Abstract
How does diversity in nature come about? One factor contributing to this diversity are species interactions; diversity on one trophic level can shape diversity on lower or higher trophic levels. For example, parasite diversity enhances host immune diversity. Insect protective symbionts mediate host resistance and are, therefore, also engaged in reciprocal selection with their host's parasites. Here, we applied experimental evolution in a well‐known symbiont‐aphid‐parasitoid system to study whether parasitoid diversity contributes to maintaining symbiont genetic diversity. We used caged populations of black bean aphids (Aphis fabae), containing uninfected individuals and individuals infected with different strains of the bacterial endosymbiont Hamiltonella defensa, which protects aphids against parasitoids. Over multiple generations, these populations were exposed to three different species of parasitoid wasps (Aphidius colemani, Binodoxys acalephae or Lysiphlebus fabarum), simultaneous or sequential mixtures of these species or no wasps. Surprisingly, we observed little selection for H. defensa in most treatments, even when it clearly provided protection against a fatal parasitoid infection. This seemed to be caused by high induced costs of resistance: aphids surviving parasitoid attacks suffered an extreme reduction in fitness. In marked contrast to previous studies looking at the effect of different genotypes of a single parasitoid species, we found little evidence for a diversifying effect of multiple parasitoid species on symbiont diversity in hosts.
Keywords: adaptation, defensive symbiosis, experimental evolution, immune system, maintenance of diversity, specificity
Parasites play a crucial role in driving and maintaining the diversity of immune systems. Here we tested whether the diversity or parasites selects for the diversity of protective symbionts using an experimental evolution approach. Surprisingly, we found little selection for protective symbionts and little evidence for the diversifying effect of different parasitoid species.
1. INTRODUCTION
How the diversity of living organisms in nature comes about is a question that has preoccupied ecologist and evolutionary biologists for centuries. Interactions between different organisms can play an important role in shaping this diversity (Chesson, 2000; Fine, 2015; Levine et al., 2017; Mcintire & Fajardo, 2014). More specifically, diversity on one trophic level—both within and between species—can shape and enhance diversity on higher and lower trophic levels (Cao et al., 2018; Dyer & Letourneau, 2003; Mailafiya et al., 2010; Morand, 2015). Similarly, the diversity of parasites has played an important role in the repeated diversification of immune systems of various organisms (Ghosh et al., 2011; Litman et al., 2007; Messier‐Solek et al., 2010). Protective symbionts—host associated (micro‐) organisms providing defence functions—can be considered from both perspectives. They can be seen as an additional line of defence complementing the host immune system and as such arguably being subject to similar selection pressures (Hafer & Vorburger, 2019) and as organisms in their own right from one trophic level that is affected by organisms from another trophic level, in this case the natural enemies against which they provide protection.
Protective symbionts are widespread throughout living organisms and are especially common in insects (Brownlie & Johnson, 2009; Flórez et al., 2015). Aphids represent one of the best‐studied systems, as they possess heritable bacterial endosymbionts providing effective protection against parasitoid wasps and pathogenic fungi (Guo et al., 2017; Oliver et al., 2014; Vorburger, 2014; Zytynska & Weisser, 2016). They do so in a very specific manner, whereby certain symbiont species provide protection against only a subset of the host's natural enemies (Asplen et al., 2014; Cayetano & Vorburger, 2015; Gimmi & Vorburger, 2024; Łukasik et al., 2013; McLean et al., 2020). There is also within‐species specificity, such that different strains of the same symbiont species provide unequal protection against different genotypes of the same parasitoid or pathogen (Cayetano et al., 2015; Cayetano & Vorburger, 2013, 2015; Leclair et al., 2016; McLean & Godfray, 2015; Parker et al., 2017; Rouchet & Vorburger, 2012; Schmid et al., 2012). The possession of resistance‐conferring symbionts often comes at fitness costs to the aphid host (Cayetano et al., 2015; Martinez et al., 2018; Sochard et al., 2019; Vorburger & Gouskov, 2011), albeit information is still lacking across parasitoid species, host genotypes and symbiont strains, limiting any general conclusions about these effects (Zytynska et al., 2021). Arguably, costs help to prevent any one symbiont from going to fixation in nature (Russell et al., 2013; Vorburger & Rouchet, 2016; Zytynska & Weisser, 2016). Symbionts are usually transmitted vertically with high fidelity (Darby & Douglas, 2003; Peccoud et al., 2014; Rock et al., 2018; Vorburger et al., 2017).
In the lab, strong reciprocal selection between parasitoids and symbionts has been shown repeatedly. Depending on the exact set up, it can result in the rapid fixation of the symbiont (Hafer‐Hahmann & Vorburger, 2020; Oliver et al., 2008; Rossbacher & Vorburger, 2020; Vorburger, 2014), extinction of the parasitoid (Käch et al., 2018) or an evolved ability of the parasitoid to overcome symbiont‐conferred resistance (Dennis et al., 2017; Dion et al., 2011; Rouchet & Vorburger, 2014). Two recent studies employing experimental evolution showed that parasitoid diversity can be crucial in maintaining symbiont diversity (Hafer‐Hahmann & Vorburger, 2020; Rossbacher & Vorburger, 2020). Both these studies focused on intraspecific variation, working with different strains of the well‐known aphid symbiont Hamiltonella defensa and different lines of the specialized parasitoid Lysiphlebus fabarum. Diversity in nature is certainly more extensive and involves not only intraspecific variation but also multiple parasitoid species attacking the same hosts (Müller et al., 1999; Van Veen et al., 2008). Two recent studies in natural populations observed that symbiont and parasitoid diversity were positively associated at the species level (Hafer‐Hahmann & Vorburger, 2021; Leclair et al., 2021). One possible explanation for this observation could be that species level diversity of parasitoids also plays a role in maintaining symbiont diversity. Here we tested experimentally whether species level parasitoid diversity has the potential to promote strain level diversity in a protective symbiont, using an experimental evolution approach.
2. METHODS
2.1. Insects
As a host we used the black bean aphid, Aphis fabae, an important pest of broad bean (Vicia fabae) and sugar beet (Beta vulgaris). We used three different clonal lines of the same A. fabae genotype which originated from a single female collected in St. Margrethen, Switzerland from Chenopodium album in 2006 (line A06‐405) and have been maintained clonally in the lab at 18–20°C and a 16/8 h light dark regime since. These lines differed only by their infections with the endosymbiotic bacterium H. defensa. Hamiltonella defensa serves as a protective symbiont in several aphid species, conferring resistance against parasitoid wasps (Asplen et al., 2014; Oliver et al., 2003, 2005; Rothacher et al., 2016; Schmid et al., 2012; Vorburger, 2014). Two of the aphid lines we used carried one of two genetically distinct H. defensa strains that had been introduced by microinjection (strain IDs H15 and H76) (Cayetano et al., 2015), while the third line was H. defensa free. We refer to these lines as H‐, H15 and H76 hereafter.
As parasitoids we used three different wasp species of the aphid‐specific subfamily Aphidiinae (Hymenoptera: Braconidae): Lysiphlebus fabarum, Binodoxys acalephae and Aphidius colemani. All are known to parasitize A. fabae in the field (Kavallieratos et al., 2013; Starý, 2006). Lysiphlebus fabarum occurs in sexual and asexual populations, while B. acalephae and A. colemani only reproduce sexually. To minimize differences between species, we used sexual L. fabarum. The sexual laboratory population was founded in 2012 by mixing nine independent accessions from six sites in Switzerland (Käch et al., 2018) and maintained since at high effective population size (500 individuals transferred every generation). The laboratory stock of Binodoxys acalephae was collected in 2018 near Zürich, Switzerland from Aphis urticata, and A. colemani was ordered from a commercial supplier (Andermatt Biocontrol, Grossdietwil, Switzerland). Since their collection/purchase and throughout the experiments, the wasps were reared on symbiont‐free A. fabae of a different clone than the one used in this study at ca. 22°C with a 16 h photoperiod.
2.2. Setup of the selection experiment
We followed a similar setup and protocol as we used previously for a related experiment manipulating intraspecific diversity of parasitoids (Hafer‐Hahmann & Vorburger, 2020). Briefly, we prepared 30 aphid populations comprising equal proportions of our three aphid lines (H‐, H15 and H76) in insect rearing cages (24.5 × 24.5 × 24.5 cm; BugDorm‐4F2222; MegaView Science, Taiwan). We placed three pots with 2‐weeks old broad bean plants (Vicia faba) that were inoculated with 9 adult females (3 per line) in every cage (27 aphids per cage). Within their cage aphids were able to move freely between plants. Treatments consisted either of no wasps (NoWasp), wasps of a single species (A. colemani, B. acalephae and L. fabarum, hereafter Acol, Baca and Lfab), a simultaneous mix with equal proportions of the three wasp species (Sim) or a sequential mix of the three wasp species (Seq), in which we applied a single species in each generation, but alternated species between generations (Generation 1 & 4: B. acalephae, generation 2 & 5: A. colemani, generation 3 & 6: L. fabarum). We set up five replicate cages per treatment. In the first generation, the wasp treatments were applied 5 days after the addition of the aphids, that is when the aphids had already produced small colonies of offspring. According to treatment we added either three females of A. colemani (the most virulent parasitoid), six females of L. fabarum, or six females of B. acalaphae, or a third of these numbers to each cage of treatment Sim. Due to low infection rates for L. fabarum and especially B. acalephae, we increased their number in the subsequent generations to 15 (5 for Sim) for L. fabarum and to 12–30 (4–10 for Sim) for B. acalephae. The numbers for this species were variable since we were not always able to obtain the desired number of wasps (see Table A1 for exact numbers). After adding the wasps to the cages, we left the populations undisturbed for 11 days to allow the wasps to attack and parasitize (i.e. kill and mummify) aphids, which take about 7–9 days after parasitoid oviposition to be recognizable as mummies. Parasitoids remained in the cage until they died naturally. Without additional food or water they only live for a few days (Ameri et al., 2015; Jerbi‐Elayed et al., 2021). After mummies had formed, we collected 30 healthy adult aphids from each cage, taking care to pick them from all plants and different parts of each plant and used them to establish the next aphid generation by inoculating new plants (10 aphids per plant) in fresh cages. If we were unable to obtain enough adult aphids, we substituted with the oldest nymphs we could find. Experimental evolution continued for 6 generations, although one replicate of Acol died out after the first generation and one replicate of the NoWasp treatment was contaminated with wasps during the second generation. These cages were replaced and set up anew with aphids from a different replicate of the same treatment. Three additional cages (two of Acol, one of Sim) died out in the last generation.
2.3. Data collection
During each transfer, we obtained the number of aphids (roughly estimated by counting aphids in groups of ca. 10 individuals) and mummies (exact counts) and plant size (i.e. total stem length of all plants) for each cage. We calculated mummification rate by dividing the number of mummies by the number of aphids plus mummies. To estimate aphid population composition (i.e. the relative frequencies of H‐, H15 and H76 aphids), we additionally collected 15 unmummified aphids per cage (5 aphids from each plant) at the end of the 3rd and last (6th), generation. These were stored at −20°C until further analysis.
We extracted aphid DNA using high salt extractions (Sunnucks & Hales, 1996), but adapted to a 96 deep well plate format (Gouskov et al., 2016; Hafer‐Hahmann & Vorburger, 2020). This DNA was then used for diagnostic PCRs (Ferrari et al., 2012) to test for the presence of H. defensa with a symbiont‐specific primer pair amplifying part of the bacterial 16S rRNA gene. Additionally, we amplified DNA of Buchnera aphidicola which, as an obligate symbiont of aphids, should be present in all individuals and hence served as a control for successful DNA extraction. 23 samples that were negative for B. aphidicola were discarded. PCRs were multiplexed for both symbionts using forward primer 16SA1 (AGAGTTTGATCMTGGCTCAG; Fukatsu & Nikoh, 1998) and reverse primer Buch_R_CV2 (CCCCCACTTTRGTTTTTCAAC; Hafer‐Hahmann & Vorburger, 2020) for B. aphidicola and forward primer 10F (AGTTTGATCATGGCTCAGATTG) and reverse primer T419R (AAATGGTATTCGCATTTATCG) for H. defensa (Ferrari et al., 2012). For each aphid possessing H. defensa, we additionally amplified part of H. defensa's murE gene (forward primer: murE16F: ACTAACGGGAAAACCACTAATAC & reverse primer: murE936R: TTGAGAATGTCAGCGGTAATC); (Henry et al., 2013). This gene shows several sequence differences between H. defensa strains H15 and H76. Amplicons were sent to a commercial service (Microsynth, Balgach, Switzerland) for Sanger sequencing.
2.4. Infection experiments
In order to quantify the susceptibility of each aphid line to each parasitoid species, we used a fully crossed design to test each aphid line with each parasitoid species (between 14 and 27 replicates per combination). We conducted two rounds of this experiment, one before and one after the main experiment. For the first round, we set up replicates with two adult aphids each on one‐week‐old bean plants. Three to four days later, we removed the adults, counted the aphid nymphs and added wasps (2 females per plant), which remained on the plants until they died. Another 11 days later, we counted all non‐mummified aphids (i.e. surviving aphids and the offspring they had produced) and mummies. For the second round, we again added two aphids per plant, but removed them after 24 h. Two days thereafter, we counted the aphid nymphs and added two female wasps, which were removed after another 24 h. Ten to eleven days after the exposure to wasps, we counted aphids and mummies. We calculated mummification rate by dividing the number of mummies by the number of aphids when wasps were added. In order to estimate costs imposed by wasps not through direct mummification but through otherwise reducing aphid fitness, we calculated the number of offspring per non‐mummified aphid by dividing the number of aphids at the end of the experiment by the number of aphids when wasps were added minus the number of mummies. For the latter we excluded replicates in which no aphids survived the parasitoid attack. While we cannot rule out that some successfully parasitized aphids reached maturity prior to mummification, it seems unlikely that they contributed a meaningful number of offspring compared to healthy aphids.
2.5. Statistical analysis
We analysed data in R, version 4.0.0 (R Core Team, 2019) using linear mixed models from the lme4 package (Bates et al., 2015). Plots were generated in ggplot2 (Wickham, 2016). Several of our response variables, especially estimates of proportions, showed strong overdispersion when analysed with generalized linear mixed models (GLMMs), resulting in unrealistic (anticonservative) p‐values. We, therefore, decided to use linear mixed models (LMMs) with variable transformations rather than GLMMs to obtain more realistic p‐values and to be able to use the same models across all response variables. For the experimental evolution experiment, we calculated symbiont haplotype number and Shannon diversity with vegan (Oksanen et al., 2019) and transformed our response variables if necessary to comply with model assumptions prior to building and testing statistical models. More precisely, we transformed mummy number, mummification rate, aphid number, number of different haplotypes and Shannon diversity using transformTukey from the package rcompanion (Mangiafico, 2019) to identify the best transformation which resulted in transforming data using a lambda of 0.325 (mummy number), 0.125 (mummification rate), 0.35 (aphid number), 1.325 (haplotype number) and 1.075 (Shannon). We transformed the proportion of H15 and H76 by using angular transformations of asin (p 0.5) and asin (p 0.4), respectively, to improve the normality of residuals. Plant size and the proportion of H‐ required no prior transformation. In each case the response variable in the experimental evolution experiment was a single value for each cage in each generation. Using each of these response variables, we fitted a separate LMM (lmer command) with cage ID as random effect and treatment, generation and their interaction as fixed effects. For a balanced design this model is equivalent to a repeated measures Anova. We defined contrasts as wasp presence versus wasp absence (not for mummification rate and mummy number), one versus multiple wasp species, multiple wasp species simultaneously (Sim) versus sequentially (Seq) and within single wasp treatments (Acol, Baca, Lfab). Each model was followed with a type III analysis of variance using Satterthwaite's method to obtain p‐values (Kuznetsova et al., 2017). Non‐significant interactions were removed from each model. Significant treatment effects or interactions were followed up with post hoc tests between each pairwise combination of treatments or between each treatment pair for each generation or between each pair of generations within each treatment using package emeans (Lenth, 2019) with Tukey corrections for multiple testing. In order to obtain beta‐diversity with confidence intervals we used divEst from package entropart and resampled 1000 times (Marcon & Hérault, 2015).
To analyse the experimental infections, similarly as described above, we used LMs followed by a type III analysis of variance and post hoc tests for significant effects with emeans (Lenth, 2019). We included aphid line (i.e. symbiont) and wasp species and their interaction as well as experimental round as fixed effects. To analyse aphid and mummy number at the end of the experiment, we included the number of aphids when adding wasps as a covariate. In order to confirm to model assumptions we used transformTukey for aphid and mummy number and the number of offspring per healthy aphid with a lambda of 0.275, 0.475 and 0.325, respectively, and an angular transformation of asin (p 0.1) for mummification rate.
3. RESULTS
3.1. Parasitism and changes in population composition
Contrary to our expectation that infection with H. defensa would be beneficial in the presence of all parasitoids, it was the H. defensa‐free aphids that increased over time in all treatments except those that contained L. fabarum in every generation (Lfab and Sim, Figures 1a and 2, Table 1, Tables A2 and A3). That H. defensa‐infected aphids persisted in the presence of L. fabarum was mainly due to selection for aphids carrying H76, whereas H15‐infected aphids declined just as strongly as in the other treatments (Figures 1b,c and 2, Table 1, Tables A2 and A3). This was consistent with the results of our parasitism tests, in which H76 decreased mummification by L. fabarum significantly, whereas H15 did not (Figure 3a,b, Table 2, Tables A4 and A5). In the case of treatment Baca, the lack of selection for H. defensa was explicable by the generally low parasitism success of B. acalephae (Figure 3a,b). In parasitism tests, it produced an extremely low number of mummies even on H. defensa‐free aphids, such that there was no difference in parasitism among the three aphid lines used (Table 2, Tables A4 and A5). The same does not apply to treatment Acol. Both strains of H. defensa strongly reduced parasitism by A. colemani in our tests (Figure 3a,b), yet they declined in cages of the Acol treatment (Figure 1b,c). A noticeable difference in parasitism tests between A. colemani and the other parasitoids was an extremely low number of live aphids on plants (p < .001; Figure 3c, Table 2, Tables A4 and A5), reflecting a near‐absence of offspring from aphids that resisted parasitism (Figure 3c,d) compared to the other two wasp species (p < .001; Figure 3d, Table 2, Tables A4 and A5). This indicates strong negative effects of parasitoid attack/oviposition on host fitness even when the host does ultimately not succumb to the parasitoid (induced costs of resistance). This effect could be related to the fact that aphids went extinct in the last generation in two cages of the Acol treatment and one cage of the Sim treatment, even though the frequency of H. defensa‐protected aphids (especially with strain H76) was high before aphids were eradicated by parasitoids (Figure 2). Indeed, if anything, our experimental infection tests indicate high costs of H76, which reduced the number of offspring produced by non‐mummified aphids significantly (Figure 3d, Table 2, Tables A4 and A5) in the presence of any wasp species (H. defensa × wasp species interaction: p = .2337; Figure 3d, Table 2 and Table A4). When exposed to A. colemani this seems to have been especially detrimental; surviving adult aphids produced less than one offspring when carrying H76 (0.66 ± 0.27), resulting in negative growth, while it was just around 1 (1.08 ± 0.45) for aphids carrying H15 and usually well above 1 (2.72 ± 1.83) for aphids without H. defensa.
FIGURE 1.
Proportion of aphids without H. defensa (a), with H. defensa haplotype H15 (b) and H76 (c) and H. defensa diversity (d: H. defensa strain richness; e: Shannon diversity; f: Beta‐diversity). Error bars represent 95% confidence intervals. Mean and confidence intervals for beta‐diversity have been calculated through bootstrapping.
FIGURE 2.
Proportion of aphids without H. defensa and with each H. defensa haplotype for each treatment and replicate. See Figure A1 for the same figure with the absolute number of aphids instead of proportions.
TABLE 1.
Fixed effects tests from linear mixed effect models for the proportion of each aphid line in experimental populations and aphid line diversity.
| Response | Factor | df | F | p |
|---|---|---|---|---|
| Proportion of aphids without H. defensa | Treatment | 5, 23 | 1.25 | .3175 |
| Generation | 2, 46 | 13.95 | <.0001 | |
| Treatment × Generation | 10, 46 | 2.11 | .0430 | |
| Proportion of aphids with H. defensa haplotype H15 | Treatment | 5, 24 | 0.86 | .5186 |
| Generation | 2, 57 | 14.04 | <.0001 | |
| Treatment × Generation | 10, 47 | 1.68 | .1145 | |
| Proportion of aphids with H. defensa haplotype H76 | Treatment | 5, 20 | 4.25 | .0088 |
| Generation | 2, 42 | 11.55 | .0001 | |
| Treatment × Generation | 10, 42 | 2.45 | .0208 | |
| Number of different aphid lines (i.e. H. defensa strains) | Treatment | 5, 79 | 0.49 | .7832 |
| Generation | 2, 79 | 40.81 | <.0001 | |
| Treatment × Generation | 10, 69 | 0.96 | .4825 | |
| Shannon diversity | Treatment | 5, 79 | 0.30 | .9119 |
| Generation | 2, 79 | 65.74 | <.0001 | |
| Treatment × Generation | 10, 69 | 0.97 | .4811 |
Note: In order to obtain statistics for main effects if interactions were non‐significant, we build new models which did not contain the interactions. Statistics for interactions and main effects in models where the interaction was significant are from the full models. Significant p‐values have been highlighted in bold.
FIGURE 3.
Outcome of experimental exposure tests. (a) Mummy number, (b) Mummification rate, (c) Aphid number at the end of the experiment, (d) Number of offspring per healthy aphid. Error bars represent 95% confidence intervals. Black line in panel d represents the number of offspring for a stable aphid population (i.e. n = 1).
TABLE 2.
Linear models for experimental exposures.
| Response | Factor | df | F | p |
|---|---|---|---|---|
| Mummy number | Round | 1, 171 | 42.43 | <.0001 |
| Number of aphids prior to exposure | 1, 171 | 58.42 | <.0001 | |
| H. defensa | 2, 171 | 24.41 | <.0001 | |
| Wasp species | 2, 171 | 26.16 | <.0001 | |
| H. defensa × Wasp species | 4, 171 | 5.75 | .0002 | |
| Mummification rate | Round | 1, 172 | 15.49 | .0001 |
| H. defensa | 2, 172 | 25.77 | <.0001 | |
| Wasp species | 2, 172 | 21.13 | <.0001 | |
| H. defensa × Wasp species | 4, 172 | 4.96 | .0008 | |
| Aphid number | Round | 1, 175 | 13.00 | .0004 |
| Number of aphids prior to exposure | 1, 175 | 101.17 | <.0001 | |
| H. defensa | 2, 175 | 3.78 | .0246 | |
| Wasp species | 2, 175 | 106.11 | <.0001 | |
| H. defensa × Wasp species | 4, 171 | 1.33 | .2596 | |
| Offspring per non‐mummified aphid | Round | 1, 174 | 8.24 | .0046 |
| H. defensa | 2, 174 | 7.57 | .0007 | |
| Wasp species | 2, 174 | 86.02 | <.0001 | |
| H. defensa × Wasp species | 4, 170 | 1.41 | .2337 |
Note: In order to obtain statistics for main effects if interactions were non‐significant, we build new models which did not contain the interactions. Statistics for interactions and main effects in models where the interaction was significant are from the full models. Significant p‐values have been highlighted in bold.
3.2. Symbiont diversity
Arguably due to the prevailing selection against H. defensa, we saw no significant effect of parasitoid diversity on symbiont strain number or Shannon index (Figure 1d,e, Table 1 and Table A2). Also beta‐diversity, reflecting the variation in symbiont composition of cages from the same treatment, indicated no consistent differences between treatments with single (Acol, Baca, Lfab) and multiple (Sim and Seq) wasp species at the end of the cage experiment (Figure 1f, Table A6). The only and admittedly weak evidence for an effect of parasitoid diversity on symbiont diversity came from comparing the two treatments that maintained reasonably high levels of H. defensa, Lfab and Sim. For all measures of symbiont diversity (Figure 1d–f), treatment Sim with all three parasitoid species showed higher values than the treatment with L. fabarum only, which mainly selected for aphids infected with H76. There was only weak overlap of confidence intervals for beta‐diversity between these treatments (Figure 1f purple vs. orange line, Table A6).
3.3. Consequences for population dynamics
We found no clear pattern of evolved resistance even in those treatments (Lfab and Sim) that showed some selection for H. defensa. Both, mummy number and mummification rate were significantly affected by treatment and this effect varied between generations, but the pattern showed no clear trends and this was paralleled by the number of aphids and plant size (Figure 4, Table 3, Tables A7 and A8). Binodoxys acalephae always showed very low numbers and rates of mummification and hence did not significantly diminish aphid numbers compared to cages without any wasps (p > .06; Figure 4, Table A8). By contrast, A. colemani produced a large number of mummies relative to aphid number and strongly reduced aphid numbers (p < .02; Figure 4, Table A8), with one cage going extinct within two generations and two out of five cages going extinct by the sixth generation. The third wasp species, L. fabarum, produced consistently high rates and numbers of mummies, but, similarly to B. acalaphae, this did not have a major impact on aphid numbers (p > .1; Figure 4, Table A8). The two treatments that received a mixture of wasps showed somewhat different patterns. In cages receiving different wasp species sequentially, the different species produced similar mummification as cages receiving the same wasp throughout (Figure 4, Table A8). Nevertheless, the numbers of aphids these cages harboured were high only in the first generation in which they had received the least aggressive wasp—B. acalaphae—but dropped in the subsequent generation and never clearly recovered thereafter (Figure 4, Table A8). Cages exposed to all three wasps simultaneously showed a similar, if less pronounced, pattern as those exposed only to the most aggressive wasp A. colemani: decreasing numbers of aphids but consistently high mummification rates (Figure 4, Table A8). One of these cages even went extinct.
FIGURE 4.
Population dynamics. (a) Mummy number, (b) Mummification rate, (c) Aphid number, (d) Plant size. Error bars represent 95% confidence intervals. Mean and confidence intervals for beta‐diversity have been calculated through bootstrapping.
TABLE 3.
Fixed effects tests from linear mixed effect models for insect population dynamics and plant size.
| Response | Factor | df | F | p |
|---|---|---|---|---|
| Mummy number | Treatment | 4, 20 | 11.85 | <.0001 |
| Generation | 5, 100 | 5.82 | .0001 | |
| Treatment × Generation | 20, 100 | 3.59 | <.0001 | |
| Mummification rate | Treatment | 4, 21 | 20.27 | <.0001 |
| Generation | 5, 94 | 11.62 | <.0001 | |
| Treatment × Generation | 20, 94 | 4.34 | <.0001 | |
| Aphid number | Treatment | 5, 24 | 19.40 | <.0001 |
| Generation | 5, 119 | 23.91 | <.0001 | |
| Treatment × Generation | 25, 119 | 2.66 | .0002 | |
| Plant size | Treatment | 5, 24 | 5.24 | .0021 |
| Generation | 5, 119 | 27.79 | <.0001 | |
| Treatment × Generation | 25, 119 | 1.96 | .0085 |
Note: Significant p‐values have been highlighted in bold.
4. DISCUSSION
Whether or not a heritable symbiont is maintained in a host population depends on its costs and benefits to the host. Both are often context‐dependent. Either strain of H. defensa we used here provided protection against fatal parasitoid infection: H76 against A. colemani and L. fabarum, H15 at least against A. colemani (see also Cayetano & Vorburger, 2015). Nevertheless, we saw strong selection against H. defensa in the presence of the parasitoids A. colemani and B. acalephae, as well as in the Seq treatment. The only parasitoid driving selection for aphids infected with H. defensa, specifically strain H76, was L. fabarum. This may also explain why H. defensa infections did not decline in the Sim treatment, where L. fabarum was continuously present in the parasitoid mixture. In this context it is important to note that L. fabarum is indeed the most common parasitoid of A. fabae in natural populations (Gimmi et al., 2023; Rothacher et al., 2016; Starý, 2006).
When it comes to costs of resistance, it is useful to distinguish the constitutive costs of possessing a defence mechanism and the induced costs of using this defence. This also applies to symbiont‐conferred defences (Vorburger et al., 2013). The well‐known constitutive costs of an infection with H. defensa (Cayetano et al., 2015; Martinez et al., 2018; Sochard et al., 2019; Vorburger & Gouskov, 2011) can explain why the prevalence of this symbiont declined in the absence of parasitoids and in the presence of the parasitoid B. acalaphae, which was so ineffective in parasitizing even H. defensa‐free aphids that it probably did not exert much selection for resistance. They cannot explain why aphids possessing H. defensa virtually disappeared in populations exposed to A. colemani. This wasp is an effective parasitoid and both strains of H. defensa strongly reduced parasitism by A. colemani. A likely explanation is provided by the high induced fitness costs of surviving an attack by A. colemani. The reproduction of aphids was strongly impaired if they survived parasitoid attack (i.e. survivors produced very few offspring), and this fitness reduction was stronger in the presence of H. defensa. Especially aphids carrying H76 suffered such a strong fitness cost that the resulting population growth was negative. In a different aphid species, Myzus persicae, A. colemani causes similarly severe induced costs in the presence of another protective symbiont, Regiella insecticola (Vorburger et al., 2008). By contrast, Vorburger et al. (2013) found no evidence for induced costs in Aphis fabae infected with H. defensa strain H76 (same as used here) after aphids survived oviposition by L. fabarum. This is consistent with the results from our parasitism tests here, where H. defensa‐infected survivors of exposures to L. fabarum still produced a reasonable amount of offspring, while those exposed to A. colemani did not (Figure 3c,d). Hence, there appears to be a clear difference in the effects the parasitoids we used have on H. defensa‐protected aphids, with A. colemani inducing severe costs even when it fails to parasitize the hosts successfully. In our study these costs seem to have been so strong in the presence of A. colemani that they were not sufficiently set off by benefits and hence aphids seem to have performed better by not paying these costs even if it left them vulnerable to parasitoid attack. Given that we worked with artificial symbiont‐aphid combinations generated by microinjection, it is fair to ask if these effects are representative of natural host‐symbiont associations. We believe that they are: both strains of H. defensa occur naturally in A. fabae, and because this aphid species reproduces sexually before overwintering (cyclical parthenogenesis), they find themselves in new host genotypes every year also in natural populations. Furthermore, Kaech et al. (2022) have shown that the fitness effects of natural and artificial combinations of A. fabae and H. defensa are very similar.
Parasitoid wasps and especially Aphidius spp. are frequently used as biological control for aphids in greenhouses. However, this control can be compromised by the presence of protective symbionts (Käch et al., 2018; Postic et al., 2020). Hence, from an applied point of view, using wasps that effectively select against protective symbionts could help to avoid this problem.
We have proposed that parasite and pathogen diversity could be an important driver in promoting and maintaining protective symbiont diversity (Hafer & Vorburger, 2019). Here we find, at best, very limited evidence for this hypothesis, mainly because we saw overall selection against the protective symbiont H. defensa, even in the presence of parasitoids against which it provides protection. However, these results were obtained in a very simplified laboratory environment. We cannot exclude that in much more complex natural environments, the interplay between induced costs, constitutive costs and benefits of protective symbionts could contribute to the variation in symbiont prevalence and composition we observe in natural populations. More support for the maintenance of symbiont diversity by parasitoids came from two earlier experiments, in which the genotypic composition of one parasitoid, L. fabarum, was manipulated rather than parasitoid species composition. These experiments provided clear evidence that genetically more diverse parasitoid populations can maintain higher strain diversity in H. defensa (Hafer‐Hahmann & Vorburger, 2020; Rossbacher & Vorburger, 2020). There was also strong selection in favour of H. defensa‐protected aphids and hence a high prevalence of the symbiont in those experiments, presumably providing more opportunity for any diversifying effects of parasitoid selection to come into play.
Our experiment only ran for six generations. While we cannot know how the prevalence of H. defensa (and its diversity) would have developed over a longer time period, the observed trends until generation six suggest that H. defensa would have gone extinct in all treatments in which L. fabarum was not present in each generation (treatments nowasp, Baca, Acol and Seq). We are convinced that the decline in H. defensa prevalence observed in these treatments is due to selection for H. defensa‐free aphids and not to vertical transmission failures, because under the laboratory conditions used here, maternal transmission is virtually perfect. Our stock cultures of these lines have meanwhile retained their infections for well over 10 years (C. Vorburger, personal observation). In the treatment with L. fabarum only—in agreement with previous findings (Hafer‐Hahmann & Vorburger, 2020; Rossbacher & Vorburger, 2020)—a single haplotype of H. defensa (H76) would likely have become fixed. The treatment using all parasitoids simultaneously seemed to induce the same trend, but it is less clear whether H76 would have trended towards fixation in all replicates. Only continuing the experiment for further generations would have been able to answer this question. However, by generation 6, the aphids had died out or were close to extinction in several cages, making it impossible to obtain more data.
Even though H. defensa is the best known protective symbiont in aphids, it is not the only one. Different species of symbionts seem to play a role in protecting aphids against parasitoids (Guo et al., 2017). Little is known about what maintains the coexistence and diversity of these different protective symbiont species. It is feasible that species level parasitoid diversity plays a role in maintaining their diversity, possibly more so than in maintaining strain diversity of H. defensa, as our largely negative results suggest. In support of this idea, two recent studies observed a positive association between symbiont and parasitoid species level diversity in natural aphid populations (Hafer‐Hahmann & Vorburger, 2021; Leclair et al., 2021). Even individual aphids can harbour multiple symbionts. Recent field data from the cereal aphid Sitobion avenae found a very high prevalence of co‐infections and suggests that rather than just individual symbionts certain symbiont combination could provide the best protection against particular parasitoids (Zytynska et al., 2023). In A. fabae, however, multiple infections do not appear to play an important role. Firstly, the prevalence of protective symbionts is generally lower in A. fabae, with H. defensa infecting approx. 30–40% of individuals in Central Europe (Gimmi et al., 2023). Secondly, co‐infections with R. insecticola, the second most abundant facultative endosymbiont, are less common than expected by chance (Gimmi et al., 2023; Vorburger & Rouchet, 2016), such that H. defensa typically occurs as single infections in A. fabae. For this reason, the protective effect of specific symbiont combination has never been tested experimentally in A. fabae.
There is mounting evidence that bottom‐up and top‐down effects across trophic levels maintain diversity within trophic levels (Cao et al., 2018; Dyer & Letourneau, 2003; Mailafiya et al., 2010; Morand, 2015). The diversity of plant communities, for example, has a positive effect on diversity in the soil and above ground spanning multiple trophic levels, albeit the strength of this effect decreases upwards in the food web (Scherber et al., 2010). Additionally, the diversity of soil communities (including pathogens and mutualists) and above ground insects can positively influence plant diversity (Bennett, 2010). It is tempting to propose that the same applies to the hidden level of symbiont communities within herbivorous insects—certainly an area that warrants further investigation.
AUTHOR CONTRIBUTIONS
Nina Hafer‐Hahmann: Conceptualization (equal); formal analysis (lead); investigation (lead); writing – original draft (lead); writing – review and editing (equal). Christoph Vorburger: Conceptualization (equal); writing – original draft (supporting); writing – review and editing (equal).
CONFLICT OF INTEREST STATEMENT
We have no conflicts of interest to disclose.
ACKNOWLEDGEMENTS
We would like to thank Paula Rodriguez and Jesper Wallisch for technical assistance. NH was supported by a DFG‐fellowship (HA 8471/1‐1) and CV acknowledges support by the Swiss National Science Foundation (grants nr. CRSII3_154396 and 21003A_181969). Open Access funding enabled and organized by Projekt DEAL.
APPENDIX 1.
FIGURE A1.
Number of aphids without H. defensa and with each H. defensa haplotype for each treatment and replicate. Note that at the beginning of the experiments (generation 0), we set up cages with 27 aphids, 9 per from each clonal line. For easier readability of the plot, we only included 15 aphids (5 per line) in the plot. Numbers of aphids not adding up to 15 in subsequent generations are either due to a failure to collect enough aphids or drop outs during molecular analysis.
TABLE A1.
Timing of experimental evolution experiment for each generation. Time is in days since setup/transfer. Transfer is for the previous/the subsequent generation, respectively.
| Generation | Procedure | Time in days |
|---|---|---|
| 1 | Set up | 0 |
| 1 |
Addition of wasps (Acol: 3/ Baca: 6/ Lfab: 6/ Seq: 6 Baca/ Sim 1/2/2) |
5–6 |
| 1/2 | Transfer | 0/17–18 |
| 2 |
Addition of wasps (Acol: 3/ Baca: 30/ Lfab: 6/ Seq: 3 Acol/ Sim 1/10/5) |
5 |
| 2/3 | Transfer | 0/16 |
| 3 |
Addition of wasps (Acol: 3/ Baca: 21/ Lfab: 6/ Seq: 15 Lfab/ Sim 1/7/5) |
5 |
| 3/4 | Transfer & sample | 0/16 |
| 4 |
Addition of wasps (Acol: 3/ Baca: 24/ Lfab: 6/ Seq: 24 Baca/ Sim 1/8/5) |
5 |
| 4/5 | Transfer | 0/16 |
| 5 |
Addition of wasps (Acol: 3/ Baca: 12–24/ Lfab: 6/ Seq: 3 Acol/ Sim 1/4–8/5) |
5 |
| 5/6 | Transfer | 0/16 |
| 6 |
Addition of wasps (Acol: 3/ Baca: 12/ Lfab: 6/ Seq: 15 Lfab/ Sim 1/4/5) |
5 |
| 6/7 | Sample | 0/16 |
TABLE A2.
Summary of the best model in each case for aphid clone identity and diversity. Significant p‐values have been highlighted in bold.
| Response | Random effect | Variance | SD |
|---|---|---|---|
| Random effects | |||
| Proportion of aphids without H. defensa | Cage identity | 0.01 | 0.11 |
| Residual | 0.05 | 0.23 | |
| Proportion of aphids with H. defensa haplotype H15 | Cage identity | 0.01 | 0.10 |
| Residual | 0.06 | 0.25 | |
| Proportion of aphids with H. defensa haplotype H76 | Cage identity | 0.01 | 0.09 |
| Residual | 0.09 | 0.30 | |
| Number of different aphid lines (i.e. H. defensa strains) | Cage identity | <0.01 | <0.01 |
| Residual | 0.73 | 0.85 | |
| Shannon diversity | Cage identity | <0.01 | <0.01 |
| Residual | 0.07 | 0.26 | |
| Response | Fixed effect | Est. | SE | df | t | p |
|---|---|---|---|---|---|---|
| Fixed effects | ||||||
| Proportion of aphids without H. defensa | (Intercept) | 0.33 | 0.05 | 64 | 7.16 | <.0001 |
| Treatment wasp presence vs. absence | <0.01 | 0.06 | 64 | <0.01 | 1 | |
| Treatment wasp number | <0.01 | 0.03 | 64 | <0.01 | 1 | |
| Treatment Seq vs. Sim | <0.01 | 0.08 | 64 | <0.01 | 1 | |
| Treatment Acol vs. Baca | <0.01 | 0.28 | 64 | <0.01 | 1 | |
| Treatment Baca vs. Lfab | <0.01 | 0.16 | 64 | <0.01 | 1 | |
| Generation 1 vs. 3 | 0.19 | 0.06 | 45 | 3.24 | .0022 | |
| Generation 1 vs. 6 | 0.32 | 0.06 | 46 | 5.21 | <.0001 | |
| Treatment wasp presence vs. absence: Generation 1 vs. 3 | −0.05 | 0.08 | 45 | −0.72 | .4769 | |
| Treatment wasp number: Generation 1 vs. 3 | −0.04 | 0.04 | 45 | −1.03 | .3107 | |
| Treatment Seq vs. Sim: Generation 1 vs. 3 | −0.07 | 0.10 | 45 | −0.64 | .525 | |
| Treatment Acol vs. Baca: Generation 1 vs. 3 | 0.23 | 0.36 | 45 | 0.64 | .5275 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 3 | 0.15 | 0.21 | 45 | 0.71 | .4792 | |
| Treatment wasp presence vs. absence: Generation 1 vs. 6 | −0.04 | 0.08 | 45 | −0.47 | .6384 | |
| Treatment wasp number: Generation 1 vs. 6 | −0.03 | 0.04 | 45 | −0.93 | .3553 | |
| Treatment Seq vs. Sim: Generation 1 vs. 6 | 0.23 | 0.11 | 46 | 2.20 | .0330 | |
| Treatment Acol vs. Baca: Generation 1 vs. 6 | 0.44 | 0.36 | 45 | 1.23 | .2247 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 6 | 0.45 | 0.21 | 45 | 2.21 | .0323 | |
| Proportion of aphids with H. defensa haplotype H15 | (Intercept) | 0.62 | 0.05 | 72 | 12.53 | <.0001 |
| Treatment wasp presence vs. absence | −0.03 | 0.04 | 24 | −0.67 | .5063 | |
| Treatment wasp number | 0.01 | 0.02 | 24 | 0.29 | .7744 | |
| Treatment Seq vs. Sim | 0.05 | 0.06 | 24 | 0.85 | .404 | |
| Treatment Acol vs. Baca | 0.17 | 0.19 | 23 | 0.86 | .3995 | |
| Treatment Baca vs. Lfab | 0.15 | 0.11 | 23 | 1.33 | .1955 | |
| Generation 1 vs. 3 | −0.24 | 0.06 | 56 | −3.68 | .0005 | |
| Generation 1 vs. 6 | −0.34 | 0.07 | 57 | −5.12 | <.0001 | |
| Proportion of aphids with H. defensa haplotype H76 | (Intercept) | 0.70 | 0.06 | 68 | 12.45 | <.0001 |
| Treatment wasp presence vs. absence | <0.01 | 0.07 | 68 | <0.01 | 1 | |
| Treatment wasp number | <0.01 | 0.03 | 68 | <0.01 | 1 | |
| Treatment Seq vs. Sim | <0.01 | 0.10 | 68 | <0.01 | 1 | |
| Treatment Acol vs. Baca | <0.01 | 0.34 | 68 | <0.01 | 1 | |
| Treatment Baca vs. Lfab | <0.01 | 0.19 | 68 | <0.01 | 1 | |
| Generation 1 vs. 3 | −0.22 | 0.08 | 41 | −2.89 | .0061 | |
| Generation 1 vs. 6 | −0.38 | 0.08 | 43 | −4.76 | <.0001 | |
| Treatment wasp presence vs. absence: Generation 1 vs. 3 | 0.05 | 0.10 | 41 | 0.46 | .6464 | |
| Treatment wasp number: Generation 1 vs. 3 | 0.04 | 0.05 | 41 | 0.85 | .4024 | |
| Treatment Seq vs. Sim: Generation 1 vs. 3 | −0.09 | 0.13 | 41 | −0.66 | .5131 | |
| Treatment Acol vs. Baca: Generation 1 vs. 3 | −0.33 | 0.46 | 41 | −0.73 | .4719 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 3 | −0.31 | 0.26 | 41 | −1.18 | .2434 | |
| Treatment wasp presence vs. absence: Generation 1 vs. 6 | 0.12 | 0.10 | 42 | 1.16 | .2532 | |
| Treatment wasp number: Generation 1 vs. 6 | 0.03 | 0.05 | 41 | 0.65 | .5216 | |
| Treatment Seq vs. Sim: Generation 1 vs. 6 | −0.30 | 0.14 | 43 | −2.17 | .0356 | |
| Treatment Acol vs. Baca: Generation 1 vs. 6 | −0.87 | 0.46 | 41 | −1.90 | .0640 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 6 | −0.88 | 0.26 | 41 | −3.32 | .0019 | |
| Number of different aphid lines (i.e. H. defensa strains) | (Intercept) | 4.29 | 0.16 | 79 | 27.5 | <.0001 |
| Treatment wasp presence vs. absence | −0.11 | 0.12 | 79 | −0.96 | .3395 | |
| Treatment wasp number | −0.04 | 0.05 | 79 | −0.82 | .4126 | |
| Treatment Seq vs. Sim | 0.12 | 0.16 | 79 | 0.78 | .4392 | |
| Treatment Acol vs. Baca | 0.34 | 0.54 | 79 | 0.63 | .5333 | |
| Treatment Baca vs. Lfab | 0.22 | 0.31 | 79 | 0.70 | .4843 | |
| Generation 1 vs. 3 | −0.99 | 0.22 | 79 | −4.50 | <.0001 | |
| Generation 1 vs. 6 | −2.05 | 0.23 | 79 | −9.03 | <.0001 | |
| Shannon diversity | (Intercept) | 1.11 | 0.05 | 79 | 23.64 | <.0001 |
| Treatment wasp presence vs. absence | −0.03 | 0.03 | 79 | −0.76 | .4466 | |
| Treatment wasp number | <0.01 | 0.02 | 79 | −0.10 | .9193 | |
| Treatment Seq vs. Sim | 0.02 | 0.05 | 79 | 0.38 | .7034 | |
| Treatment Acol vs. Baca | 0.07 | 0.16 | 79 | 0.43 | .6705 | |
| Treatment Baca vs. Lfab | 0.02 | 0.09 | 79 | 0.21 | .8377 | |
| Generation 1 vs. 3 | −0.51 | 0.07 | 79 | −7.75 | <.0001 | |
| Generation 1 vs. 6 | −0.76 | 0.07 | 79 | −11.15 | <.0001 | |
TABLE A3.
Post hoc test to investigate significant interactions for aphid clone identity and diversity. Please note that generation 0 data consisted of the expected equal proportion set up at the beginning of the experiment. Hence, data for generation 0 has been omitted from the results for contrasts between treatment. Significant p‐values have been highlighted in bold.
| Response | Treatment | Estimate 0 | SE 0 | Estimate 3 | SE 3 | Estimate 6 | SE 6 |
|---|---|---|---|---|---|---|---|
| Estimates (estimated marginal means) | |||||||
| Proportion of aphids without H. defensa | Acol | 0.33 | 0.114 | 0.48 | 0.114 | 0.91 | 0.147 |
| Baca | 0.33 | 0.114 | 0.57 | 0.114 | 0.78 | 0.114 | |
| Lfab | 0.33 | 0.114 | 0.51 | 0.114 | 0.31 | 0.114 | |
| NoWasp | 0.33 | 0.114 | 0.65 | 0.114 | 0.76 | 0.114 | |
| Seq | 0.33 | 0.114 | 0.41 | 0.114 | 0.83 | 0.114 | |
| Sim | 0.33 | 0.114 | 0.54 | 0.114 | 0.36 | 0.127 | |
| Proportion of aphids with H. defensa haplotype H76 | Acol | 0.70 | 0.138 | 0.37 | 0.138 | 0.03 | 0.179 |
| Baca | 0.70 | 0.138 | 0.38 | 0.138 | 0.14 | 0.138 | |
| Lfab | 0.70 | 0.138 | 0.67 | 0.138 | 1.03 | 0.138 | |
| NoWasp | 0.70 | 0.138 | 0.36 | 0.138 | 0.15 | 0.138 | |
| Seq | 0.70 | 0.138 | 0.46 | 0.138 | 0.00 | 0.138 | |
| Sim | 0.70 | 0.138 | 0.64 | 0.138 | 0.59 | 0.155 | |
| Response | Treatment | Generation | z 3 | p 3 | z 6 | p 6 |
|---|---|---|---|---|---|---|
| Contrasts between generations for each treatment | ||||||
| Proportion of aphids without H. defensa | Acol | 0 | −1.01 | .575 | −3.35 | .004 |
| 3 | −2.50 | .041 | ||||
| Baca | 0 | −1.65 | .235 | −3.05 | .011 | |
| 3 | −1.39 | .353 | ||||
| Lfab | 0 | −1.19 | .464 | 0.19 | .980 | |
| 3 | 1.38 | .359 | ||||
| NoWasp | 0 | −2.20 | .082 | −2.94 | .014 | |
| 3 | −0.73 | .745 | ||||
| Seq | 0 | −0.49 | .875 | −3.39 | .004 | |
| 3 | −2.89 | .016 | ||||
| Sim | 0 | −1.40 | .350 | −0.16 | .986 | |
| 3 | 1.15 | .491 | ||||
| Proportion of aphids with H. defensa haplotype H76 | Acol | 0 | 1.75 | .197 | 3.07 | .009 |
| 3 | 1.57 | .266 | ||||
| Baca | 0 | 1.73 | .204 | 2.99 | .012 | |
| 3 | 1.26 | .425 | ||||
| Lfab | 0 | 0.16 | .985 | −1.74 | .200 | |
| 3 | −1.91 | .148 | ||||
| NoWasp | 0 | 1.84 | .169 | 2.96 | .013 | |
| 3 | 1.12 | .508 | ||||
| Seq | 0 | 1.27 | .420 | 3.74 | .001 | |
| 3 | 2.47 | .044 | ||||
| Sim | 0 | 0.33 | .940 | 0.53 | .855 | |
| 3 | 0.22 | .974 | ||||
| Response | Contrast | z 3 | p 3 | z 6 | p 6 |
|---|---|---|---|---|---|
| Contrasts between treatments for each generation | |||||
| Proportion of aphids without H. defensa | Acol–Baca | −0.58 | .992 | 0.73 | .978 |
| Acol–Lfab | −0.17 | 1 | 3.26 | .021 | |
| Acol–NoWasp | −1.07 | .890 | 0.81 | .964 | |
| Acol–Seq | 0.46 | .997 | 0.46 | .997 | |
| Acol–Sim | −0.35 | .999 | 2.85 | .062 | |
| Baca–Lfab | 0.41 | .998 | 2.91 | .053 | |
| Baca–NoWasp | −0.50 | .996 | 0.10 | 1 | |
| Baca–Seq | 1.04 | .901 | −0.31 | 1 | |
| Baca–Sim | 0.23 | 1 | 2.45 | .156 | |
| Lfab–NoWasp | −0.91 | .943 | −2.82 | .068 | |
| Lfab–Seq | 0.63 | .988 | −3.22 | .023 | |
| Lfab–Sim | −0.19 | 1 | −0.30 | 1 | |
| NoWasp–Seq | 1.54 | .641 | −0.41 | .998 | |
| NoWasp–Sim | 0.72 | .978 | 2.35 | .188 | |
| Seq–Sim | −0.82 | .964 | 2.74 | .081 | |
| Proportion of aphids with H. defensa haplotype H76 | Acol–Baca | −0.02 | 1 | −0.50 | .996 |
| Acol–Lfab | −1.53 | .649 | −4.42 | <.001 | |
| Acol–NoWasp | 0.08 | 1 | −0.53 | .995 | |
| Acol–Seq | −0.47 | .997 | 0.12 | 1 | |
| Acol–Sim | −1.36 | .749 | −2.39 | .173 | |
| Baca–Lfab | −1.51 | .660 | −4.55 | <.001 | |
| Baca–NoWasp | 0.10 | 1 | −0.04 | 1 | |
| Baca–Seq | −0.45 | .998 | 0.72 | .979 | |
| Baca–Sim | −1.34 | .760 | −2.19 | .256 | |
| Lfab–NoWasp | 1.61 | .596 | 4.52 | <.001 | |
| Lfab–Seq | 1.06 | .895 | 5.27 | <.001 | |
| Lfab–Sim | 0.16 | 1 | 2.09 | .303 | |
| NoWasp–Seq | −0.55 | .994 | 0.75 | .974 | |
| NoWasp–Sim | −1.44 | .700 | −2.16 | .272 | |
| Seq–Sim | −0.90 | .946 | −2.87 | .059 | |
TABLE A4.
Summary of best models for experimental exposures. Significant p‐values have been highlighted in bold.
| Response | Fixed effect | Estimate | SE | t | p |
|---|---|---|---|---|---|
| Mummy number | (Intercept) | 0.81 | 0.19 | 4.17 | <.001 |
| Round after main experiment | −0.05 | 0.13 | −0.36 | .7157 | |
| Number of aphids prior to exposure | 0.04 | 0.01 | 7.31 | <.001 | |
| H. defensa H15 | −1.05 | 0.19 | −5.40 | <.001 | |
| H. defensa H76 | −1.10 | 0.20 | −5.50 | <.001 | |
| Wasp species Baca | −1.06 | 0.22 | −4.79 | <.001 | |
| Wasp species Lfab | 0.21 | 0.20 | 1.04 | .2988 | |
| H. defensa H15: Wasp species Baca | 1.07 | 0.31 | 3.49 | .0006 | |
| H. defensa H76: Wasp species Baca | 0.83 | 0.34 | 2.48 | .014 | |
| H. defensa H15: Wasp species Lfab | 0.90 | 0.28 | 3.18 | .0017 | |
| H. defensa H76: Wasp species Lfab | −0.05 | 0.30 | −0.16 | .870 | |
| Mummification rate | (Intercept) | 0.99 | 0.09 | 10.7 | <.001 |
| Round after main experiment | −0.26 | 0.07 | −3.96 | .0001 | |
| H. defensa H15 | −0.56 | 0.12 | −4.59 | <.001 | |
| H. defensa H76 | −0.72 | 0.13 | −5.71 | <.001 | |
| Wasp species Baca | −0.66 | 0.14 | −4.73 | <.001 | |
| Wasp species Lfab | 0.11 | 0.13 | 0.90 | .3679 | |
| H. defensa H15: Wasp species Baca | 0.59 | 0.19 | 3.07 | .0025 | |
| H. defensa H76: Wasp species Baca | 0.59 | 0.21 | 2.77 | .0063 | |
| H. defensa H15:Wasp species Lfab | 0.46 | 0.18 | 2.56 | .0112 | |
| H. defensa H76: Wasp species Lfab | −0.05 | 0.19 | −0.25 | .8027 | |
| Aphid number | (Intercept) | 0.71 | 0.17 | 4.31 | <.001 |
| Round after main experiment | 0.39 | 0.13 | 3.10 | .0023 | |
| Number of aphids prior to exposure | 0.05 | 0.01 | 9.84 | <.001 | |
| H. defensa H15 | 0.15 | 0.11 | 1.35 | .1774 | |
| H. defensa H76 | −0.09 | 0.12 | −0.70 | .4851 | |
| Wasp species Baca | 1.61 | 0.12 | 13.18 | <.001 | |
| Wasp species Lfab | 1.23 | 0.11 | 11.11 | <.001 | |
| Offspring per healthy aphid | (Intercept) | 0.90 | 0.08 | 11.89 | <.001 |
| Round after main experiment | 0.15 | 0.07 | 2.25 | .0258 | |
| H. defensa H15 | −0.02 | 0.08 | −0.20 | .8387 | |
| H. defensa H76 | −0.23 | 0.08 | −2.84 | .0051 | |
| Wasp species Baca | 0.92 | 0.08 | 11.15 | <.001 | |
| Wasp species Lfab | 0.82 | 0.07 | 10.97 | <.001 |
TABLE A5.
Post hoc test to investigate significant interactions and main effects for experimental exposure tests. Significant p‐values have been highlighted in bold.
| Response | Wasp species | Est. H‐ | SE H‐ | Est. H15 | SE H15 | Est. H76 | SE H76 |
|---|---|---|---|---|---|---|---|
| Estimates (estimated marginal means) | |||||||
| Mummy number | Acol | 1.42 | 0.14 | 0.38 | 0.14 | 0.32 | 0.14 |
| Baca | 0.36 | 0.17 | 0.38 | 0.16 | 0.10 | 0.21 | |
| Lfab | 1.63 | 0.15 | 1.49 | 0.14 | 0.49 | 0.16 | |
| Mummification rate | Acol | 0.86 | 0.09 | 0.30 | 0.09 | 0.14 | 0.09 |
| Baca | 0.20 | 0.11 | 0.23 | 0.10 | 0.07 | 0.13 | |
| Lfab | 0.97 | 0.09 | 0.87 | 0.09 | 0.21 | 0.10 | |
| Aphid number | Overall | 2.66 | 0.08 | 2.81 | 0.08 | 2.57 | 0.09 |
| Offspring per non‐mummified aphid | Overall | 1.55 | 0.06 | 1.54 | 0.05 | 1.32 | 0.06 |
| Est. overall | SE overall | ||||||
| Aphid number | Acol | 1.73 | 0.08 | ||||
| Baca | 3.34 | 0.10 | |||||
| Lfab | 2.96 | 0.08 | |||||
| Offspring per non‐mummified aphid | Acol | 0.89 | 0.05 | ||||
| Baca | 1.81 | 0.06 | |||||
| Lfab | 1.71 | 0.05 | |||||
| Response | Contrast | t H‐ | p H‐ | t H15 | p H15 | t H76 | p H76 |
|---|---|---|---|---|---|---|---|
| Contrasts between wasp species for each H. defensa treatment | |||||||
| Mummy number | Acol–Baca | 4.79 | <.001 | −0.03 | .999 | 0.89 | .649 |
| Acol–Lfab | −1.04 | .551 | −5.61 | <.001 | −0.74 | .738 | |
| Baca–Lfab | −5.59 | <.001 | −5.08 | <.001 | −1.46 | .312 | |
| Mummification rate | Acol–Baca | 4.73 | <.001 | 0.50 | .872 | 0.45 | .892 |
| Acol–Lfab | −0.90 | .639 | −4.59 | <.001 | −0.50 | .873 | |
| Baca–Lfab | −5.40 | <.001 | −4.66 | <.001 | −0.84 | .676 | |
| t Overall | p Overall | ||||||
| Aphid number | Acol–Baca | −13.18 | <.001 | ||||
| Acol–Lfab | −11.11 | <.001 | |||||
| Baca–Lfab | 3.01 | .008 | |||||
| Offspring per non‐mummified aphid | Acol–Baca | −11.15 | <.001 | ||||
| Acol–Lfab | −10.97 | <.001 | |||||
| Baca–Lfab | 1.19 | .460 | |||||
| Response | Contrast | t Acol | p Acol | t Baca | p Baca | t Lfab | p Lfab |
|---|---|---|---|---|---|---|---|
| Contrasts between H. defensa treatments for each wasp species | |||||||
| Mummy number | H‐ – H15 | 5.40 | <.001 | −0.08 | .996 | 0.71 | .757 |
| H‐ – H76 | 5.50 | <.001 | 0.97 | .596 | 5.21 | <.001 | |
| H15 – H76 | 0.26 | .963 | 1.07 | .534 | 4.59 | <.001 | |
| Mummification rate | H‐ – H15 | 4.59 | <.001 | −0.23 | .972 | 0.79 | .707 |
| H‐ – H76 | 5.71 | <.001 | 0.77 | .724 | 5.53 | <.001 | |
| H15 – H76 | 1.28 | .411 | 0.99 | .585 | 4.83 | <.001 | |
| t Overall | p Overall | ||||||
| Aphid number | H‐ – H15 | −1.35 | .367 | ||||
| H‐ – H76 | 0.07 | .764 | |||||
| H15 – H76 | 1.97 | .123 | |||||
| Offspring per non‐mummified aphid | H‐ – H15 | 0.20 | .977 | ||||
| H‐ – H76 | 2.84 | .014 | |||||
| H15 – H76 | 2.70 | .021 | |||||
TABLE A6.
Calculated and estimated beta‐diversity. Estimated beta‐diversity and confidence intervals have been obtained through bootstrapping.
| Treatment | Generation | Beta, measured | Beta, estimated | Lower CI | Upper CI |
|---|---|---|---|---|---|
| NoWasp | 3 | 1.15 | 1.16 | 1.02 | 1.39 |
| Acol | 3 | 1.36 | 1.37 | 1.24 | 1.65 |
| Baca | 3 | 1.25 | 1.26 | 1.09 | 1.54 |
| Lfab | 3 | 1.15 | 1.16 | 1.08 | 1.38 |
| Seq | 3 | 1.07 | 1.08 | 0.97 | 1.31 |
| Sim | 3 | 1.50 | 1.51 | 1.39 | 1.71 |
| NoWasp | 6 | 1.50 | 1.50 | 1.21 | 1.60 |
| Acol | 6 | 1.20 | 1.21 | 0.90 | 1.37 |
| Baca | 6 | 1.50 | 1.51 | 1.35 | 1.85 |
| Lfab | 6 | 1.25 | 1.26 | 1.18 | 1.55 |
| Seq | 6 | 1.25 | 1.26 | 1.18 | 1.55 |
| Sim | 6 | 1.50 | 1.50 | 1.47 | 1.67 |
TABLE A7.
Summary of the best model in each case for population dynamics. Significant p‐values have been highlighted in bold.
| Response | Random effect | Variance | SD |
|---|---|---|---|
| Random effects | |||
| Mummy Number | ID | 0.17 | 0.42 |
| Residual | 1.02 | 1.01 | |
| Mummification rate | ID | 0000 | 0.02 |
| Residual | 0.01 | 0.08 | |
| Aphid number | ID | 1.34 | 1.16 |
| Residual | 8.72 | 2.95 | |
| Plant size | ID | 6.07 | 2.46 |
| Residual | 59.71 | 7.73 | |
| Response | Fixed effect | Estimate | SE | df | t | p |
|---|---|---|---|---|---|---|
| Fixed effects | ||||||
| Mummy Number | (Intercept) | 3.56 | 0.22 | 108 | 16.27 | <.0001 |
| Treatment wasp number | −0.19 | 0.09 | 108 | −2.17 | .0325 | |
| Treatment Seq vs. Sim | −1.37 | 0.35 | 108 | −3.96 | .0001 | |
| Treatment Acol vs. Baca | 1.35 | 0.40 | 108 | 3.39 | .0010 | |
| Treatment Baca vs. Lfab | −0.82 | 0.40 | 108 | −2.05 | .0424 | |
| Generation 1 vs. 2 | 0.04 | 0.29 | 100 | 0.14 | .8910 | |
| Generation 1 vs. 3 | −0.65 | 0.29 | 100 | −2.26 | .0260 | |
| Generation 1 vs. 4 | −0.45 | 0.29 | 100 | −1.56 | .1210 | |
| Generation 1 vs. 5 | −0.82 | 0.29 | 100 | −2.85 | .0053 | |
| Generation 1 vs. 6 | −1.23 | 0.29 | 100 | −4.29 | <.0001 | |
| Treatment wasp number: Generation 1 vs. 2 | 0.24 | 0.12 | 100 | 2.08 | .0399 | |
| Treatment Seq vs. Sim: Generation 1 vs. 2 | 1.72 | 0.45 | 100 | 3.79 | .0003 | |
| Treatment Acol vs. Baca: Generation 1 vs. 2 | −1.30 | 0.52 | 100 | −2.49 | .0144 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 2 | −0.36 | 0.52 | 100 | −0.68 | .4980 | |
| Treatment wasp number: Generation 1 vs. 3 | 0.20 | 0.12 | 100 | 1.72 | .0882 | |
| Treatment Seq vs. Sim: Generation 1 vs. 3 | 1.41 | 0.45 | 100 | 3.12 | .0024 | |
| Treatment Acol vs. Baca: Generation 1 vs. 3 | −1.71 | 0.52 | 100 | −3.28 | .0014 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 3 | −0.49 | 0.52 | 100 | −0.93 | .3537 | |
| Treatment wasp number: Generation 1 vs. 4 | 0.02 | 0.12 | 100 | 0.20 | .8418 | |
| Treatment Seq vs. Sim: Generation 1 vs. 4 | 1.06 | 0.45 | 100 | 2.34 | .0211 | |
| Treatment Acol vs. Baca: Generation 1 vs. 4 | −1.58 | 0.52 | 100 | −3.02 | .0032 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 4 | −0.51 | 0.52 | 100 | −0.98 | .3288 | |
| Treatment wasp number: Generation 1 vs. 5 | 0.08 | 0.12 | 100 | 0.72 | .4720 | |
| Treatment Seq vs. Sim: Generation 1 vs. 5 | 1.55 | 0.45 | 100 | 3.43 | .0009 | |
| Treatment Acol vs. Baca: Generation 1 vs. 5 | −2.66 | 0.52 | 100 | −5.09 | <.0001 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 5 | −1.11 | 0.52 | 100 | −2.12 | .0363 | |
| Treatment wasp number: Generation 1 vs. 6 | 0.31 | 0.12 | 100 | 2.64 | .0095 | |
| Treatment Seq vs. Sim: Generation 1 vs. 6 | 2.02 | 0.45 | 100 | 4.46 | <.0001 | |
| Treatment Acol vs. Baca: Generation 1 vs. 6 | −2.58 | 0.52 | 100 | −4.94 | <.0001 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 6 | −0.89 | 0.52 | 100 | −1.71 | .0898 | |
| Mummification rate | (Intercept) | 0.61 | 0.02 | 109 | 35.33 | <.0001 |
| Treatment wasp number | −0.01 | 0.01 | 109 | −1.37 | .1747 | |
| Treatment Seq vs. Sim | −0.12 | 0.03 | 109 | −4.26 | <.0001 | |
| Treatment Acol vs. Baca | 0.16 | 0.03 | 109 | 5.23 | <.0001 | |
| Treatment Baca vs. Lfab | −0.02 | 0.03 | 109 | −0.75 | .4535 | |
| Generation 1 vs. 2 | 0.17 | 0.02 | 93 | 7.12 | <.0001 | |
| Generation 1 vs. 3 | 0.03 | 0.02 | 93 | 1.44 | .1518 | |
| Generation 1 vs. 4 | 0.09 | 0.02 | 92 | 3.69 | .0004 | |
| Generation 1 vs. 5 | 0.07 | 0.02 | 94 | 2.77 | .0067 | |
| Generation 1 vs. 6 | 0.07 | 0.02 | 96 | 2.98 | .0037 | |
| Treatment wasp number: Generation 1 vs. 2 | 0.03 | 0.01 | 93 | 2.89 | .0049 | |
| Treatment Seq vs. Sim: Generation 1 vs. 2 | 0.20 | 0.04 | 94 | 5.19 | <.0001 | |
| Treatment Acol vs. Baca: Generation 1 vs. 2 | −0.08 | 0.04 | 92 | −1.98 | .0504 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 2 | −0.02 | 0.04 | 92 | −0.41 | .6819 | |
| Treatment wasp number: Generation 1 vs. 3 | 0.03 | 0.01 | 93 | 3.40 | .0010 | |
| Treatment Seq vs. Sim: Generation 1 vs. 3 | 0.18 | 0.04 | 94 | 4.83 | <.0001 | |
| Treatment Acol vs. Baca: Generation 1 vs. 3 | −0.08 | 0.04 | 94 | −1.71 | .0914 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 3 | −0.01 | 0.04 | 93 | −0.19 | .8467 | |
| Treatment wasp number: Generation 1 vs. 4 | 0.00 | 0.01 | 92 | −0.11 | .9144 | |
| Treatment Seq vs. Sim: Generation 1 vs. 4 | 0.08 | 0.04 | 92 | 2.14 | .0350 | |
| Treatment Acol vs. Baca: Generation 1 vs. 4 | −0.09 | 0.04 | 92 | −2.04 | .0444 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 4 | −0.04 | 0.04 | 92 | −1.00 | .3204 | |
| Treatment wasp number: Generation 1 vs. 5 | 0.03 | 0.01 | 94 | 3.17 | .0020 | |
| Treatment Seq vs. Sim: Generation 1 vs. 5 | 0.12 | 0.04 | 95 | 3.13 | .0023 | |
| Treatment Acol vs. Baca: Generation 1 vs. 5 | −0.10 | 0.04 | 94 | −2.28 | .0250 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 5 | −0.01 | 0.04 | 93 | −0.16 | .8747 | |
| Treatment wasp number: Generation 1 vs. 6 | 0.05 | 0.01 | 96 | 4.68 | <.0001 | |
| Treatment Seq vs. Sim: Generation 1 vs. 6 | 0.15 | 0.04 | 97 | 3.76 | .0003 | |
| Treatment Acol vs. Baca: Generation 1 vs. 6 | −0.19 | 0.05 | 97 | −4.03 | .0001 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 6 | −0.06 | 0.04 | 93 | −1.32 | .1916 | |
| Aphid number | (Intercept) | 15.96 | 0.58 | 131 | 27.55 | <.0001 |
| Treatment wasp presence vs. absence | −0.70 | 0.74 | 131 | −0.95 | .3456 | |
| Treatment wasp number | −0.35 | 0.35 | 131 | −1.01 | .3165 | |
| Treatment Seq vs. Sim | 2.24 | 1.00 | 131 | 2.23 | .0274 | |
| Treatment Acol vs. Baca | 0.14 | 3.48 | 131 | 0.04 | .9682 | |
| Treatment Baca vs. Lfab | −0.08 | 2.01 | 131 | −0.04 | .9685 | |
| Generation 1 vs. 2 | −6.88 | 0.77 | 120 | −8.92 | <.0001 | |
| Generation 1 vs. 3 | −3.00 | 0.76 | 119 | −3.93 | .0001 | |
| Generation 1 vs. 4 | −5.67 | 0.76 | 119 | −7.44 | <.0001 | |
| Generation 1 vs. 5 | −4.80 | 0.76 | 119 | −6.30 | <.0001 | |
| Generation 1 vs. 6 | −6.82 | 0.76 | 119 | −8.94 | <.0001 | |
| Treatment wasp presence vs. absence: Generation1 vs. 2 | −1.35 | 1.02 | 121 | −1.32 | .1887 | |
| Treatment wasp number: Generation 1 vs. 2 | −0.95 | 0.48 | 121 | −1.99 | .0485 | |
| Treatment Seq vs. Sim: Generation 1 vs. 2 | −3.47 | 1.32 | 119 | −2.63 | .0096 | |
| Treatment Acol vs. Baca: Generation 1 vs. 2 | 7.99 | 4.78 | 121 | 1.67 | .0969 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 2 | 3.44 | 2.73 | 121 | 1.26 | .2098 | |
| Treatment wasp presence vs. absence: Generation1 vs. 3 | −0.22 | 0.98 | 119 | −0.23 | .8190 | |
| Treatment wasp number: Generation 1 vs. 3 | −1.20 | 0.46 | 119 | −2.63 | .0096 | |
| Treatment Seq vs. Sim: Generation 1 vs. 3 | −5.01 | 1.32 | 119 | −3.80 | .0002 | |
| Treatment Acol vs. Baca: Generation 1 vs. 3 | 1.34 | 4.57 | 119 | 0.29 | .7696 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 3 | 0.29 | 2.64 | 119 | 0.11 | .9122 | |
| Treatment wasp presence vs. absence: Generation1 vs. 4 | −0.96 | 0.98 | 119 | −0.99 | .3257 | |
| Treatment wasp number: Generation 1 vs. 4 | −0.44 | 0.46 | 119 | −0.95 | .3421 | |
| Treatment Seq vs. Sim: Generation 1 vs. 4 | −1.27 | 1.32 | 119 | −0.96 | .3379 | |
| Treatment Acol vs. Baca: Generation 1 vs. 4 | 4.38 | 4.57 | 119 | 0.96 | .3406 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 4 | 2.94 | 2.64 | 119 | 1.11 | .2679 | |
| Treatment wasp presence vs. absence: Generation1 vs. 5 | −1.16 | 0.98 | 119 | −1.19 | .2374 | |
| Treatment wasp number: Generation 1 vs. 5 | −1.72 | 0.46 | 119 | −3.75 | .0003 | |
| Treatment Seq vs. Sim: Generation 1 vs. 5 | −2.24 | 1.32 | 119 | −1.70 | .0918 | |
| Treatment Acol vs. Baca: Generation 1 vs. 5 | 3.16 | 4.57 | 119 | 0.69 | .4909 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 5 | 0.12 | 2.64 | 119 | 0.05 | .9632 | |
| Treatment wasp presence vs. absence: Generation1 vs. 6 | −2.35 | 0.98 | 119 | −2.40 | .0178 | |
| Treatment wasp number: Generation 1 vs. 6 | −1.78 | 0.46 | 119 | −3.89 | .0002 | |
| Treatment Seq vs. Sim: Generation 1 vs. 6 | −1.46 | 1.32 | 119 | −1.11 | .2699 | |
| Treatment Acol vs. Baca: Generation 1 vs. 6 | 10.6 | 4.57 | 119 | 2.32 | .0222 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 6 | 5.14 | 2.64 | 119 | 1.95 | .0539 | |
| Plant size | (Intercept) | 69.63 | 1.48 | 137 | 47.03 | <.0001 |
| Treatment wasp presence vs. absence | 2.71 | 1.90 | 137 | 1.43 | .1547 | |
| Treatment wasp number | 1.66 | 0.89 | 137 | 1.87 | .0638 | |
| Treatment Seq vs. Sim | −5.30 | 2.56 | 137 | −2.07 | .0407 | |
| Treatment Acol vs. Baca | −9.60 | 8.88 | 137 | −1.08 | .2818 | |
| Treatment Baca vs. Lfab | −4.00 | 5.13 | 137 | −0.78 | .4368 | |
| Generation 1 vs. 2 | 13.98 | 2.02 | 120 | 6.93 | <.0001 | |
| Generation 1 vs. 3 | −3.03 | 2.00 | 119 | −1.52 | .1311 | |
| Generation 1 vs. 4 | −1.53 | 2.00 | 119 | −0.77 | .4437 | |
| Generation 1 vs. 5 | −8.67 | 2.00 | 119 | −4.34 | <.0001 | |
| Generation 1 vs. 6 | −1.80 | 2.00 | 119 | −0.90 | .3688 | |
| Treatment wasp presence vs. absence: Generation1 vs. 2 | 1.33 | 2.67 | 121 | 0.50 | .6192 | |
| Treatment wasp number: Generation 1 vs. 2 | 0.58 | 1.25 | 121 | 0.47 | .6415 | |
| Treatment Seq vs. Sim: Generation 1 vs. 2 | 4.80 | 3.46 | 119 | 1.39 | .1674 | |
| Treatment Acol vs. Baca: Generation 1 vs. 2 | −10.43 | 12.49 | 121 | −0.84 | .4053 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 2 | −6.12 | 7.14 | 121 | −0.86 | .3933 | |
| Treatment wasp presence vs. absence: Generation1 vs. 3 | −2.79 | 2.55 | 119 | −1.09 | .2765 | |
| Treatment wasp number: Generation 1 vs. 3 | 0.88 | 1.20 | 119 | 0.74 | .4637 | |
| Treatment Seq vs. Sim: Generation 1 vs. 3 | 1.10 | 3.46 | 119 | 3.18 | .0019 | |
| Treatment Acol vs. Baca: Generation 1 vs. 3 | 14.4 | 11.97 | 119 | 1.20 | .2314 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 3 | 9.60 | 6.91 | 119 | 1.39 | .1674 | |
| Treatment wasp presence vs. absence: Generation1 vs. 4 | −2.77 | 2.55 | 119 | −1.09 | .2799 | |
| Treatment wasp number: Generation 1 vs. 4 | −2.78 | 1.20 | 119 | −2.32 | .0219 | |
| Treatment Seq vs. Sim: Generation 1 vs. 4 | 5.10 | 3.46 | 119 | 1.48 | .1426 | |
| Treatment Acol vs. Baca: Generation 1 vs. 4 | 17.8 | 11.97 | 119 | 1.49 | .1397 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 4 | 3.00 | 6.91 | 119 | 0.43 | .6650 | |
| Treatment wasp presence vs. absence: Generation1 vs. 5 | −1.59 | 2.55 | 119 | −0.62 | .5358 | |
| Treatment wasp number: Generation 1 vs. 5 | 0.26 | 1.20 | 119 | 0.22 | .8284 | |
| Treatment Seq vs. Sim: Generation 1 vs. 5 | 2.10 | 3.46 | 119 | 0.61 | .5445 | |
| Treatment Acol vs. Baca: Generation 1 vs. 5 | 10.8 | 11.97 | 119 | 0.90 | .3688 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 5 | 7.20 | 6.91 | 119 | 1.04 | .2996 | |
| Treatment wasp presence vs. absence: Generation1 vs. 6 | 0.68 | 2.55 | 119 | 0.27 | .7906 | |
| Treatment wasp number: Generation 1 vs. 6 | 0.86 | 1.20 | 119 | 0.72 | .4739 | |
| Treatment Seq vs. Sim: Generation 1 vs. 6 | 1.50 | 3.46 | 119 | 0.43 | .6650 | |
| Treatment Acol vs. Baca: Generation 1 vs. 6 | −2.80 | 11.97 | 119 | −0.23 | .8155 | |
| Treatment Baca vs. Lfab: Generation 1 vs. 6 | −1.60 | 6.91 | 119 | −0.23 | .8173 | |
TABLE A8.
Post hoc test to investigate significant interactions for population dynamics. Significant p‐values have been highlighted in bold.
| Response | Treatment | Estimate1 | SE1 | Estimate2 | SE2 | Estimate3 | SE3 | Estimate4 | SE4 | Estimate5 | SE5 | Estimate6 | SE6 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Estimates (estimated marginal means) | |||||||||||||
| Mummy number | Acol | 5.30 | 0.490 | 3.55 | 0.490 | 2.54 | 0.490 | 3.23 | 0.490 | 1.66 | 0.490 | 0.87 | 0.490 |
| Baca | 1.77 | 0.490 | 2.27 | 0.490 | 1.95 | 0.490 | 2.35 | 0.490 | 2.34 | 0.490 | 1.62 | 0.490 | |
| Lfab | 4.77 | 0.490 | 4.68 | 0.490 | 4.21 | 0.490 | 4.79 | 0.490 | 4.89 | 0.490 | 3.82 | 0.490 | |
| Seq | 1.61 | 0.490 | 4.09 | 0.490 | 2.98 | 0.490 | 2.29 | 0.490 | 2.60 | 0.490 | 3.33 | 0.490 | |
| Sim | 4.35 | 0.490 | 3.40 | 0.490 | 2.90 | 0.490 | 2.91 | 0.490 | 2.24 | 0.490 | 2.03 | 0.490 | |
| Mummification rate | Acol | 0.79 | 0.038 | 0.82 | 0.038 | 0.69 | 0.042 | 0.80 | 0.038 | 0.70 | 0.042 | 0.58 | 0.049 |
| Baca | 0.45 | 0.038 | 0.63 | 0.038 | 0.48 | 0.038 | 0.58 | 0.038 | 0.55 | 0.038 | 0.56 | 0.038 | |
| Lfab | 0.66 | 0.038 | 0.78 | 0.038 | 0.63 | 0.038 | 0.79 | 0.038 | 0.67 | 0.038 | 0.69 | 0.038 | |
| Seq | 0.46 | 0.042 | 0.91 | 0.038 | 0.78 | 0.038 | 0.63 | 0.042 | 0.75 | 0.038 | 0.83 | 0.042 | |
| Sim | 0.70 | 0.038 | 0.76 | 0.038 | 0.66 | 0.038 | 0.71 | 0.038 | 0.74 | 0.042 | 0.77 | 0.042 | |
| Aphid number | Acol | 12.59 | 1.419 | 6.95 | 1.419 | 9.81 | 1.419 | 6.47 | 1.419 | 5.15 | 1.419 | 4.64 | 1.419 |
| Baca | 17.14 | 1.419 | 8.97 | 1.419 | 15.72 | 1.419 | 11.87 | 1.419 | 13.89 | 1.419 | 10.77 | 1.419 | |
| Lfab | 17.44 | 1.419 | 10.38 | 1.419 | 16.78 | 1.419 | 10.66 | 1.419 | 17.11 | 1.419 | 11.38 | 1.419 | |
| NoWasp | 17.36 | 1.419 | 13.74 | 1.580 | 16.99 | 1.419 | 13.52 | 1.419 | 17.15 | 1.419 | 16.45 | 1.419 | |
| Seq | 17.85 | 1.419 | 5.99 | 1.419 | 6.45 | 1.419 | 10.56 | 1.419 | 6.81 | 1.419 | 6.58 | 1.419 | |
| Sim | 13.38 | 1.419 | 8.46 | 1.419 | 12.01 | 1.419 | 8.63 | 1.419 | 6.83 | 1.419 | 5.03 | 1.419 | |
| Plant size | Acol | 73.60 | 3.627 | 83.80 | 3.627 | 71.00 | 3.627 | 76.00 | 3.627 | 67.80 | 3.627 | 72.40 | 3.627 |
| Baca | 69.20 | 3.627 | 85.00 | 3.627 | 62.40 | 3.627 | 61.20 | 3.627 | 58.00 | 3.627 | 66.20 | 3.627 | |
| Lfab | 67.60 | 3.627 | 85.20 | 3.627 | 56.00 | 3.627 | 71.40 | 3.627 | 52.80 | 3.627 | 65.00 | 3.627 | |
| NoWasp | 63.60 | 3.627 | 75.08 | 4.050 | 61.60 | 3.627 | 70.40 | 3.627 | 56.00 | 3.627 | 59.40 | 3.627 | |
| Seq | 66.60 | 3.627 | 85.80 | 3.627 | 80.00 | 3.627 | 64.60 | 3.627 | 62.40 | 3.627 | 68.20 | 3.627 | |
| Sim | 77.20 | 3.627 | 86.80 | 3.627 | 68.60 | 3.627 | 65.00 | 3.627 | 68.80 | 3.627 | 75.80 | 3.627 | |
| Response | Treatment | Generation | z2 | p2 | z3 | p3 | z4 | p4 | z5 | p5 | z6 | p6 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Contrasts between generations for each treatment | ||||||||||||
| Mummy number | Acol | 1 | 2.73 | .078 | 4.32 | .001 | 3.24 | .020 | 5.69 | <.001 | 6.92 | <.001 |
| Acol | 2 | 1.58 | .612 | 0.51 | .996 | 2.96 | .043 | 4.19 | .001 | |||
| Acol | 3 | −1.08 | .890 | 1.38 | .741 | 2.60 | .106 | |||||
| Acol | 4 | 2.45 | .149 | 3.68 | .005 | |||||||
| Acol | 5 | 1.23 | .822 | |||||||||
| Baca | 1 | −0.78 | .970 | −0.28 | 1 | −0.89 | .947 | −0.88 | .950 | 0.24 | 1 | |
| Baca | 2 | 0.50 | .996 | −0.11 | 1 | −0.10 | 1 | 1.02 | .909 | |||
| Baca | 3 | −0.62 | .989 | −0.61 | .990 | 0.52 | .995 | |||||
| Baca | 4 | 0.01 | 1 | 1.14 | .865 | |||||||
| Baca | 5 | 1.13 | .870 | |||||||||
| Lfab | 1 | 0.14 | 1 | 0.88 | .951 | −0.03 | 1 | −0.19 | 1 | 1.48 | .675 | |
| Lfab | 2 | 0.74 | .977 | −0.17 | 1 | −0.34 | .999 | 1.34 | .762 | |||
| Lfab | 3 | −0.91 | .944 | −1.07 | .891 | 0.61 | .990 | |||||
| Lfab | 4 | −0.17 | 1 | 1.51 | .657 | |||||||
| Lfab | 5 | 1.68 | .549 | |||||||||
| Seq | 1 | −3.88 | .002 | −2.14 | .277 | −1.07 | .893 | −1.55 | .635 | −2.68 | .088 | |
| Seq | 2 | 1.75 | .504 | 2.82 | .063 | 2.34 | .189 | 1.20 | .835 | |||
| Seq | 3 | 1.07 | .892 | 0.59 | .991 | −0.55 | .994 | |||||
| Seq | 4 | −0.48 | .997 | −1.62 | .590 | |||||||
| Seq | 5 | −1.14 | .865 | |||||||||
| Sim | 1 | 1.48 | .677 | 2.27 | .215 | 2.25 | .226 | 3.31 | .016 | 3.62 | .006 | |
| Sim | 2 | 0.79 | .968 | 0.77 | .973 | 1.82 | .455 | 2.14 | .275 | |||
| Sim | 3 | −0.03 | 1 | 1.03 | .906 | 1.35 | .756 | |||||
| Sim | 4 | 1.06 | .897 | 1.38 | .742 | |||||||
| Sim | 5 | 0.32 | 1 | |||||||||
| Mummification rate | Acol | 1 | −0.53 | .995 | 1.94 | .386 | −0.07 | 1 | 1.75 | .503 | 3.49 | .009 |
| Acol | 2 | 2.44 | .154 | 0.46 | .997 | 2.25 | .225 | 3.94 | .002 | |||
| Acol | 3 | −2000 | .348 | −0.18 | 1 | 1.63 | .580 | |||||
| Acol | 4 | 1.82 | .461 | 3.55 | .008 | |||||||
| Acol | 5 | 1.82 | .461 | |||||||||
| Baca | 1 | −3.44 | .011 | −0.68 | .984 | −2.58 | .112 | −1.89 | .418 | −2.13 | .281 | |
| Baca | 2 | 2.76 | .074 | 0.85 | .956 | 1.55 | .633 | 1.30 | .782 | |||
| Baca | 3 | −1.90 | .407 | −1.21 | .833 | −1.45 | .696 | |||||
| Baca | 4 | 0.70 | .982 | 0.45 | .998 | |||||||
| Baca | 5 | −0.25 | 1 | |||||||||
| Lfab | 1 | −2.49 | .139 | 0.45 | .998 | −2.55 | .121 | −0.21 | 1 | −0.69 | .983 | |
| Lfab | 2 | 2.94 | .046 | −0.06 | 1 | 2.28 | .212 | 1.80 | .471 | |||
| Lfab | 3 | −3000 | .039 | −0.66 | .986 | −1.14 | .863 | |||||
| Lfab | 4 | 2.34 | .188 | 1.86 | .432 | |||||||
| Lfab | 5 | −0.48 | .997 | |||||||||
| Seq | 1 | −8.09 | <.001 | −5.73 | <.001 | −2.90 | .052 | −5.13 | <.001 | −6.30 | <.001 | |
| Seq | 2 | 2.52 | .128 | 5.06 | <.001 | 3.16 | .025 | 1.42 | .717 | |||
| Seq | 3 | 2.69 | .087 | 0.64 | .988 | −0.95 | .932 | |||||
| Seq | 4 | −2.09 | .301 | −3.43 | .011 | |||||||
| Seq | 5 | −1.55 | .634 | |||||||||
| Sim | 1 | −1.05 | .900 | 0.95 | .933 | −0.03 | 1 | −0.70 | .981 | −1.20 | .834 | |
| Sim | 2 | 2000 | .352 | 1.02 | .909 | 0.28 | 1 | −0.22 | 1 | |||
| Sim | 3 | −0.97 | .925 | −1.59 | .605 | −2.09 | .299 | |||||
| Sim | 4 | −0.68 | .984 | −1.18 | .846 | |||||||
| Sim | 5 | −0.48 | .997 | |||||||||
| Aphid number | Acol | 1 | 3.02 | .036 | 1.49 | .674 | 3.27 | .017 | 3.98 | .002 | 4.26 | .001 |
| Acol | 2 | −1.53 | .645 | 0.26 | 1 | 0.97 | .927 | 1.24 | .815 | |||
| Acol | 3 | 1.79 | .477 | 2.50 | .133 | 2.77 | .069 | |||||
| Acol | 4 | 0.71 | .980 | 0.98 | .922 | |||||||
| Acol | 5 | 0.27 | 1 | |||||||||
| Baca | 1 | 4.38 | <.001 | 0.76 | .974 | 2.82 | .060 | 1.74 | .508 | 3.41 | .011 | |
| Baca | 2 | −3.62 | .006 | −1.55 | .631 | −2.64 | .097 | −0.97 | .928 | |||
| Baca | 3 | 2.06 | .313 | 0.98 | .923 | 2.65 | .093 | |||||
| Baca | 4 | −1.08 | .887 | 0.59 | .992 | |||||||
| Baca | 5 | 1.67 | .554 | |||||||||
| Lfab | 1 | 3.78 | .003 | 0.35 | .999 | 3.63 | .006 | 0.18 | 1 | 3.24 | .019 | |
| Lfab | 2 | −3.43 | .011 | −0.15 | 1 | −3.60 | .006 | −0.54 | .994 | |||
| Lfab | 3 | 3.28 | .017 | −0.17 | 1 | 2.89 | .051 | |||||
| Lfab | 4 | −3.45 | .010 | −0.39 | .999 | |||||||
| Lfab | 5 | 3.06 | .032 | |||||||||
| NoWasp | 1 | 1.82 | .458 | 0.20 | 1 | 2.05 | .318 | 0.11 | 1 | 0.49 | .996 | |
| NoWasp | 2 | −1.63 | .578 | 0.11 | 1 | −1.71 | .527 | −1.36 | .750 | |||
| NoWasp | 3 | 1.86 | .433 | −0.08 | 1 | 0.29 | 1 | |||||
| NoWasp | 4 | −1.94 | .383 | −1.57 | .622 | |||||||
| NoWasp | 5 | 0.37 | .999 | |||||||||
| Seq | 1 | 6.35 | <.001 | 6.10 | <.001 | 3.90 | .002 | 5.91 | <.001 | 6.03 | <.001 | |
| Seq | 2 | −0.25 | 1 | −2.45 | .149 | −0.44 | .998 | −0.32 | 1 | |||
| Seq | 3 | −2.20 | .245 | −0.19 | 1 | −0.07 | 1 | |||||
| Seq | 4 | 2.01 | .344 | 2.13 | .279 | |||||||
| Seq | 5 | 0.12 | 1 | |||||||||
| Sim | 1 | 2.63 | .098 | 0.73 | .977 | 2.54 | .120 | 3.51 | .008 | 4.47 | <.001 | |
| Sim | 2 | −1.90 | .410 | −0.09 | 1 | 0.88 | .951 | 1.84 | .446 | |||
| Sim | 3 | 1.81 | .464 | 2.77 | .069 | 3.73 | .004 | |||||
| Sim | 4 | 0.96 | .928 | 1.92 | .393 | |||||||
| Sim | 5 | 0.96 | .930 | |||||||||
| Plant size | Acol | 1 | −2.09 | .301 | 0.53 | .995 | −0.49 | .996 | 1.19 | .842 | 0.25 | 1 |
| Acol | 2 | 2.62 | .101 | 1.60 | .603 | 3.27 | .017 | 2.33 | .189 | |||
| Acol | 3 | −1.02 | .909 | 0.65 | .986 | −0.29 | 1 | |||||
| Acol | 4 | 1.68 | .549 | 0.74 | .977 | |||||||
| Acol | 5 | −0.94 | .935 | |||||||||
| Baca | 1 | −3.23 | .019 | 1.39 | .732 | 1.64 | .576 | 2.29 | .206 | 0.61 | .990 | |
| Baca | 2 | 4.62 | <.001 | 4.87 | <.001 | 5.52 | <.001 | 3.85 | .003 | |||
| Baca | 3 | 0.25 | 1 | 0.90 | .946 | −0.78 | .971 | |||||
| Baca | 4 | 0.65 | .986 | −1.02 | .909 | |||||||
| Baca | 5 | −1.68 | .549 | |||||||||
| Lfab | 1 | −3.60 | .006 | 2.37 | .174 | −0.78 | .971 | 3.03 | .035 | 0.53 | .995 | |
| Lfab | 2 | 5.98 | <.001 | 2.82 | .061 | 6.63 | <.001 | 4.13 | .001 | |||
| Lfab | 3 | −3.15 | .025 | 0.65 | .986 | −1.84 | .443 | |||||
| Lfab | 4 | 3.81 | .003 | 1.31 | .779 | |||||||
| Lfab | 5 | −2.50 | .133 | |||||||||
| NoWasp | 1 | −2.20 | .243 | 0.41 | .998 | −1.39 | .732 | 1.56 | .629 | 0.86 | .955 | |
| NoWasp | 2 | 2.59 | .108 | 0.90 | .946 | 3.66 | .005 | 3.01 | .036 | |||
| NoWasp | 3 | −1.80 | .469 | 1.15 | .861 | 0.45 | .998 | |||||
| NoWasp | 4 | 2.95 | .044 | 2.25 | .223 | |||||||
| NoWasp | 5 | −0.70 | .982 | |||||||||
| Seq | 1 | −3.93 | .002 | −2.74 | .075 | 0.41 | .998 | 0.86 | .955 | −0.33 | .999 | |
| Seq | 2 | 1.19 | .842 | 4.34 | <.001 | 4.79 | <.001 | 3.60 | .006 | |||
| Seq | 3 | 3.15 | .025 | 3.60 | .006 | 2.41 | .160 | |||||
| Seq | 4 | 0.45 | .998 | −0.74 | .977 | |||||||
| Seq | 5 | −1.19 | .842 | |||||||||
| Sim | 1 | −1.96 | .369 | 1.76 | .496 | 2.50 | .133 | 1.72 | .522 | 0.29 | 1 | |
| Sim | 2 | 3.72 | .004 | 4.46 | <.001 | 3.68 | .005 | 2.25 | .223 | |||
| Sim | 3 | 0.74 | .977 | −0.04 | 1 | −1.47 | .682 | |||||
| Sim | 4 | −0.78 | .971 | −2.21 | .241 | |||||||
| Sim | 5 | −1.43 | .707 | |||||||||
| Response | Contrast | z 1 | p 1 | z 2 | p 2 | z 3 | p 3 | z 4 | p 4 | z 5 | p 5 | z 6 | p 6 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Contrasts between treatments for each generation | |||||||||||||
| Mummy number | Acol–Baca | 5.09 | <.001 | 1.85 | .351 | 0.85 | .913 | 1.28 | .707 | −0.98 | .864 | −1.07 | .819 |
| Acol–Lfab | 0.77 | .939 | −1.62 | .486 | −2.41 | .121 | −2.25 | .169 | −4.67 | <.001 | −4.25 | <.001 | |
| Acol–Seq | 5.33 | <.001 | −0.78 | .935 | −0.63 | .970 | 1.35 | .659 | −1.36 | .656 | −3.54 | .005 | |
| Acol–Sim | 1.37 | .647 | 0.22 | 1 | −0.52 | .986 | 0.46 | .991 | −0.83 | .920 | −1.68 | .453 | |
| Baca–Lfab | −4.33 | <.001 | −3.47 | .007 | −3.26 | .013 | −3.53 | .005 | −3.69 | .003 | −3.18 | .016 | |
| Baca–Seq | 0.24 | .999 | −2.63 | .072 | −1.48 | .576 | 0.08 | 1 | −0.38 | .996 | −2.47 | .106 | |
| Baca–Sim | −3.72 | .003 | −1.63 | .480 | −1.37 | .649 | −0.82 | .924 | 0.15 | 1 | −0.60 | .975 | |
| Lfab–Seq | 4.56 | <.001 | 0.84 | .917 | 1.78 | .392 | 3.60 | .004 | 3.31 | .011 | 0.71 | .953 | |
| Lfab–Sim | 0.60 | .974 | 1.84 | .357 | 1.89 | .328 | 2.71 | .059 | 3.84 | .002 | 2.58 | .081 | |
| Seq–Sim | −3.96 | .001 | 1000 | .856 | 0.11 | 1 | −0.90 | .897 | 0.52 | .985 | 1.87 | .341 | |
| Mummification rate | Acol–Baca | 6.48 | <.001 | 3.68 | .003 | 3.61 | .004 | 4.05 | .001 | 2.70 | .061 | 0.43 | .993 |
| Acol–Lfab | 2.59 | .080 | 0.70 | .956 | 0.97 | .867 | 0.20 | 1 | 0.56 | .981 | −1.73 | .419 | |
| Acol–Seq | 5.83 | <.001 | −1.61 | .492 | −1.59 | .507 | 2.96 | .031 | −0.83 | .921 | −3.80 | .002 | |
| Acol–Sim | 1.68 | .451 | 1.18 | .762 | 0.57 | .980 | 1.72 | .426 | −0.75 | .943 | −2.88 | .038 | |
| Baca–Lfab | −3.89 | .002 | −2.98 | .029 | −2.80 | .047 | −3.86 | .002 | −2.27 | .162 | −2.50 | .098 | |
| Baca–Seq | −0.27 | .999 | −5.29 | <.001 | −5.52 | <.001 | −0.86 | .909 | −3.74 | .003 | −4.80 | <.001 | |
| Baca–Sim | −4.80 | <.001 | −2.50 | .099 | −3.23 | .014 | −2.33 | .142 | −3.49 | .006 | −3.75 | .003 | |
| Lfab–Seq | 3.40 | .008 | −2.32 | .148 | −2.72 | .058 | 2.77 | .0500 | −1.47 | .584 | −2.45 | .111 | |
| Lfab–Sim | −0.91 | .893 | 0.48 | .989 | −0.43 | .993 | 1.53 | .548 | −1.35 | .660 | −1.40 | .631 | |
| Seq–Sim | −4.25 | <.001 | 2.80 | .047 | 2.29 | .157 | −1.33 | .671 | 0.03 | 1 | 0.99 | .857 | |
| Aphid number | Acol–Baca | −2.27 | .214 | −1000 | .916 | −2.95 | .043 | −2.69 | .084 | −4.36 | <.001 | −3.06 | .032 |
| Acol–Lfab | −2.42 | .158 | −1.70 | .531 | −3.47 | .009 | −2.09 | .3000 | −5.96 | <.001 | −3.36 | .013 | |
| Acol–NoWasp | −2.38 | .171 | −3.19 | .021 | −3.58 | .006 | −3.51 | .008 | −5.98 | <.001 | −5.89 | <.001 | |
| Acol–Seq | −2.62 | .099 | 0.48 | .997 | 1.68 | .551 | −2.04 | .327 | −0.83 | .961 | −0.97 | .927 | |
| Acol–Sim | −0.39 | .999 | −0.75 | .975 | −1.09 | .883 | −1.07 | .891 | −0.84 | .960 | −0.20 | 1 | |
| Baca–Lfab | −0.15 | 1 | −0.70 | .982 | −0.53 | .995 | 0.60 | .991 | −1.60 | .599 | −0.31 | 1 | |
| Baca–NoWasp | −0.11 | 1 | −2.25 | .224 | −0.63 | .988 | −0.83 | .962 | −1.62 | .585 | −2.83 | .059 | |
| Baca–Seq | −0.35 | .999 | 1.48 | .675 | 4.62 | <.001 | 0.65 | .987 | 3.53 | .007 | 2.09 | .300 | |
| Baca–Sim | 1.88 | .421 | 0.25 | 1 | 1.85 | .436 | 1.62 | .5900 | 3.52 | .008 | 2.86 | .055 | |
| Lfab–NoWasp | 0.04 | 1 | −1.58 | .611 | −0.11 | 1 | −1.43 | .711 | −0.02 | 1 | −2.52 | .125 | |
| Lfab–Seq | −0.21 | 1 | 2.18 | .252 | 5.15 | <.001 | 0.05 | 1 | 5.13 | <.001 | 2.39 | .166 | |
| Lfab–Sim | 2.03 | .333 | 0.95 | .932 | 2.38 | .171 | 1.01 | .912 | 5.12 | <.001 | 3.17 | .023 | |
| NoWasp–Seq | −0.24 | 1 | 3.65 | .005 | 5.25 | <.001 | 1.48 | .6800 | 5.15 | <.001 | 4.92 | <.001 | |
| NoWasp–Sim | 1.99 | .356 | 2.48 | .136 | 2.49 | .136 | 2.44 | .1500 | 5.14 | <.001 | 5.69 | <.001 | |
| Seq–Sim | 2.23 | .231 | −1.23 | .820 | −2.77 | .069 | 0.96 | .928 | −0.01 | 1 | 0.77 | .972 | |
| Plant size | Acol–Baca | 0.86 | .956 | −0.23 | 1 | 1.68 | .550 | 2.89 | .051 | 1.91 | .400 | 1.21 | .832 |
| Acol–Lfab | 1.17 | .850 | −0.27 | 1 | 2.92 | .046 | 0.90 | .947 | 2.92 | .046 | 1.44 | .701 | |
| Acol–NoWasp | 1.95 | .377 | 1.60 | .598 | 1.83 | .448 | 1.09 | .884 | 2.30 | .201 | 2.53 | .121 | |
| Acol–Seq | 1.36 | .748 | −0.39 | .999 | −1.75 | .498 | 2.22 | .234 | 1.05 | .899 | 0.82 | .964 | |
| Acol–Sim | −0.70 | .981 | −0.58 | .992 | 0.47 | .997 | 2.14 | .271 | −0.19 | 1 | −0.66 | .986 | |
| Baca–Lfab | 0.31 | 1 | −0.04 | 1 | 1.25 | .812 | −1.99 | .354 | 1.01 | .913 | 0.23 | 1 | |
| Baca–NoWasp | 1.09 | .884 | 1.82 | .454 | 0.16 | 1 | −1.79 | .473 | 0.39 | .999 | 1.33 | .770 | |
| Baca–Seq | 0.51 | .996 | −0.16 | 1 | −3.43 | .010 | −0.66 | .986 | −0.86 | .956 | −0.39 | .999 | |
| Baca–Sim | −1.56 | .626 | −0.35 | .999 | −1.21 | .832 | −0.74 | .976 | −2.11 | .291 | −1.87 | .424 | |
| Lfab–NoWasp | 0.78 | .971 | 1.86 | .431 | −1.09 | .884 | 0.19 | 1 | −0.62 | .989 | 1.09 | .884 | |
| Lfab–Seq | 0.19 | 1 | −0.12 | 1 | −4.68 | <.001 | 1.33 | .7700 | −1.87 | .424 | −0.62 | .989 | |
| Lfab–Sim | −1.87 | .424 | −0.31 | 1 | −2.46 | .145 | 1.25 | .812 | −3.12 | .026 | −2.11 | .291 | |
| NoWasp–Seq | −0.58 | .992 | −1.97 | .364 | −3.59 | .006 | 1.13 | .868 | −1.25 | .812 | −1.72 | .524 | |
| NoWasp–Sim | −2.65 | .092 | −2.15 | .266 | −1.36 | .748 | 1.05 | .899 | −2.50 | .133 | −3.20 | .021 | |
| Seq–Sim | −2.07 | .311 | −0.19 | 1 | 2.22 | .234 | −0.08 | 1 | −1.25 | .812 | −1.48 | .677 | |
Hafer‐Hahmann, N. , & Vorburger, C. (2024). Parasitoid species diversity has no effect on protective symbiont diversity in experimental host‐parasitoid populations. Ecology and Evolution, 14, e11090. 10.1002/ece3.11090
DATA AVAILABILITY STATEMENT
Data and code are available in the Dryad Digital Repository: https://doi.org/10.5061/dryad.s4mw6m9cm.
REFERENCES
- Ameri, M. , Rasekh, A. , & Mohammadi, Z. (2015). A comparison of life history traits of sexual and asexual strains of the parasitoid wasp, Lysiphlebus fabarum (Braconidae: Aphidiinae). Ecological Entomology, 40, 50–61. 10.1111/een.12155 [DOI] [Google Scholar]
- Asplen, M. K. , Bano, N. , Brady, C. M. , Desneux, N. , Hopper, K. R. , Malouines, C. , Oliver, K. M. , White, J. A. , & Heimpel, G. E. (2014). Specialisation of bacterial endosymbionts that protect aphids from parasitoids. Ecological Entomology, 39, 736–739. 10.1111/een.12153 [DOI] [Google Scholar]
- Bates, D. M. , Maechler, M. , Bolker, B. M. , & Walker, S. (2015). Fitting linear mixed‐effects models using lme4. Journal of Statistical Software, 67, 1–48. 10.1177/009286150103500418 [DOI] [Google Scholar]
- Bennett, A. (2010). The role of soil community biodiversity in insect biodiversity. Insect Conservation and Diversity, 3, 157–171. 10.1111/j.1752-4598.2010.00086.x [DOI] [Google Scholar]
- Brownlie, J. C. , & Johnson, K. N. (2009). Symbiont‐mediated protection in insect hosts. Trends in Microbiology, 17, 348–354. 10.1016/j.tim.2009.05.005 [DOI] [PubMed] [Google Scholar]
- Cao, H. X. , Klein, A. M. , Zhu, C. , Staab, M. , Durka, W. , Fischer, M. , & Fornoff, F. (2018). Intra‐ and interspecific tree diversity promotes multitrophic plant–Hemiptera–ant interactions in a forest diversity experiment. Basic and Applied Ecology, 29, 89–97. 10.1016/j.baae.2018.03.005 [DOI] [Google Scholar]
- Cayetano, L. , Rothacher, L. , Simon, J. , & Vorburger, C. (2015). Cheaper is not always worse: Strongly protective isolates of a defensive symbiont are less costly to the aphid host. Proceedings of the Royal Society B, 282, 20142333. 10.1098/rspb.2014.2333 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cayetano, L. , & Vorburger, C. (2013). Genotype‐by‐genotype specificity remains robust to average temperature variation in an aphid/endosymbiont/parasitoid system. Journal of Evolutionary Biology, 26, 1603–1610. 10.1111/jeb.12154 [DOI] [PubMed] [Google Scholar]
- Cayetano, L. , & Vorburger, C. (2015). Symbiont‐conferred protection against Hymenopteran parasitoids in aphids: How general is it? Ecological Entomology, 40, 85–93. 10.1111/een.12161 [DOI] [Google Scholar]
- Chesson, P. (2000). Mechanisms of maintenance of species diversity. Annual Review of Ecology and Systematics, 31, 343–366. 10.1146/annurev.ecolsys.31.1.343 [DOI] [Google Scholar]
- Darby, A. C. , & Douglas, A. E. (2003). Elucidation of the transmission patterns of an insect‐borne bacterium. Applied and Environmental Microbiology, 69, 4403–4407. 10.1128/AEM.69.8.4403-4407.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dennis, A. B. , Patel, V. , Oliver, K. M. , & Vorburger, C. (2017). Parasitoid gene expression changes after adaptation to symbiont‐protected hosts. Evolution, 71, 2599–2617. 10.1111/evo.13333 [DOI] [PubMed] [Google Scholar]
- Dion, E. , Zélé, F. , Simon, J. C. , & Outreman, Y. (2011). Rapid evolution of parasitoids when faced with the symbiont‐mediated resistance of their hosts. Journal of Evolutionary Biology, 24, 741–750. 10.1111/j.1420-9101.2010.02207.x [DOI] [PubMed] [Google Scholar]
- Dyer, L. A. , & Letourneau, D. (2003). Top‐down and bottom‐up diversity cascades in detrital vs. living food webs. Ecology Letters, 6, 60–68. 10.1046/j.1461-0248.2003.00398.x [DOI] [Google Scholar]
- Ferrari, J. , West, J. A. , Via, S. , & Godfray, H. C. J. (2012). Population genetic structure and secondary symbionts in host‐associated populations of the pea aphid. Evolution, 66, 375–390. 10.5061/dryad.8qb00 [DOI] [PubMed] [Google Scholar]
- Fine, P. V. A. (2015). Ecological and evolutionary drivers of geographic variation in species diversity. Annual Review of Ecology, Evolution, and Systematics, 46, 369–392. 10.1146/annurev-ecolsys-112414-054102 [DOI] [Google Scholar]
- Flórez, L. V. , Biedermann, P. H. W. , Engl, T. , & Kaltenpoth, M. (2015). Defensive symbioses of animals with prokaryotic and eukaryotic microorganisms. Natural Product Reports, 32, 904–936. 10.1039/c5np00010f [DOI] [PubMed] [Google Scholar]
- Fukatsu, T. , & Nikoh, N. (1998). Two intracellular symbiotic bacteria from the mulberry psyllid Anomoneura mori (insecta Homoptera). Applied and Environmental Microbiology, 64, 3599–3606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ghosh, J. , Lun, C. M. , Majeske, A. J. , Sacchi, S. , Schrankel, C. S. , & Smith, L. C. (2011). Invertebrate immune diversity. Developmental and Comparative Immunology, 35, 959–974. 10.1016/j.dci.2010.12.009 [DOI] [PubMed] [Google Scholar]
- Gimmi, E. , & Vorburger, C. (2024). High specificity of symbiont‐conferred resistance in an aphid‐parasitoid field community. Journal of Evolutionary Biology, 37, 162–170. 10.1093/jeb/voad013 [DOI] [PubMed] [Google Scholar]
- Gimmi, E. , Wallisch, J. , & Vorburger, C. (2023). Defensive symbiosis in the wild: Seasonal dynamics of parasitism risk and symbiont‐conferred resistance. Molecular Ecology, 32, 4063–4077. 10.1111/mec.16976 [DOI] [PubMed] [Google Scholar]
- Gouskov, A. , Reyes, M. , Wirthner‐Bitterlin, L. , & Vorburger, C. (2016). Fish population genetic structure shaped by hydroelectric power plants in the upper Rhine catchment. Evolutionary Applications, 9, 394–408. 10.1111/eva.12339 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo, J. , Hatt, S. , He, K. , Chen, J. , Francis, F. , & Wang, Z. (2017). Nine facultative endosymbionts in aphids. A review. Journal of Asia‐Pacific Entomology, 20, 794–801. 10.1016/j.aspen.2017.03.025 [DOI] [Google Scholar]
- Hafer, N. , & Vorburger, C. (2019). Diversity begets diversity: Do parasites promote variation in protective symbionts? Current Opinion in Insect Science, 32, 8–14. 10.1016/j.cois.2018.08.008 [DOI] [PubMed] [Google Scholar]
- Hafer‐Hahmann, N. , & Vorburger, C. (2020). Parasitoids as drivers of symbiont diversity in an insect host. Ecology Letters, 23, 1232–1241. 10.1111/ele.13526 [DOI] [PubMed] [Google Scholar]
- Hafer‐Hahmann, N. , & Vorburger, C. (2021). Positive association between the diversity of symbionts and parasitoids of aphids in field populations. Escosphere, 12, e03355. 10.1002/ecs2.3355 [DOI] [Google Scholar]
- Henry, L. M. , Peccoud, J. , Simon, J. C. , Hadfield, J. D. , Maiden, M. J. C. , Ferrari, J. , & Godfray, H. C. J. (2013). Horizontally transmitted symbionts and host colonization of ecological niches. Current Biology, 23, 1713–1717. 10.1016/j.cub.2013.07.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jerbi‐Elayed, M. , Foray, V. , Tougeron, K. , Grissa‐Lebdi, K. , & Hance, T. (2021). Developmental temperature affects life‐history traits and heat tolerance in the aphid parasitoid aphidius colemani. Insects, 12, 852. 10.3390/insects12100852 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Käch, H. , Mathé‐Hubert, H. , Dennis, A. B. , & Vorburger, C. (2018). Rapid evolution of symbiont‐mediated resistance compromises biological control of aphids by parasitoids. Evolutionary Applications, 11, 220–230. 10.1111/eva.12532 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaech, H. , Jud, S. , & Vorburger, C. (2022). Similar cost of Hamiltonella defensa in experimental and natural aphid‐endosymbiont associations. Ecology and Evolution, 12, e8551. 10.1002/ece3.8551 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kavallieratos, N. G. , Jankovic, M. , Starý, P. , Yovkova, M. , & Athanassiou, C. G. (2013). Review and key for the identification of parasitoids (Hymenoptera: Braconidae: Aphidiinae) of aphids infesting herbaceous and shrubby ornamental plants in southeastern Europe. Annals of the Entomological Society of America, 106, 294–309. 10.1603/AN12090 [DOI] [Google Scholar]
- Kuznetsova, A. , Brockhoff, P. B. , & Christensen, R. H. B. (2017). lmerTest package: Tests in linear mixed effects models. Journal of Statistical Software, 82, 1–26. 10.18637/jss.v082.i13 [DOI] [Google Scholar]
- Leclair, M. , Buchard, C. , Mahéo, F. , Simon, J. C. , & Outreman, Y. (2021). A link between communities of protective endosymbionts and parasitoids of the pea aphid revealed in unmanipulated agricultural systems. Frontiers in Ecology and Evolution, 9, 187. 10.3389/fevo.2021.618331 [DOI] [Google Scholar]
- Leclair, M. , Pons, I. , Mahéo, F. , Simon, J.‐C. , & Outreman, Y. (2016). Diversity in symbiont consortia in the pea aphid complex is associated with large phenotypic variation in the insect host. Evolutionary Ecology, 30, 925–941. 10.1007/s10682-016-9856-1 [DOI] [Google Scholar]
- Lenth, R. (2019). emmeans: Estimated marginal means, aka least‐squares means .
- Levine, J. M. , Bascompte, J. , Adler, P. B. , & Allesina, S. (2017). Beyond pairwise mechanisms of species coexistence in complex communities. Nature, 546, 56–64. 10.1038/nature22898 [DOI] [PubMed] [Google Scholar]
- Litman, G. W. , Dishaw, L. J. , Cannon, J. P. , Haire, R. N. , & Rast, J. P. (2007). Alternative mechanisms of immune receptor diversity. Current Opinion in Immunology, 19, 526–534. 10.1016/j.coi.2007.07.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Łukasik, P. , van Asch, M. , Guo, H. , Ferrari, J. , & Charles, H. (2013). Unrelated facultative endosymbionts protect aphids against a fungal pathogen. Ecology Letters, 16, 214–218. 10.1111/ele.12031 [DOI] [PubMed] [Google Scholar]
- Mailafiya, D. M. , Le Ru, B. P. , Kairu, E. W. , Calatayud, P. A. , & Dupas, S. (2010). Factors affecting stem borer parasitoid species diversity and parasitism in cultivated and natural habitats. Environmental Entomology, 39, 57–67. 10.1603/EN09196 [DOI] [PubMed] [Google Scholar]
- Mangiafico, S. (2019). rcompanion: Functions to support extension education program evaluation .
- Marcon, E. , & Hérault, B. (2015). Entropart: An R package to measure and partition diversity. Journal of Statistical Software, 67, 1–26. 10.18637/jss.v067.i08 [DOI] [Google Scholar]
- Martinez, A. J. , Doremus, M. R. , Kraft, L. J. , Kim, K. L. , & Oliver, K. M. (2018). Multi‐modal defences in aphids offer redundant protection and increased costs likely impeding a protective mutualism. Journal of Animal Ecology, 87, 464–477. 10.1111/1365-2656.12675 [DOI] [PubMed] [Google Scholar]
- Mcintire, E. J. B. , & Fajardo, A. (2014). Facilitation as a ubiquitous driver of biodiversity. New Phytologist, 201, 403–416. 10.1111/nph.12478 [DOI] [PubMed] [Google Scholar]
- McLean, A. H. C. , & Godfray, H. C. J. (2015). Evidence for specificity in symbiont‐conferred protection against parasitoids. Proceedings of the Royal Society B: Biological Sciences, 282, 20150977. 10.1098/rspb.2015.0977 [DOI] [PMC free article] [PubMed] [Google Scholar]
- McLean, A. H. C. , Hrček, J. , Parker, B. J. , Mathé‐Hubert, H. , Kaech, H. , Paine, C. , & Godfray, H. C. J. (2020). Multiple phenotypes conferred by a single insect symbiont are independent. Proceedings of the Royal Society B: Biological Sciences, 287, 20200562. 10.1098/rspb.2020.0562 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Messier‐Solek, C. , Buckley, K. M. , & Rast, J. P. (2010). Highly diversified innate receptor systems and new forms of animal immunity. Seminars in Immunology, 22, 39–47. 10.1016/j.smim.2009.11.007 [DOI] [PubMed] [Google Scholar]
- Morand, S. (2015). (macro‐) Evolutionary ecology of parasite diversity: From determinants of parasite species richness to host diversification. International Journal for Parasitology: Parasites and Wildlife, 4, 80–87. 10.1016/j.ijppaw.2015.01.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Müller, C. B. , Adriaanse, I. C. T. , Belshaw, R. , & Godfray, H. C. J. (1999). The structure of an aphid‐parasitoid community. Journal of Animal Ecology, 68, 246–370. [Google Scholar]
- Oksanen, J. , Blanchet, F. G. , Friendly, M. , Kindt, R. , Legendre, P. , McGlinn, D. , Minchin, P. R. , O'Hara, R. B. , Simpson, G. L. , Solymos, P. , Stevens, M. H. H. , Szoecs, E. , & Wagner, H. (2019). vegan: Community ecology package .
- Oliver, K. M. , Campos, J. , Moran, N. A. , & Hunter, M. S. (2008). Population dynamics of defensive symbionts in aphids. Proceedings of the Royal Society B: Biological Sciences, 275, 293–299. 10.1098/rspb.2007.1192 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oliver, K. M. , Moran, N. A. , & Hunter, M. S. (2005). Variation in resistance to parasitism in aphids is due to symbionts not host genotype. Proceedings of the National Academy of Sciences of the United States of America, 102, 12795–12800. 10.1073/pnas.0506131102 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oliver, K. M. , Russell, J. A. , Moran, N. A. , & Hunter, M. S. (2003). Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proceedings of the National Academy of Sciences of the United States of America, 100, 1803–1807. 10.1073/pnas.0335320100 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oliver, K. M. , Smith, A. H. , & Russell, J. A. (2014). Defensive symbiosis in the real world – Advancing ecological studies of heritable, protective bacteria in aphids and beyond. Functional Ecology, 28, 341–355. 10.1111/1365-2435.12133 [DOI] [Google Scholar]
- Parker, B. J. , Hrček, J. , McLean, A. H. C. , & Godfray, H. C. J. (2017). Genotype specificity among hosts, pathogens, and beneficial microbes influences the strength of symbiont‐mediated protection. Evolution, 71, 1222–1231. 10.1111/evo.13216 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peccoud, J. , Bonhomme, J. , Mahéo, F. , de la Huerta, M. , Cosson, O. , & Simon, J. C. (2014). Inheritance patterns of secondary symbionts during sexual reproduction of pea aphid biotypes. Insect Science, 21, 291–300. 10.1111/1744-7917.12083 [DOI] [PubMed] [Google Scholar]
- Postic, E. , Le Ralec, A. , Buchard, C. , Granado, C. , & Outreman, Y. (2020). Variable impacts of prevalent bacterial symbionts on a parasitoid used to control aphid pests of protected crops. Biological Control, 148, 104302. 10.1016/j.biocontrol.2020.104302 [DOI] [Google Scholar]
- R Core Team . (2019). R: A language and environment for statistical computing. R Foundation for Statistical Computing. [Google Scholar]
- Rock, D. I. , Smith, A. H. , Joffe, J. , Albertus, A. , Wong, N. , O'Connor, M. , Oliver, K. M. , & Russell, J. A. (2018). Context‐dependent vertical transmission shapes strong endosymbiont community structure in the pea aphid, Acyrthosiphon pisum . Molecular Ecology, 27, 2039–2056. 10.1111/mec.14449 [DOI] [PubMed] [Google Scholar]
- Rossbacher, S. , & Vorburger, C. (2020). Prior adaptation of parasitoids improves biological control of symbiont‐protected pests. Evolutionary Applications, 13, 1868–1876. 10.1111/eva.12934 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rothacher, L. , Ferrer‐Suay, M. , & Vorburger, C. (2016). Bacterial endosymbionts protect aphids in the field and alter parasitoid community composition. Ecology, 97, 1712–1723. 10.14315/evth-2014-0405 [DOI] [PubMed] [Google Scholar]
- Rouchet, R. , & Vorburger, C. (2012). Strong specificity in the interaction between parasitoids and symbiont‐protected hosts. Journal of Evolutionary Biology, 25, 2369–2375. 10.1111/j.1420-9101.2012.02608.x [DOI] [PubMed] [Google Scholar]
- Rouchet, R. , & Vorburger, C. (2014). Experimental evolution of parasitoid infectivity on symbiont‐protected hosts leads to the emergence of genotype specificity. Evolution, 68, 1607–1616. 10.1111/evo.12377 [DOI] [PubMed] [Google Scholar]
- Russell, J. A. , Weldon, S. , Smith, A. H. , Kim, K. L. , Hu, Y. , Łukasik, P. , Doll, S. , Anastopoulos, I. , Novin, M. , & Oliver, K. M. (2013). Uncovering symbiont‐driven genetic diversity across North American pea aphids. Molecular Ecology, 22, 2045–2059. 10.1111/mec.12211 [DOI] [PubMed] [Google Scholar]
- Scherber, C. , Eisenhauer, N. , Weisser, W. W. , Schmid, B. , Voigt, W. , Fischer, M. , Schulze, E. D. , Roscher, C. , Weigelt, A. , Allan, E. , Beler, H. , Bonkowski, M. , Buchmann, N. , Buscot, F. , Clement, L. W. , Ebeling, A. , Engels, C. , Halle, S. , Kertscher, I. , … Tscharntke, T. (2010). Bottom‐up effects of plant diversity on multitrophic interactions in a biodiversity experiment. Nature, 468, 553–556. 10.1038/nature09492 [DOI] [PubMed] [Google Scholar]
- Schmid, M. , Sieber, R. , Zimmermann, Y. S. , & Vorburger, C. (2012). Development, specificity and sublethal effects of symbiont‐conferred resistance to parasitoids in aphids. Functional Ecology, 26, 207–215. 10.1111/j.1365-2435.2011.01904.x [DOI] [Google Scholar]
- Sochard, C. , Leclair, M. , Simon, J. C. , & Outreman, Y. (2019). Host plant effects on the outcomes of defensive symbioses in the pea aphid complex. Evolutionary Ecology, 33, 651–669. 10.1007/s10682-019-10005-4 [DOI] [Google Scholar]
- Starý, P. (2006). Aphid parasitoids of the Czech Republic (Hymenoptera: Braconidae, Aphidiinae). Academia. [Google Scholar]
- Sunnucks, P. , & Hales, D. F. (1996). Numerous transposed sequences of mitochondrial cytochrome I‐II in aphids of the genus Sitobion (Hemiptera: Aphididae) oxidase. Molecular Biology, 13, 510–524. [DOI] [PubMed] [Google Scholar]
- Van Veen, F. J. F. , Müller, C. B. , Pell, J. K. , & Godfray, H. C. J. (2008). Food web structure of three guilds of natural enemies: Predators, parasitoids and pathogens of aphids. Journal of Animal Ecology, 77, 191–200. 10.1111/j.1365-2656.2007.01325.x [DOI] [PubMed] [Google Scholar]
- Vorburger, C. (2014). The evolutionary ecology of symbiont‐conferred resistance to parasitoids in aphids. Insect Science, 21, 251–264. 10.1111/1744-7917.12067 [DOI] [PubMed] [Google Scholar]
- Vorburger, C. , Ganesanandamoorthy, P. , & Kwiatkowski, M. (2013). Comparing constitutive and induced costs of symbiont‐conferred resistance to parasitoids in aphids. Ecology and Evolution, 3, 706–713. 10.1002/ece3.491 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vorburger, C. , & Gouskov, A. (2011). Only helpful when required: A longevity cost of harbouring defensive symbionts. Journal of Evolutionary Biology, 24, 1611–1617. 10.1111/j.1420-9101.2011.02292.x [DOI] [PubMed] [Google Scholar]
- Vorburger, C. , Gouskov, A. , & von Burg, S. (2008). Genetic covariation between effectiveness and cost of defence in aphids. Biology Letters, 4, 674–676. 10.1098/rsbl.2008.0382 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vorburger, C. , & Rouchet, R. (2016). Are aphid parasitoids locally adapted to the prevalence of defensive symbionts in their hosts? BMC Evolutionary Biology, 16, 271. 10.1186/s12862-016-0811-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vorburger, C. , Siegrist, G. , & Rhyner, N. (2017). Faithful vertical transmission but ineffective horizontal transmission of bacterial endosymbionts during sexual reproduction of the black bean aphid, Aphis fabae . Ecological Entomology, 42, 202–209. [Google Scholar]
- Wickham, H. (2016). ggplot2: Elegant graphics for data analysis .
- Zytynska, S. E. , Sturm, S. , Hawes, C. , Weisser, W. W. , & Karley, A. (2023). Floral presence and flower identity alter cereal aphid endosymbiont communities on adjacent crops. Journal of Applied Ecology, 60, 1409–1423. 10.1111/1365-2664.14426 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zytynska, S. E. , Tighiouart, K. , & Frago, E. (2021). Benefits and costs of hosting facultative symbionts in plant‐sucking insects: A meta‐analysis. Molecular Ecology, 30, 2483–2494. 10.1111/mec.15897 [DOI] [PubMed] [Google Scholar]
- Zytynska, S. E. , & Weisser, W. W. (2016). The natural occurrence of secondary bacterial symbionts in aphids. Ecological Entomology, 41, 13–26. 10.1111/een.12281 [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data and code are available in the Dryad Digital Repository: https://doi.org/10.5061/dryad.s4mw6m9cm.