strain NXU102. Genes were divided into six branches according to the biological pathways they participated in metabolism, genetic information processing, environmental information processing, cellular processes, organismal systems, and human diseases. (H) Top-ranked GO (gene ontology) terms of the DEGs (differentially expressed genes): the starting strain E. coli NXU101 vs the mutant strain NXU102. The size of each bubble reflects the number of DEGs assigned to the GO terms.

The heat map in Figure 4A shows 3 metabolic pathways of amino acids including histidine metabolism, lysine degradation, and phenylalanine metabolism. Figure 4C shows that 9 DEGs belong to the lysine degradation, including patD, gabD, lhgD, gabT, ldcC, patA, atoB, glaH, and atoA. The pathways in Figure 4B,D show that 4 DEGs belong to the TCA cycle, including sdhD, sdhC, pck, and aceE. Figure 4C,D shows the difference of related pathways for the DEGs according to their log2 fold change values (Log2 fc). The most relevant lysine catabolic pathway was analyzed, and a significant amount of genes in the lysine to succinate pathway were up-regulated, which might lead to high carbon flow to the TCA cycle.

Figure 4.

Figure 4

Open in a new tab

Detailed analysis of the enriched KEGG pathway involved l-isoleucine production and gene sets. (A) Circos plots with interdependence between selected KEGG pathways and their up-regulated genes. (B) Circos plots with interdependence between selected KEGG pathways and their down-regulated genes. (C) Up-regulated genes in genes related to lysine degradation and description. (D) Genes associated with the TCA cycle in down-regulated genes and description. (E) Expression of lysine degradation-related genes in the pathway.

Genes related to l-isoleucine metabolism showing KEGG enrichment were further analyzed in the present study (Figure 5). The transcription levels of ptsG and murP genes participating in PTS were significantly up-regulated. Among the genes associated with the glycolytic pathway (EMP), glpX, yggF, pfk, fbaB, gpmA, ptsGH, and pykA were significantly up-regulated, while pgi was significantly down-regulated. The transcription levels of aceAB, sdhABCD, and sucB genes that were involved in the TCA cycle were significantly down-regulated, while mdh, acnA, and fumD were significantly up-regulated. Interestingly, phosphoenolpyruvate to oxaloacetate-related genes, such as ppc and pck, were down-regulated by 0.9- and 0.2-fold, respectively. In comparison, ppc (the gene encoding phosphoenolpyruvate carboxylase) might be more strongly expressed, which was useful to improve the yield of the target product in this study. In the group of the genes participating in the l-isoleucine synthesis pathway, aspC, asd, thrBC, and ilvAE showed significant up-regulated transcription levels, while ilvB exhibited down-regulated transcription levels. One of them, ilvA, encoded a threonine dehydratase, which is the key enzyme for the production of l-isoleucine from l-threonine after the 5-step reaction. Similarly, a 2.4-fold upregulation of aspC (the gene encoding aspartate aminotransferase) also greatly increased carbon flow to the aspartate pathway. It was unexpected to observe the poxB gene to be down-regulated by 0.003-fold for encoding the pyruvate dehydrogenase, while the adhP and aldB genes were significantly up-regulated, which would lead to a redistribution of the carbon flow. The pta gene, which is related to acetyl coenzyme degradation, was found to be up-regulated by 1.2-fold, while the ackA gene, which is related to the ATP production in this pathway, was down-regulated by 0.9-fold. Nevertheless, such changes might not have a significant impact on the overall ATP supply compared with the down-regulation of other genes. Although a large number of genes in the TCA cycle were down-regulated, a great amount of genes participating in the EMP and oxidative phosphorylation pathways were also found to be up-regulated. In particular, the upregulation of genes related to NADPH and ATP production might be responsible for the enhanced activity of the mutant strains. A reduced accumulation of the byproduct acetic acid in the biosynthetic pathway had lowered its detrimental effect on the bacterium and was thus beneficial to the normal growth of the bacterium. At the same time, by cutting off the degradation pathway of l-threonine, the accumulation of l-threonine was enhanced and the carbon flow was redirected to the l-isoleucine metabolic pathway.

Figure 5.

Figure 5

Open in a new tab

Transcriptional differences in related genes between the departure strain NXU101 and the mutant strain NXU102. The number in parentheses is the ratio of the average value of the mRNA fragments of a gene in E. coli NXU102 to that in E. coli NXU101. Red indicates a significant increase in transcription, and green indicates a significant decrease in transcription.

Discussion

l-isoleucine is widely used in the food industry, biomedicine, and cosmetics with high added value. Therefore, it is urgent to construct a chassis strain with a high production of l-isoleucine, which is an important precursor of l-isoleucine, and we aim to increase the accumulation of l-isoleucine by cutting off its metabolic pathway. We analyzed the transcriptome of the strain to further understand its physiological properties and to provide ideas for the construction of l-isoleucine chassis strains.

l-isoleucine is mainly produced by microbial fermentation, with E. coli and C. glutamicum being the main production strains.2,17E. coli usually synthesizes high levels of acetate, which may affect the production of l-isoleucine by inhibiting cell growth and protein production.18 However, the biosynthesis of l-isoleucine in E. coli can be improved by optimizing the fermentation process or by knocking out genes related to acetate production. Although the yield of current shake flask fermentation using E. coli at 12 g·L–1 is lower than the yield of l-isoleucine in C. glutamicum at 32 g·L–1,19 the E. coli genome is more well-characterized compared with C. glutamicum. Further, several tools have been developed for the cytogenetic manipulation of E. coli.20

In this study, genes related to the l-threonine degradation (Δtdh, ΔltaE, ΔyiaY) were knocked out using CRISPR/Cas9 gene editing technology to obtain the E. coli NXU102 mutant strain. The yield of l-isoleucine in this mutant strain was found to be 7.48 g·L–1, demonstrating good genetic stability and stable l-isoleucine production. At the same time, it is important to fully understand the effect of genetic changes in the mutant strain on the l-isoleucine synthesis pathway through transcriptomics. An analysis of DEG transcript levels in the relevant pathways could also provide a deeper mechanistic insight into further strain modification.

Transcriptional analysis of the mutant strain NXU101 showed that DEGs were mainly enriched in the l-isoleucine synthesis pathways, such as oxidative phosphorylation, TCA cycle, phosphotransferase system, and amino acid metabolism. The EMP pathway, the PPP pathway, and the TCA cycle generate precursors and energy required for the synthesis of l-isoleucine.21,22 In the mutant strain NXU101, ptsG and murP gene expressions were up-regulated, implying that more glucose had entered the E. coli cells through the phosphotransferase system.23 It is important to highlight again that the EMP pathway, the PPP pathway, and the TCA cycle are key pathways for the synthesis of the l-isoleucine precursor, such as oxaloacetate, aspartate, and NADPH,24 and the TCA cycle is a major pathway in microbial oxidative metabolism. The sdhABCD genes encode four subunits of succinate dehydrogenase, whose expression was found to be down-regulated in the mutant strain NXU101 in this study.25 This might lead to a blockage of succinate in the TCA cycle.26 Interestingly, the fumD and mdh genes were significantly up-regulated and were able to direct the carbon flow toward oxaloacetate to enhance the production of bulk biochemicals. On the other hand, the EMP pathway is a fundamental biochemical infrastructure of carbohydrate metabolism in E. coli, providing ATP for cell growth and metabolism whereby cells are able to produce ATP through phosphorylation of the EMP pathway substrates. Studies have shown that hypoxia may lead to the upregulation of EMP pathway genes, and the EMP pathway can still provide energy to support microbial growth when the TCA cycle is inhibited. In this study, an increased transcript level of the key EMP pathway genes (e.g., glpX, yggF, pfk, fbaB, gpmA, ptsGH, and pykA) was found to be able to maintain normal microbial growth.

In E. coli, the detrimental effects of high levels of acetate are limiting the bacteria’s growth. Simen Akkermans et al. investigated the effect of pH on the growth of E. coli K12 MG1655 using a γ-interaction model and showed that the growth rate and maximum cell density increased as the pH reached 7.0.27 In this study, the poxB gene was significantly down-regulated in the mutant strain NXU101, which might be responsible for the enhanced growth activity and increased production of l-isoleucine in E. coli. By overexpressing the yggE gene, Yoshihiro Ojima et al. found that the expression levels of the acetic acid production gene (e.g., pta, ackA, and poxB) were relatively low, especially the expression level of poxB that was one-seventh of the original strain, and the acetic acid yield in culture fermentation was only half of the original strain.28 Meanwhile, the transcript levels of the aldB and adh genes were significantly up-regulated, probably due to the reduction of acetic acid production/accumulation.

Phosphoenolpyruvate carboxylase (encoded by the ppc gene) and phosphoenolpyruvate carboxykinase (encoded by the pck gene) were both down-regulated in E. coli under glycolytic conditions. The known functions of the pck gene are the decarboxylation of oxaloacetate under gluconeogenic conditions and ATP exclusion for the metabolic balance of cells.29 This might be due to the up-regulation of a large number of genes in the EMP pathway of the mutant strain, which resulted in a reduction in the pck gene expression. By constructing E. coli that expressed natural pck and ppc genes under the same promoter control, studies found that the natural pck gene activity was 160-fold lower than the ppc gene,30 which explained the higher expression of the ppc gene compared with the pck gene in the mutant strain. Peng et al. constructed a ppc mutant and found reduced acetate and CO2 excretion in the mutant using metabolic flux analysis C13 labeling experiments, while TCA cycle-related genes were up-regulated and glycolytic together with pentose phosphate pathways were down-regulated. The concentrations of acetyl coenzyme A and oxaloacetate were also decreased in the ppc mutant.31 Similar to Peng et al., ppc gene expression in the mutant strains was also down-regulated in this study, which is in surprising agreement with his contrary description. Meanwhile, NAD (+)-dependent malate dehydrogenase as encoded by the mdh gene is an energy supply enzyme that catalyzes the interconversion of malate and oxaloacetate and plays a key role in several metabolic pathways including the TCA cycle.

The ilvA gene that encodes threonine deaminase was significantly up-regulated in the present study, and the enzyme was resistant to feedback inhibition by l-isoleucine. By introducing the ilvA gene into wild Bacillus flavus, Hashiguchi et al. constructed a mutant strain capable of converting exogenous L-homoserine and l-threonine to l-isoleucine, and the transformants had obtained a high accumulation of l-isoleucine.32 Guillouet et al. found that overexpression of the ilvA gene in C. glutamicum was able to increase the yield of l-isoleucine by 50-fold, whereas overexpression of the tdcB gene increased the target product by only 4-fold. It was also noticed that 70% of the carbon available in the lysine pathway was redirected to l-isoleucine when the ilvA gene was overexpressed.14 This is consistent with the current finding that observed the upregulation of the ilvA gene was accompanied by significant upregulation of the l-lysine degradation pathway-related genes, such as patD, gabD, lhgD, gabT, ldcC, patA, atoB, glaH, and atoA, allowing the degradation of lysine to succinate that re-entered the TCA cycle.

E. coli NXU101 (ΔLeuA, Met-+Lys-) with an l-isoleucine yield of 4.34 g·L–1 served as the starting strain in this study. The mutant strain NXU102 was successfully constructed by cutting off the l-threonine catabolic pathway through the CRISPR/Cas9 gene editing technology. The yield of l-isoleucine was 7.48 g·L–1, which was 72.3% higher than the starting strain E. coli NXU101, and the activity was found to be 10.3% higher than the starting strain. In order to fully understand the altered genetic characteristics of the mutant strains and to prepare for further genetic modification, transcriptome analysis of the starting and mutant strains was conducted. The results of the transcriptome analysis indicated that genes related to the EMP pathway were up-regulated, which facilitated energy production and strain activity. On the other hand, genes related to the detrimental byproduct acetate degradation pathway were up-regulated, but the production genes were down-regulated, which is beneficial for energy production as well as the activity of the strain theoretically. Similarly, the poxB gene was down-regulated to 0.003-fold, which reduced the byproduct production, whereas the aspC gene up-regulated to 2.4-fold, which promoted the flow of oxaloacetate to l-aspartate and facilitated the synthesis of l-isoleucine precursors. Up-regulation of the ilvA gene by 1.4 enhanced l-threonine metabolism to produce l-isoleucine. Therefore, the mutant strain NXU102 showed a significant increase in its activity and l-isoleucine production, which provides insights for the construction of an l-isoleucine-producing engineered strain of E. coli, whereby a high-quality chassis strain can be harvested.

Data Availability Statement

All the data supporting the findings of this study are available within the article and its Supporting Information files. Data is available on request from the authors. The data that support the findings of this study are available from the corresponding author, [H.T.F], upon reasonable request.

Supporting Information Available

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.3c07619.

  • Knockout results of this experiment (PDF)

Author Contributions

Conceptualization, H.J.Z., H.T.F., and H.Y.L.; methodology, H.T.F.; H.J.Z., and F.-M. L.; software, H.J.Z., T.Y., and C.M.; formal analysis, H.Y.L. and H.T.F.; original draft preparation, H.J.Z.; review and editing, H.T.F., X.B.W., and Y.P.N; supervision and administration, H.T.F and H.Y.L; and funding acquisition, H.T.F. and H.Y.L. All authors have read and agreed to the published version of the manuscript.

This research was supported by the Natural Science Foundation of Ningxia (2020AAC03100); the Innovation Platform Funds of Ningxia Key Laboratory for Food Microbial-Applications Technology and Safety Control (2021DPC05003); and the Youth Science and Technology Innovation Personnel Training Project of Ningxia.

The authors declare no competing financial interest.

Supplementary Material

ao3c07619_si_001.pdf (773.9KB, pdf)

References

  1. Gu C. S.; Mao X. B.; Chen D. W.; Yu B.; Yang Q. Isoleucine Plays an Important Role for Maintaining Immune Function. Curr. Protein Pept. Sci. 2019, 20, 644–651. 10.2174/1389203720666190305163135. [DOI] [PubMed] [Google Scholar]
  2. Becker J.; Giesselmann G.; Hoffmann S. L.; Wittmann C. In Corynebacterium glutamicum for Sustainable Bioproduction: From Metabolic Physiology to Systems Metabolic Engineering; Zhao H.; Zeng A. P.. 2018; Vol. 162. [DOI] [PubMed]
  3. Li Y.; Wei H.; Wang T.; Xu Q.; Zhang C.; Fan X.; Ma Q.; Chen N.; Xie X. Current status on metabolic engineering for the production of L-aspartate family amino acids and derivatives. Bioresour. Technol. 2017, 245, 1588–1602. 10.1016/j.biortech.2017.05.145. [DOI] [PubMed] [Google Scholar]
  4. Lu S.; Tao T.; Su Y. T.; Hu J.; Zhang L.; Wang G. L.; Li X. Y.; Guo X. H. Whole Genome Sequencing and CRISPR/Cas9 Gene Editing of Enterotoxigenic Escherichia coli BE311 for Fluorescence Labeling and Enterotoxin Analyses. Int. J. Mol. Sci. 2022, 23, 7502 10.3390/ijms23147502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Korthikunta V.; Pandey J.; Singh R.; Srivastava R.; Srivastava A. K.; Tamrakar A. K.; Tadigoppula N. In vitro anti-hyperglycemic activity of 4-hydroxyisoleucine derivatives. Phytomedicine 2015, 22, 66–70. 10.1016/j.phymed.2014.09.007. [DOI] [PubMed] [Google Scholar]
  6. Zhang C. L.; Ma J.; Li Z. X.; Liang Y. L.; Xu Q. Y.; Xie X. X.; Chen N. A strategy for L-isoleucine dioxygenase screening and 4-hydroxyisoleucine production by resting cells. Bioengineered 2018, 9, 72–79. 10.1080/21655979.2017.1304872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. D’Este M.; Alvarado-Morales M.; Angelidaki I. Amino acids production focusing on fermentation technologies - A review. Biotechnol. Adv. 2018, 36, 14–25. 10.1016/j.biotechadv.2017.09.001. [DOI] [PubMed] [Google Scholar]
  8. Dong X. Y.; Zhao Y.; Zhao J. X.; Wang X. Y. Characterization of aspartate kinase and homoserine dehydrogenase from Corynebacterium glutamicum IWJ001 and systematic investigation of L-isoleucine biosynthesis. J. Ind. Microbiol. Biotechnol. 2016, 43, 873–885. 10.1007/s10295-016-1763-5. [DOI] [PubMed] [Google Scholar]
  9. Yamamoto K.; Tsuchisaka A.; Yukawa H. In Branched-Chain Amino Acids. Adv Biochem Eng Biotechnol, 2017, 10; Vol. 159. [DOI] [PubMed] [Google Scholar]
  10. Yu H.; Xu J.; Liu L.; Zhang W. [Biosynthesis of 2,5-dimethylpyrazine from L-threonine by whole-cell biocatalyst of recombinant Escherichia coli]. Sheng Wu Gong Cheng Xue Bao = Chinese Journal of Biotechnology 2021, 37, 228–241. [DOI] [PubMed] [Google Scholar]
  11. Lee K. H.; Park J. H.; Kim T. Y.; Kim H. U.; Lee S. Y.. Systems metabolic engineering of Escherichia coli for L-threonine production. Mol. Syst. Biol. 2007, 3. [DOI] [PMC free article] [PubMed]
  12. Vybornaya T. V.; Yuzbashev T. V.; Fedorov A. S.; Bubnov D. M.; Filippova S. S.; Bondarenko F. V.; Sineoky S. P. Use of an Alternative Pathway for Isoleucine Synthesis in Threonine-Producing Strains of Escherichia coli. Appl. Biochem. Microbiol. 2020, 56, 759–769. 10.1134/S0003683820070066. [DOI] [Google Scholar]
  13. Liu J. Q.; Dairi T.; Itoh N.; Kataoka M.; Shimizu S.; Yamada H. Gene cloning, biochemical characterization and physiological role of a thermostable low-specificity L-threonine aldolase from Escherichia coli. Eur. J. Biochem. 1998, 255, 220–226. 10.1046/j.1432-1327.1998.2550220.x. [DOI] [PubMed] [Google Scholar]
  14. Guillouet S.; Rodal A. A.; An G. H.; Lessard P. A.; Sinskey A. J. Expression of the Escherichia coli catabolic threonine dehydratase in Corynebacterium glutamicum and its effect on isoleucine production. Appl. Environ. Microbiol. 1999, 65, 3100–3107. 10.1128/AEM.65.7.3100-3107.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Chen L.; Chen Z.; Zheng P.; Sun J. B.; Zeng A. P. Study and reengineering of the binding sites and allosteric regulation of biosynthetic threonine deaminase by isoleucine and valine in Escherichia coli. Appl. Microbiol. Biotechnol. 2013, 97, 2939–2949. 10.1007/s00253-012-4176-z. [DOI] [PubMed] [Google Scholar]
  16. Zhiyu Ai Thesis, 2022.
  17. Park J. H.; Lee S. Y. Metabolic pathways and fermentative production of L-aspartate family amino acids. Biotechnol. J. 2010, 5, 560–577. 10.1002/biot.201000032. [DOI] [PubMed] [Google Scholar]
  18. DAGLEY S.; DAWES E. A.; FOSTER S. M. Effect of pH on growth of Aerobacter aerogens and Escherichia coli in synthetic media. Biochem. J. 1952, 52, xxi–xxii. [PubMed] [Google Scholar]
  19. Wang X. Strategy for improving L-isoleucine production efficiency in Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2019, 103, 2101–2111. 10.1007/s00253-019-09632-2. [DOI] [PubMed] [Google Scholar]
  20. Chang Y.; Su T.; Qi Q.; Liang Q. Easy regulation of metabolic flux in Escherichia coli using an endogenous type I-E CRISPR-Cas system. Microb. Cell. Fact. 2016, 15, 195. 10.1186/s12934-016-0594-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Seol E.; Sekar B. S.; Raj S. M.; Park S. Co-production of hydrogen and ethanol from glucose by modification of glycolytic pathways in Escherichia coli- from Embden-Meyerhof-Parnas pathway to pentose phosphate pathway. Biotechnol. J. 2016, 11, 249–256. 10.1002/biot.201400829. [DOI] [PubMed] [Google Scholar]
  22. Murarka A.; Clomburg J. M.; Moran S.; Shanks J. V.; Gonzalez R. Metabolic Analysis of Wild-type Escherichia coli and a Pyruvate Dehydrogenase Complex (PDHC)-deficient Derivative Reveals the Role of PDHC in the Fermentative Metabolism of Glucose*. J. Biol. Chem. 2010, 285, 31548–31558. 10.1074/jbc.M110.121095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kim H. J.; Jeong H.; Lee S. J. Glucose Transport through <i>N</i>-Acetylgalactosamine Phosphotransferase System in <i>Escherichia coli</i> C Strain. J. Microbiol. Biotechnol. 2022, 32, 1047–1053. 10.4014/jmb.2205.05059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Zhu Y.; Du S.; Yan Y.; Pan F.; Wang R.; Li S.; Xu H.; Luo Z. Systematic engineering of Bacillus amyloliquefaciens for efficient production of poly-γ-glutamic acid from crude glycerol. Bioresour. Technol. 2022, 359, 127382 10.1016/j.biortech.2022.127382. [DOI] [PubMed] [Google Scholar]
  25. Xia H. H.; Zhu N. Q.; Wang Z. W.; Chen T. In PROCEEDINGS OF THE 2012 INTERNATIONAL CONFERENCE ON APPLIED BIOTECHNOLOGY (ICAB 2012), VOL 1; Zhang T. C.; Ouyang P.; Kaplan S.; Skarnes B., Eds.; International Conference on Applied Biotechnology (ICAB), 2014; Vol. 249. [Google Scholar]
  26. Dauner M.; Bailey J. E.; Sauer U. Metabolic flux analysis with a comprehensive isotopomer model in Bacillus subtilis. Biotechnol. Bioeng. 2001, 76, 144–156. 10.1002/bit.1154. [DOI] [PubMed] [Google Scholar]
  27. Akkermans S.; Van Impe J. F. Mechanistic modelling of the inhibitory effect of pH on microbial growth. Food Microbiol. 2018, 72, 214–219. 10.1016/j.fm.2017.12.007. [DOI] [PubMed] [Google Scholar]
  28. Ojima Y.; Komaki M.; Nishioka M.; Iwatani S.; Tsujimoto N.; Taya M. Introduction of a stress-responsive gene, yggG, enhances the yield of l-phenylalanine with decreased acetic acid production in a recombinant Escherichia coli. Biotechnol. Lett. 2009, 31, 525–530. 10.1007/s10529-008-9906-z. [DOI] [PubMed] [Google Scholar]
  29. Chao Y. P.; Liao J. C. Metabolic responses to substrate futile cycling in Escherichia coli. J. Biol. Chem. 1994, 269, 5122–5126. 10.1016/S0021-9258(17)37663-9. [DOI] [PubMed] [Google Scholar]
  30. Lee H. J.; Kim H.; Seo J.; Na Y. A.; Lee J.; Lee J.; Kim P. Estimation of phosphoenolpyruvate carboxylation mediated by phosphoenolpyruvate carboxykinase (PCK) in engineered Escherichia coli having high ATP. Enzyme Microb. Technol. 2013, 53, 13–17. 10.1016/j.enzmictec.2013.04.001. [DOI] [PubMed] [Google Scholar]
  31. PENG L.; Arauzo-Bravo M. J.; Shimizu K.; et al. Metabolic flux analysis for a ppc mutant Escherichia coli based on 13C-labelling experiments together with enzyme activity assays and intracellular metabolite measurements. Fems Microbiol. Lett. 2004, 235, 17–23. 10.1111/j.1574-6968.2004.tb09562.x. [DOI] [PubMed] [Google Scholar]
  32. Hashiguchi K.-i.; Kojima H.; Sato K.; Sano K. Effects of an Escherichia coli ilvA mutant gene encoding feedback-resistant threonine deaminase on L-isoleucine production by Brevibacterium flavum. Biosci., Biotechnol., Biochem. 1997, 61, 105–108. 10.1271/bbb.61.105. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ao3c07619_si_001.pdf (773.9KB, pdf)

Data Availability Statement

All the data supporting the findings of this study are available within the article and its Supporting Information files. Data is available on request from the authors. The data that support the findings of this study are available from the corresponding author, [H.T.F], upon reasonable request.

Articles from ACS Omega are provided here courtesy of American Chemical Society

RESOURCES