Abstract
Background
Glioblastoma multiform (GBM) is among the commonly diagnosed brain malignancies with poor prognosis. CD133 has been introduced as an oncogene in various cancers, like GBM. This study aimed to investigate the significance of CD133 in GBM development using in silico and in vitro techniques.
Method
The TCGA-GBM database was analyzed for the correlational and comparative studies. After selecting the U87MG cell line, CD133-siRNA was transfected into U87MG cells and treated with temozolomide. The cell viability, cell cycle, migration, clonogenicity, and apoptosis of groups were investigated using MTT, flow cytometry, wound-healing, colony formation, and annexin V/PI assays. Using qRT-PCR method, the mRNA expression levels of MMP16, SOX2, RAF1, MAP2K1, MAPK3, PIK3CA, AKT3, mTOR, CDK4, and BCL2 were studied.
Results
CD133 silencing improves apoptosis rate, arrests the cell cycle at the sub-G1 phase, suppresses the clonogenicity of U87MG cells, and inhibits the PI3K/Akt and MAPK pathways via downregulating the RAF1, MAP2K1, MAPK3, PIK3CA, AKT3, and mTOR expression. Besides, combining CD133 silencing with temozolomide treatment considerably inhibits the migration of U87MG cells compared to temozolomide monotherapy.
Conclusion
CD133 can regulate the PI3K/Akt and MAPK pathways and modulate the clonogenicity, apoptosis, and cell cycle of GBM. Combining CD133 silencing with temozolomide treatment considerably increases apoptosis, arrests the cell cycle at the sub-G1, and suppresses migration of U87MG cells compared to temozolomide monotherapy.
Graphical Abstract

Keywords: CD133, Glioblastoma, Temozolomide, PI3K/Akt, MAPK
Introduction
Glioblastoma multiform (GBM) remains a commonly diagnosed primary brain malignancy [1]. Overall, the median survival of affected patients is less than 15 months [2]. Chemoresistance and the highly aggressive nature of GBM severely affect the prognosis of affected patients [3]. A better understanding of GBM biology can provide ample opportunity to develop novel treatments for affected patients.
Cancer stem cells are small populations of malignant cells with stem-like properties; their symmetric and asymmetric divisions and self-renewal result in maintaining tumors [4]. Their quiescence nature and efficacy for extensive DNA repair can shield cancer stem cells from chemoradiotherapy [5]. In this regard, it has been reported that glioma stem cells can be associated with tumor recurrence [5, 6]. Therefore, identifying and targeting these cells can provide ample opportunities to improve the prognoses of affected patients.
CD133 is one of the introduced cancer stem cell markers for various cancers like glioma [7]. It has been implicated in the invasion, migration, tumor sphere formation, and chemoresistance of melanoma cells [8]. In hepatocellular carcinoma, CD133 silencing has been associated with inhibited invasion and vascular endothelial growth factor (VEGF) expression, and increased activity of natural killer cells [9]. In animal models, CD133+ pancreatic cancer cells produce metastatic nodules; however, CD133 silencing reverses this pro-tumoral effect. It has been found that the Erk1/2 and SRC signaling pathways regulate the CD133 expression, and CD133 can modulate the epithelial-to-mesenchymal transition in pancreatic cancer cells [10]. It has been reported that hypoxia can upregulate CD133 in glioma cells, and CD133 silencing enhances the chemosensitivity of glioma cells to cisplatin [11]. Aside from this, a recent meta-analysis study has shown that CD133 upregulation is associated with sooner distant tumor recurrence in magnetic resonance imaging patients with glioblastoma [12]. Therefore, CD133 can have a significant role in GBM biology.
Although CD133 has been introduced as a cancer stem marker in GBM and a recent meta-analysis has indicated its clinical significance for GBM patients [12], there is no study investigating the significance of CD133 in various aspects of GBM development and the potential impact of CD133 on the oncogenic signaling pathways of GBM. The present study aimed to investigate the significance of CD133 in GBM development and evaluate the combination of CD133-silencing with temozolomide on GBM development. This study leveraged the in silico and in vitro techniques to study the potential CD133-mediated pathways implicated in GBM development.
Materials and methods
In silico investigation
The cancer genome atlas (TCGA)-genotype-tissue expression (GTEx) dataset was accessed using the GEPIA 2 (http://gepia2.cancer-pku.cn/) to study the expression levels of CD133 in GBM and non-tumoral brain tissues; normal brain tissues were included from the GTEx dataset for the comparison of CD133 expression level. Using the GEPIA 2, the TCGA-GBM was also accessed to investigate the prognostic significance of CD133 in GBM patients; 25% and 75% quartiles were used as criteria for low and high expression of CD133 in the prognostic studies [13], and the TCGA-GBM (Nature 2008) was leveraged to perform correlational studies [14]. The cancer cell line encyclopedia (CCLE) dataset was used to evaluate CD133 expression in GBM cell lines [15], and GeneMANIA (with max resultant genes and attributes of null) and STRING (with a coefficient of 0.1 and maximum additional interactions of null) were used to study the interactions between the studied genes using Cytscape 3.7.0 [16, 17].
Cell culture
The U87MG, U373, and A172 cell lines were purchased from the Pasture Institute’s cell bank in Tehran, Iran, and cultured in RPMI-1640 supplemented with 10% fetal bovine serum (GIBCO, Carlsbad, CA) and 1% penicillin/streptomycin. The cells were incubated at 37 °C in a 95% humidified, 5% CO2 incubator. All of the cell lines were free from mycoplasma contamination.
Transfection
The U87MG cell line was selected due to its higher expression of CD133 compared to the A172 and U373 cell lines. After reaching 80% confluency, U87MG cells were suspended in a cold electroporation buffer, and the number of cells was counted. 1 × 106 cells were electroporated with scramble, 20, 40, and 60 pmol of CD133-siRNA (Table 1) using a Gene Pulser Electroporation (Bio-Rad, CA, USA) and a 0.4 cm3 Gene Pulser Cuvette (Bio-Rad, CA, USA). The utilized pulse type was the square wave, the pulse length was 25 ms, and the voltage was 100 v.
Table 1.
CD133-siRNA sequences
| CD133-siRNA | Sense | Anti-sense |
|---|---|---|
| CD133 siRNA (a) | 5′-UUGUCAUAAUCAAUUUUGGTT-3′ | 5′-AACAGUAUUAGUUAAAACCTT-3′ |
| CD133 siRNA (b) | 5′-UGAAGUUCUGAGCAAAAUCTT-3′ | 5′-TTGAUUUUGCUCAGAACUUGA-3′ |
| CD133 siRNA (c) | 5′-AGAAAGUCCUAUAAUACUCTT-3′ | 5′-TTGAGUAUUAUAGGACUUUCU-3′ |
qRT-PCR
Total RNA from the cells was extracted using the RiboEX reagent (GeneAll Biotechnology, Seoul, South Korea). After that, a spectrophotometer (Thermo Fisher Scientific, Lenexa, South Korea) was used to examine the purity and concentration of the extracted RNA. The complementary DNA (cDNA) was produced using a thermal cycler system and the AddScript cDNA Synthesis Kit (ADDBIO, South Korea). Then, using Thermo Fisher’s StepOnePlusTM Real-Time PCR System, the mRNA expression of MMP16, SOX2, RAF1, MAP2K1, MAPK3, PIK3CA, AKT3, mTOR, CDK4, BCL2, and CD133 was studied. The housekeeping gene was 18s; the pair primer sequences were blasted before the experiment using the NCBI website (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 2). For the comparison of the mRNA expression levels in the different studied groups, we used the 2–∆∆Ct to obtain the values; then, log 10 of the obtained values were calculated for further statistical analyses.
Table 2.
The primer sequences of studied genes
| Gene | Forward primer | Reverse primer |
|---|---|---|
| MMP16 | CCCACACCGCTCTATTCCTCC | CCCTGTTGTTTCTCACTCGCC |
| SOX2 | AAAACAGCCCGGACCGCGTC | CTCGTCGATGAACGGCCGCT |
| RAF1 | AGTCACAGCGAATCAGCCTC | GCCTAATTTTGTTTTTCTCCTGGG |
| MAP2K1 | CAATGGCGGTGTGGTGTTC | GATTGCGGGTTTGATCTCCAG |
| MAPK3 | CGCTTCCGCCATGAGAATGT | GGTCAGTCTCCATCAGGTCC |
| PIK3CA | GAAGCACCTGAATAGGCAAGTCG | GAGCATCCATGAAATCTGGTCGC |
| AKT3 | AGAACGACCAAAGCCAAACACA | AGTCTGTCTGCTACAGCCTGG |
| mTOR | AGATGCTTGGAACCGGACCTG | CCAAGATGCCACCTTTCCTCTC |
| CDK4 | CCATCAGCACAGTTCGTGAGGT | TCAGTTCGGGATGTGGCACAGA |
| BCL2 | ACTGGCTCTGTCTGAGTAAG | CCTGATGCTCTGGGTAAC |
| CD133 | GCTTTGCAATCTCCCTGTTG | TTGATCCGGGTTCTTACCTG |
| 18s | ACCCGTTGAACCCCATTCGTGA | GCCTCACTAAACCATCCAATCGG |
MTT assay
The cell viability and the half-maximal inhibitory concentration (IC50) of temozolomide on U87MG cells was studied using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. After diluting the initial concentration of temozolomide, i.e., 34.3 mg/ml, its diluted concentration was used for treating tumoral cells. Then, 50 μl of MTT (2 mg/ml) (Sigma–Aldrich, M5655) was added to each well of a 96-well plate after 15 × 103 cells had been seeded into each well. The cells were then incubated for 180 min in the incubator. Following the medium removal, the plate was then incubated for 30 min, and 150 μl of dimethyl sulphoxide (DMSO) (Sigma-Aldrich, D4540) was added to each well. After shaking for 10 min, the optical density (OD) of each well was assessed at 570 nm using an ELISA reader (Sunrise RC, Tecan, Switzerland). The formula for calculating each well’s cell viability percentage was as follows: (each value − mean value of DMSO)/(mean of control value − mean value of DMSO) * 100.
Annexin V/propidium iodide (PI) assay
U87MG cell apoptosis was studied using the annexin V/PI assay. We treated one group of transfected and one group of non-transfected U87MG cells with temozolomide after seeding 2 × 105 transfected and non-transfected cells in a six-well plate; then, we incubated it for 24 h. The cells were stained with annexin V/PI in accordance with the manufacturer’s instructions after a second 24-h incubation (EXBIO, Vestec, Czech Republic). Then, the apoptosis rate of each group was assessed by flow cytometry (MiltenyBiotecTM FACS Quant 10; MiltenyBiotec, Germany). FlowJo was used to analyze the data.
Cell cycle assay
The seeding and treatment procedures of the annexin V/PI assay were used in this assay as well. Single cells from each group were obtained, fixed with 80% ethanol, and stored at − 20 °C for 24 h. Using flow cytometry (MiltenyBiotecTM FACS Quant 10; MiltenyBiotec, Germany) after RNase treatment and DAPI labeling (Sigma–Aldrich, D9542), cell distribution in the cell cycle phases was studied. The data were analyzed using the FlowJo software (Tree Star, CA, USA).
Scratch assay
The scratch test was used to investigate the migration of U87MG cells. A 24-well plate was seeded with 3 × 105 U87MG cells. A yellow sterile pipette tip was then used to scrape the cellular monolayer. Using an inverted microscope (Optika, XDS-3, Italy), the related pictures were taken at 0, 12, 24, and 48 h after incubation.
Colony formation assay
The stemness of the U87MG cells was investigated using the colony formation assay. Crystal violet was used to stain the cells after they had been incubated for 14 days with 3 × 105 transfected and non-transfected cells in a six-well plate. The pictures were taken using an inverted microscope (Optika, XDS-3, Italy).
Statistical analyses
The in vitro data were analyzed using GraphPad Prism V 8.0.2 (GraphPad Software, CA, USA). The one-way ANOVA was used to perform statistical analyses between more than two groups. The Shapiro–Wilk test was applied to assess the data normality. P-values less than 0.05 were regarded as statistically significant. For each experiment, three independent biological replicates were conducted to perform the statistical analyses.
Results
In silico investigation on the significance of CD133 in GBM
Firstly, we attempted to study CD133 expression levels in GBM and non-tumoral brain tissues. Based on the TCGA-GTEX dataset, CD133 expression is significantly upregulated in GBM tissues (Fig. 1A). The TCGA-GBM was investigated to study the prognostic value of CD133 in patients with primary GBM as well. The mRNA expression of CD133 is not significantly associated with the overall survival and disease-specific survival of patients with primary GBM (Fig. 1A, B).
Fig. 1.
In silico investigation on CD133 significance in GBM. A CD133 expression in GBM and non-tumoral tissues; CD133 expression is upregulated in tumoral (T) tissues compared to normal (N) tissues. B CD133 (PROM1) expression level is not significantly associated with the overall survival of primary GBM patients. C CD133 (PROM1) expression is not significantly associated with the disease-specific survival of primary GBM patients. D The correlation between CD133 and the specific genes of the PI3K/Akt and MAPK pathways. The radar chart represents the correlation coefficient between the studied genes with CD133 in tumor bulk analysis of GBM tissues. E Gene interactions based on GeneMANIA. F Gene interactions based on STRING. PROM1 is the gene symbol name of CD133
Since CD133 can regulate the PI3k/Akt pathway in prostate adenocarcinoma cells [18], the TCGA-GBM dataset was studied to identify the correlations between CD133 and the genes of the PI3K/Akt and MAPK pathways. It has been found that there are significant positive correlations between CD133 with RAF1, mTOR, and AKT3 in GBM tissues (Fig. 1C). The GeneMANIA results are in favor of considerable interactions between studied genes (Fig. 1D). These interactions of GeneMANIA are pathways, genetic interactions, predicted, physical interactions, co-expression, and shared protein domains. Consistent with this, the STRING results have also demonstrated considerable interactions between the studied genes (Fig. 1E).
Selecting a GBM cell line and determining the optimal dose of CD133-siRNA
Firstly, we leveraged the CCLE dataset to investigate which of the U87MG and A172 cell lines has the highest CD133 expression. It has been found that there is a trend in CD133 expression level being higher in the U87MG cell line than the A172 cell line (Fig. 2A). Our experimental results have validated that the CD133 expression level is significantly higher in U87MG cells compared to A172 and U373 cells (Fig. 2B). Therefore, we used the U87MG cell line for our in vitro experiments. Afterward, we attempted to determine the optimal dose of CD133-siRNA after 48 h of transfection. It has been found that transfection with 20 pmol of CD133-siRNA significantly downregulates the mRNA expression of CD133 in U87MG cells (P-value < 0.0001) (Fig. 2C). However, we were unable to perform flow cytometry studies to investigate the effect of CD133-siRNA on its expression.
Fig. 2.
CD133 expression in GBM cell lines and the optimal dose of CD133-siRNA after 48 h of transfection. A CD133 expression level based on the CCLE dataset; U87MG cells have higher CD133 expression compared to A172 cells. B CD133 expression in A172, U373, and U87MG cells. U87MG cells have higher CD133 expression compared to A172 and U373 cells. C CD133 expression after 48 h of transfecting CD133-siRNA; 20 pmol CD133-siRNA is the optimal dose for downregulating CD133 in U87MG cells after 48 h. *P-value ≤ 0.05, **P-value ≤ 0.01, ***P-value ≤ 0.001, and ****P-value ≤ 0.0001
The effect of CD133 silencing on the cell viability of U87 cells
We used the MTT assay to determine the effect of CD133-siRNA and the combination therapy on the cell viability of U87MG cells. Firstly, we measured the IC50 of temozolomide on U87MG cells; our results demonstrated that 693 μg/ml is the IC50 of temozolomide on U87MG cells in our experiment (Fig. 3A). To rule out the potential effect of the transfection procedure on the cell viability of U87MG cells, we included the shock and scramble transfection groups as well. Our results have shown that shock and scramble transfection have no statistically significant effect on the cell viability of U87MG cells (P-value = 0.7355 and P-value = 0.4535, respectively) (Fig. 3B). Also, CD133 suppression has not significantly altered the cell viability of U87MG cells and has not increased the temozolomide-mediated anti-tumoral effect on the cell viability of U87MG cells (Fig. 3C).
Fig. 3.
The half-maximal inhibitory concentration (IC50) of temozolomide and the effect of CD133 silencing on the cell viability of U87MG cells. A The IC50 of temozolomide on U87MG cells is 693.0 µg/ml. B The effect of shock and scramble transfection on the viability of U87MG cells. The shock of transfection and transfecting scramble is not associated with significant cell viability change. C The effect of CD133 suppression on the cell viability of U87MG cells. CD133 silencing does not significantly alter the cell viability of U87MG cells. The MTT results are displayed as displayed as mean ± standard deviation (SD). ns: non-significant, ***P-value ≤ 0.001, and ****P-value ≤ 0.0001
The effect of CD133 silencing on the apoptosis of U87MG cells
After evaluating the effect of CD133 silencing on the cell viability of U87MG cells, we studied its effect on the apoptosis of U87MG cells [19]. Our results have shown that CD133 silencing significantly improves the apoptosis of U87MG cells (P-value < 0.0001). Also, CD133 silencing potentiates the anti-tumoral effect of temozolomide on the apoptosis of U87MG cells (P-value < 0.05). In line with this, CD133 suppression significantly downregulates BCL2 expression in U87Mg cells (P-value < 0.0001) (Fig. 4). Consistent with this, CD133 silencing increases the apoptosis of prostate cancer cells and potentiates the paclitaxel-mediated apoptosis in prostate cancer cells [18]. Although CD133 silencing does not alter the apoptosis of colorectal cancer cells [20, 21], the combined CD133 silencing with oxaliplatin potentiates the oxaliplatin-mediated apoptosis in colorectal cancer cells [21].
Fig. 4.
The annexin V/PI assay for evaluating the apoptosis rate of U87MG cells. A the annexin V/PI of the control group, B the annexin V/PI of the CD133 silenced group, C the annexin V/PI of the temozolomide-treated group, D the annexin V/PI of the combined treatment group, E the apoptosis rates of studied groups, and F the mRNA expression of BCL2 in different studied groups. CD133 silencing increases the apoptosis rate of U87MG cells and potentiates the anti-tumoral effect of temozolomide on the apoptosis of U87MG cells. CD133 silencing downregulates BCL2 expression in U87MG cells. In the annexin V/PI assay, a lower dose of temozolomide than IC50 was used. *P-value ≤ 0.05, and ****P-value ≤ 0.0001
The effect of CD133 silencing on the cell cycle of U87MG cells
The cell cycle analysis has demonstrated that CD133 silencing significantly arrests the cell cycle at the sub-G1 phase compared to the control group (P-value = 0.0038). Also, the combined therapy of CD133 silencing with temozolomide significantly arrests the cell cycle compared to monotherapy with temozolomide. In line with these, CD133 silencing significantly downregulates CDK4 expression in U87MG cells (P-value < 0.0001) (Fig. 5). In prostate cancer cells, the combined CD133 silencing with paclitaxel arrests the cell cycle at the G2 phase [18]. In colorectal cancer cells, CD133 silencing arrests the cell cycle of tumoral cells at the G1 phase [21].
Fig. 5.
The cell cycle assay for studying the cell cycle phase distribution of U87MG cells. A The cell cycle phase distribution of the control group, B the cell cycle phase distribution of the CD133-silenced group, C the cell cycle phase distribution of the temozolomide-treated group, D the cell cycle phase distribution of the combined treatment group, E the cell cycle phase distribution of studied groups. CD133 silencing leads to the accumulation of cells at the sub-G1 phase. F the mRNA expression of CDK4 in different studied groups. CD133 silencing downregulates the expression of CDK4 in U87MG cells. **P-value ≤ 0.01, and ****P-value ≤ 0.0001
The effect of CD133 silencing on the migration of U87MG cells
The scratch assay was performed to investigate the effect of CD133 silencing on the migration of U87MG cells. Our results have shown that the combination therapy decreases the migration of U87MG cells in vitro (Fig. 6A). CD133 silencing and the combined therapy significantly downregulate MMP16 expression compared to the control group (P-value < 0.0001) (Fig. 6B).
Fig. 6.
The scratch assay and the mRNA expression of MMP16. A The scratch assay for assessing the migration of U87MG cells in different studied groups. The combined CD133 silencing with temozolomide decreases the migration of U87MG cells compared to temozolomide monotherapy. B The mRNA expression of MMP16 in different studied groups. CD133 silencing downregulates the expression of MMP16 in U87MG cells. ****P-value ≤ 0.0001
The effect of CD133 silencing on the clonogenicity of U87MG cells
The colony formation results have shown that CD133 silencing decreases the stemness of U87MG cells (Fig. 7A–D). Consistent with this, CD133 silencing and the combined therapy significantly downregulate SOX2 expression compared to the control group (both P-values ≤ 0.0001) (Fig. 7E).
Fig. 7.
The colony formation and mRNA expression of SOX2. A The microscopic image of the clonogenicity of the control group. B The microscopic image of the clonogenicity of the temozolomide group. C The microscopic image of the clonogenicity of the CD133-siRNA group. D The microscopic image of the clonogenicity of the combined therapy. CD133 silencing decreases the clonogenicity of U87MG cells. E The mRNA expression of SOX2 in different studied groups. CD133 silencing downregulates the expression of SOX2 in U87MG cells. *P-value ≤ 0.05, and ****P-value ≤ 0.0001
CD133 can regulate the PI3K/Akt and MAPK pathways of U87MG cells
Following the in silico results, the effect of CD133 suppression on the studied signaling factors of the PI3K/Akt and MAPK pathways in U87MG was investigated. CD133 silencing significantly downregulates the expression of RAF1, MAP2K1, MAPK3, PIK3CA, AKT3, and mTOR compared to the control group (Fig. 8). Also, the combination therapy significantly decreases the expression of RAF1, MAP2K1, MAPK3, PIK3CA, AKT3, and mTOR compared to the control group (Fig. 8). However, we could not perform western blot studies to investigate the expression of these factors in protein levels.
Fig. 8.
The effect of CD133 silencing on the signaling factors of the PI3K/Akt and MAPK pathways. A The mRNA expression of RAF1 in different studied groups. CD133 silencing downregulates RAF1 expression in U87MG cells. B The mRNA expression of MAP2K1 in different studied groups. CD133 silencing downregulates MAP2K1 expression in U87MG cells. C The mRNA expression of MAPK3 in different studied groups. CD133 silencing downregulates MAPK3 expression in U87MG cells. D The mRNA expression of PIK3CA in different studied groups. CD133 silencing downregulates PIK3CA expression in U87MG cells. E The mRNA expression of AKT3 in different studied groups. CD133 silencing downregulates AKT3 expression in U87MG cells. F The mRNA expression of mTOR in different studied groups. CD133 silencing downregulates mTOR expression in U87MG cells. **P-value ≤ 0.01, ***P-value ≤ 0.001, and ****P-value ≤ 0.0001
Discussion
The current treatment for primary GBM patients includes tumor resection followed by radiation and temozolomide; tumor-treating field therapy has additional benefits along with temozolomide in treating GBM. Although most cases of primary GBM relapse, there is no well-established therapeutic approach for recurrent GBM [22, 23]. The present study has shown that CD133 silencing arrests the cell cycle at the sub-G1 phase, improves apoptosis, decreases the clonogenicity of U87MG cells, and can modulate the PI3K/Akt and MAPK pathways via downregulating the RAF1, MAP2K1, MAPK3, PIK3CA, AKT3, and mTOR expression. Also, the combined treatment of CD133 silencing with temozolomide significantly suppressed the migration of U87MG cells compared to monotherapy with temozolomide.
Initial concepts of brain cancer stem cells were developed in the early 2000s [24–26]. Cancer stem cells are a small population of the tumor bulk that can reproduce original malignant tissue; treatment resistance, tumor recurrence, and low proliferation have been the characteristics of cancer stem cells [4, 27]. It has been shown that cancer stem cells can be responsible for the source of factors associated with poor survival of cancer patients [28]. CD133 has been reported as a cancer stem cell marker in various malignancies [5, 29, 30]. CD133 is located on chromosome 4p15.33; this glycoprotein is on the cell membrane [31]. Glioma stem cells highly express CD133 compared to differentiated glioma cells [32]. Bresecia et al. have reported that CD133-silencing substantially decreases the clonogenicity in vitro and tumorigenesis in vivo, and CD133 re-expression in CD133-silenced cells reverses these anti-tumoral effects in glioma cells [33]. Kang et al. have found that carmustine-resistance GBM cells express CD133, CD117, CD90, CD71, and CD45 and can reconstitute tumor bulk in immunocompromised animal models [34]. Shideng et al. have reported that CD133+ glioma cells can effectively activate the repair of radiation-induced DNA damage compared to CD133− glioma cells [35]. Also, the nutrient-deprived tumor microenvironment upregulates CD133 expression, leading to increased survival and decreased apoptosis of glioma cells [36]. CD133 ectopic expression has substantially decreased apoptosis and increased the chemoresistance of glioma cells [37]. Yu et al. have indicated that CD133+ glioma stem cells are more invasive than CD133− cells [38]. CD133 protein expression has clinical relevance as well. A recent meta-analysis has shown that increased expression of CD133 is associated with poor progression-free survival in patients with high-grade gliomas and sooner distant tumor recurrence on the MRI of GBM patients [12]. However, our in silico results have shown that there is no statistically significance association between the mRNA expression of CD133 with overall survival and disease-specific survival of primary GBM patients. This might stem from the fact that the mentioned meta-analysis study investigated the protein expression of CD133 rather than the mRNA expression of CD133. Despite the scarcity of cancer stem cells in tumor bulk, recent advances in single-cell sequencing approaches have provided ample opportunities to study their genetic properties. Couturier et al. have sorted glioma stem cells into three categories, i.e., CD9+/CD133+, CD133−/CD24+/CD9−, and CD9+/CD44+/CD133− glioma cells based on single-cell RNA sequencing. Applying single-cell proteomic analysis and mass cytometry, their results have shown that CD9+/CD133+ glioma cells implanted in animal models have substantially lower survival than other glioma stem cell subtypes. Indeed, CD9+/CD133+ glioma cells have higher tumorigenic and temozolomide resistance than other subtypes [39].
The PI3K/Akt and MAPK pathways have been introduced as oncogenic pathways in GBM development [40–42]. Our in silico results have indicated that CD133 can be associated with the signaling factors of PI3K/Akt and MAPK pathways; this hypothesis was strengthened by the evidence of CD133’s impact on the PI3K/Akt pathway in prostate cancer [18]. Our in vitro results have indicated that CD133 can regulate the PI3K/Akt and MAPK pathways, and CD133 silencing downregulates RAF1, MAP2K1, MAPK3, PIK3CA, AKT3, and mTOR in U87MG cells. In this regard, Dong et al. have reported that CD133 ectopic expression does not affect the proliferation and migration of U87MG cells; however, CD133 ectopic expression increases the phosphorylated Erk and activates the MAPK/Erk pathway in U87MG cells [43]. Wei et al. have reported that CD133− glioma cells are not capable of producing glioma in immunocompromised animal models in contrast to CD133+ glioma cells; it has been found that the PI3K activity and the phosphorylations of Akt on S473 and T308 are considerably increased in CD133+ population [44]. Furthermore, the results of the performed assays have shown that CD133 silencing increases apoptosis rate, arrests the cell cycle at the sub-G1 phase, and suppresses the clonogenicity of U87MG cells; however, CD133 silencing does not significantly affect the cell viability and migration of U87MG cells. Also, our MTT assay has demonstrated that CD133 silencing does not significantly affect the temozolomide-mediated cytotoxicity on U87MG cells. In line with this, Ahmed et al. have reported that CD133 silencing does not increase the chemosensitivity of U251 cells to temozolomide [11]. Also, it has been reported that CD133 silencing does not decrease the cell viability of colorectal cancer cells [21]. In prostate cancer, CD133 silencing does not affect the cell viability of malignant cells [18]. Altogether, CD133 can activate the MAPK/Erk and PI3K/Akt pathways in GBM and regulate the apoptosis, cell cycle, and colonogenicity of GBM cells.
The present study has some limitations. First, we could not perform protein-based assays to investigate the protein expression of the studied genes. Second, we could not include in vivo experiments. Therefore, the obtained results should be interpretated considering these limitations. However, the current study has some strengths as well. First, the hypothesis of our study is developed from in silico investigations. Second, we studied the effect of the combined treatment of temozolomide with CD133 silencing on various aspects of GBM development, along with the molecular mechanism. Third, we performed a deep literature review to integrate the findings with the obtained results. Collectively, this study provides novel insights into the CD133-mediated molecular mechanisms in GBM development.
In conclusion, this study has shown that CD133 can regulate the PI3K/Akt and MAPK pathways in GBM, and its silencing results in the arrested cell cycle at the sub-G1 phase, stimulated apoptosis, and inhibited clonogenicity of U87MG cells. Although CD133 silencing does not significantly affect the migration and cell viability of U87MG cells, its combination with temozolomide potentiates the anti-tumoral effects of temozolomide on migration, apoptosis, and cell cycle of U87MG cells.
Acknowledgements
The research protocol was approved & Supported by Student Research Committee, Tabriz University of Medical Sciences (Grant Number: 68982). The objects of the graphical abstract are obtained from https://smart.servier.com/
Author contributions
MAS performed the in silico studies and in vitro assays, analyzed the data, and wrote the manuscript. FNO helped with in vitro assays. BB supervised the study, reviewed, and edited the manuscript. All authors reviewed the manuscript.
Funding
No funding.
Data availability
The datasets supporting the conclusions of this article are available in the TCGA-GEPIA (http://gepia.cancer-pku.cn/), and cBioPortal (https://www.cbioportal.org/), and CCLE (https://sites.broadinstitute.org/ccle/).
Declarations
Ethics approval and consent to participate
This study was approved by the Ethics Committee of Tabriz University of Medical Sciences (IR.TBZMED.VCR.REC.1400.537).
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Gittleman H, Boscia A, Ostrom QT, Truitt G, Fritz Y, Kruchko C, et al. Survivorship in adults with malignant brain and other central nervous system tumor from 2000–2014. Neuro Oncol. 2018;20(suppl_7):vii6–vii16. doi: 10.1093/neuonc/noy090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Grochans S, Cybulska AM, Simińska D, Korbecki J, Kojder K, Chlubek D, et al. Epidemiology of glioblastoma multiforme-literature review. Cancers. 2022;14(10):2412. doi: 10.3390/cancers14102412. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Olivier C, Oliver L, Lalier L, Vallette FM. Drug resistance in glioblastoma: the two faces of oxidative stress. Front Mol Biosci. 2020;7:620677. doi: 10.3389/fmolb.2020.620677. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Najafzadeh B, Asadzadeh Z, Motafakker Azad R, Mokhtarzadeh A, Baghbanzadeh A, Alemohammad H, et al. The oncogenic potential of NANOG: an important cancer induction mediator. J Cell Physiol. 2021;236(4):2443–2458. doi: 10.1002/jcp.30063. [DOI] [PubMed] [Google Scholar]
- 5.Tang X, Zuo C, Fang P, Liu G, Qiu Y, Huang Y, et al. Targeting glioblastoma stem cells: a review on biomarkers, signal pathways and targeted therapy. Front Oncol. 2021;11:701291. doi: 10.3389/fonc.2021.701291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Vieira de Castro J, Gonçalves CS, Hormigo A, Costa BM. Exploiting the complexities of glioblastoma stem cells: insights for cancer initiation and therapeutic targeting. Int J Mol Sci. 2020;21(15):5278. doi: 10.3390/ijms21155278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Alves ALV, Gomes INF, Carloni AC, Rosa MN, da Silva LS, Evangelista AF, et al. Role of glioblastoma stem cells in cancer therapeutic resistance: a perspective on antineoplastic agents from natural sources and chemical derivatives. Stem Cell Res Ther. 2021;12(1):206. doi: 10.1186/s13287-021-02231-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Simbulan-Rosenthal CM, Dougherty R, Vakili S, Ferraro AM, Kuo LW, Alobaidi R, et al. CRISPR-Cas9 knockdown and induced expression of CD133 reveal essential roles in melanoma invasion and metastasis. Cancers. 2019;11(10):1490. doi: 10.3390/cancers11101490. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kohga K, Tatsumi T, Takehara T, Tsunematsu H, Shimizu S, Yamamoto M, et al. Expression of CD133 confers malignant potential by regulating metalloproteinases in human hepatocellular carcinoma. J Hepatol. 2010;52(6):872–879. doi: 10.1016/j.jhep.2009.12.030. [DOI] [PubMed] [Google Scholar]
- 10.Ding Q, Miyazaki Y, Tsukasa K, Matsubara S, Yoshimitsu M, Takao S. CD133 facilitates epithelial–mesenchymal transition through interaction with the ERK pathway in pancreatic cancer metastasis. Mol Cancer. 2014;13:15. doi: 10.1186/1476-4598-13-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ahmed EM, Bandopadhyay G, Coyle B, Grabowska A. A HIF-independent, CD133-mediated mechanism of cisplatin resistance in glioblastoma cells. Cell Oncol. 2018;41(3):319–328. doi: 10.1007/s13402-018-0374-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Abdoli Shadbad M, Hosseinkhani N, Asadzadeh Z, Brunetti O, Silvestris N, Baradaran B. The prognostic value of CD133 in predicting the relapse and recurrence pattern of high-grade gliomas on MRI: a meta-analysis. Front Oncol. 2021;11:722833. doi: 10.3389/fonc.2021.722833. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Tang Z, Kang B, Li C, Chen T, Zhang Z. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res. 2019;47(W1):W556–W560. doi: 10.1093/nar/gkz430. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2012;2(5):401–404. doi: 10.1158/2159-8290.CD-12-0095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Nusinow DP, Szpyt J, Ghandi M, Rose CM, McDonald ER, 3rd, Kalocsay M, et al. Quantitative proteomics of the cancer cell line encyclopedia. Cell. 2020;180(2):387–402.e16. doi: 10.1016/j.cell.2019.12.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Warde-Farley D, Donaldson SL, Comes O, Zuberi K, Badrawi R, Chao P, et al. The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function. Nucleic acids Res. 2010;38(suppl_2):W214–W220. doi: 10.1093/nar/gkq537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Szklarczyk D, Franceschini A, Wyder S, Forslund K, Heller D, Huerta-Cepas J, et al. STRING v10: protein–protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 2015;43(Database issue):D447–D452. doi: 10.1093/nar/gku1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Aghajani M, Mokhtarzadeh A, Aghebati-Maleki L, Mansoori B, Mohammadi A, Safaei S, et al. CD133 suppression increases the sensitivity of prostate cancer cells to paclitaxel. Mol Biol Rep. 2020;47(5):3691–3703. doi: 10.1007/s11033-020-05411-9. [DOI] [PubMed] [Google Scholar]
- 19.Sazonova EV, Chesnokov MS, Zhivotovsky B, Kopeina GS. Drug toxicity assessment: cell proliferation versus cell death. Cell Death Discov. 2022;8(1):417. doi: 10.1038/s41420-022-01207-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Akbari M, Shanehbandi D, Asadi M, Shomali N, Faraji A, Khaze V, et al. Effects of CD133 silencing on survival and migration of HT-29 colorectal cancer cells. Iran J Immunol. 2019;16(3):246–257. doi: 10.22034/IJI.2019.80275. [DOI] [PubMed] [Google Scholar]
- 21.Asadzadeh Z, Mansoori B, Mohammadi A, Kazemi T, Mokhtarzadeh A, Shanehbandi D, et al. The combination effect of Prominin1 (CD133) suppression and oxaliplatin treatment in colorectal cancer therapy. Biomed Pharmacother. 2021;137:111364. doi: 10.1016/j.biopha.2021.111364. [DOI] [PubMed] [Google Scholar]
- 22.Guo Q-L, Dai X-L, Yin M-Y, Cheng H-W, Qian H-S, Wang H, et al. Nanosensitizers for sonodynamic therapy for glioblastoma multiforme: current progress and future perspectives. Mil Med Res. 2022;9(1):26. doi: 10.1186/s40779-022-00386-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Pineda E, Domenech M, Hernández A, Comas S, Balaña C. Recurrent glioblastoma: ongoing clinical challenges and future prospects. Onco Targets Ther. 2023;16:71–86. doi: 10.2147/OTT.S366371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ignatova TN, Kukekov VG, Laywell ED, Suslov ON, Vrionis FD, Steindler DA. Human cortical glial tumors contain neural stem-like cells expressing astroglial and neuronal markers in vitro. Glia. 2002;39(3):193–206. doi: 10.1002/glia.10094. [DOI] [PubMed] [Google Scholar]
- 25.Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J, et al. Identification of a cancer stem cell in human brain tumors. Can Res. 2003;63(18):5821–5828. [PubMed] [Google Scholar]
- 26.Hemmati HD, Nakano I, Lazareff JA, Masterman-Smith M, Geschwind DH, Bronner-Fraser M, et al. Cancerous stem cells can arise from pediatric brain tumors. Proc Natl Acad Sci USA. 2003;100(25):15178–15183. doi: 10.1073/pnas.2036535100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Biserova K, Jakovlevs A, Uljanovs R, Strumfa I. Cancer stem cells: significance in origin, pathogenesis and treatment of glioblastoma. Cells. 2021;10(3):621. doi: 10.3390/cells10030621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Tuo Z, Feng D, Jiang Z, Bi L, Yang C, Wang Q. Unveiling clinical significance and tumor immune landscape of CXCL12 in bladder cancer: Insights from multiple omics analysis. Chin J Cancer Res = Chung-kuo yen cheng yen chiu. 2023;35(6):686–701. doi: 10.21147/j.issn.1000-9604.2023.06.12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Wang H, Liu J, Zhu X, Yang B, He Z, Yao X. AZGP1P2/UBA1/RBM15 cascade mediates the fate determinations of prostate cancer stem cells and promotes therapeutic effect of docetaxel in castration-resistant prostate cancer via TPM1 m6A modification. Research. 2023;6:0252. doi: 10.34133/research.0252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Wang Q, Yang T, Li S, Xu C, Wang C, Xiong Y, et al. Unimolecular self-assembled hemicyanine-oleic acid conjugate acts as a novel succinate dehydrogenase inhibitor to amplify photodynamic therapy and eliminate cancer stem cells. Research. 2023;6:0223. doi: 10.34133/research.0223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Li Z. CD133: a stem cell biomarker and beyond. Exp Hematol Oncol. 2013;2(1):17. doi: 10.1186/2162-3619-2-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Patel AP, Tirosh I, Trombetta JJ, Shalek AK, Gillespie SM, Wakimoto H, et al. Single-cell RNA-seq highlights intratumoral heterogeneity in primary glioblastoma. Science. 2014;344(6190):1396–1401. doi: 10.1126/science.1254257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Brescia P, Ortensi B, Fornasari L, Levi D, Broggi G, Pelicci G. CD133 is essential for glioblastoma stem cell maintenance. Stem Cells. 2013;31(5):857–869. doi: 10.1002/stem.1317. [DOI] [PubMed] [Google Scholar]
- 34.Kang MK, Kang SK. Tumorigenesis of chemotherapeutic drug-resistant cancer stem-like cells in brain glioma. Stem Cells Dev. 2007;16(5):837–847. doi: 10.1089/scd.2007.0006. [DOI] [PubMed] [Google Scholar]
- 35.Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB, et al. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature. 2006;444(7120):756–760. doi: 10.1038/nature05236. [DOI] [PubMed] [Google Scholar]
- 36.Sun H, Zhang M, Cheng K, Li P, Han S, Li R, et al. Resistance of glioma cells to nutrient-deprived microenvironment can be enhanced by CD133-mediated autophagy. Oncotarget. 2016;7(46):76238–76249. doi: 10.18632/oncotarget.12803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Angelastro JM, Lamé MW. Overexpression of CD133 promotes drug resistance in C6 glioma cells. Mol Cancer Res. 2010;8(8):1105–1115. doi: 10.1158/1541-7786.MCR-09-0383. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Yu SP, Yang XJ, Zhang B, Ming HL, Chen C, Ren BC, et al. Enhanced invasion in vitro and the distribution patterns in vivo of CD133+ glioma stem cells. Chin Med J. 2011;124(17):2599–2604. [PubMed] [Google Scholar]
- 39.Couturier CP, Ayyadhury S, Le PU, Nadaf J, Monlong J, Riva G, et al. Single-cell RNA-seq reveals that glioblastoma recapitulates a normal neurodevelopmental hierarchy. Nat Commun. 2020;11(1):3406. doi: 10.1038/s41467-020-17186-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Khabibov M, Garifullin A, Boumber Y, Khaddour K, Fernandez M, Khamitov F, et al. Signaling pathways and therapeutic approaches in glioblastoma multiforme (review) Int J Oncol. 2022;60(6):1–18. doi: 10.3892/ijo.2022.5359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Pearson JRD, Regad T. Targeting cellular pathways in glioblastoma multiforme. Signal Transduct Target Ther. 2017;2(1):17040. doi: 10.1038/sigtrans.2017.40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Vitucci M, Karpinich NO, Bash RE, Werneke AM, Schmid RS, White KK, et al. Cooperativity between MAPK and PI3K signaling activation is required for glioblastoma pathogenesis. Neuro Oncol. 2013;15(10):1317–1329. doi: 10.1093/neuonc/not084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Dong L, Qi N, Ge RM, Cao CL, Lan F, Shen L. Overexpression of CD133 promotes the phosphorylation of Erk in U87MG human glioblastoma cells. Neurosci Lett. 2010;484(3):210–214. doi: 10.1016/j.neulet.2010.08.057. [DOI] [PubMed] [Google Scholar]
- 44.Wei Y, Jiang Y, Zou F, Liu Y, Wang S, Xu N, et al. Activation of PI3K/Akt pathway by CD133-p85 interaction promotes tumorigenic capacity of glioma stem cells. Proc Natl Acad Sci USA. 2013;110(17):6829–6834. doi: 10.1073/pnas.1217002110. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets supporting the conclusions of this article are available in the TCGA-GEPIA (http://gepia.cancer-pku.cn/), and cBioPortal (https://www.cbioportal.org/), and CCLE (https://sites.broadinstitute.org/ccle/).








