Environmental Detection of Parasites in the Marginalized Paiute Reservations Compared to a Nearby Area

ABSTRACT.

The amounts of parasite DNA in soil samples from different playgrounds and other public areas can help identify areas of possible microbe transmission and give indications of the possible occurrence of parasite infection in nearby communities. We collected 207 soil samples from parks in Paiute indigenous tribal areas in southwestern Utah and from the higher income city of St. George, Utah, and tested them for 11 parasites that can cause human disease. Molecular tests revealed an elevated odds ratio (OR) of 3.072 (range, 1.114–8.065) for detecting the helminth Trichuris trichiura and an elevated OR of 3.036 (range, 1.101–7.966) for any protozoa (not including Acanthamoeba) in the tribal land playgrounds compared with St. George parks. These findings support previous studies showing that areas in lower socioeconomic communities, especially marginalized communities, tend to have more parasites in the soil, which may lead to higher disease prevalence rates.

INTRODUCTION

Parasites and parasite larvae in soil pose a potentially serious health risk to those living in marginalized communities. The transmission of parasites to humans can lead to several serious health problems, ranging from mild allergies to fatal amoebic encephalitis. Children are particularly vulnerable to fecal–oral transmission from soil contaminated by zoonotic and human-derived parasites. Protozoans (e.g., Giardia intestinalis) and helminths (e.g., Trichuris trichiura) have complex life cycles and can remain dormant for extended periods in soil and water, exposing humans to these transmission risks.

Although parasitic transmission can be blunted through improved sanitation efforts, clean drinking water, and access to medical care, many underserved populations struggle to meet these necessities^1–3 and, as a result, have been noted to have a greater seroprevalence of parasitic infections.⁴ Children in these populations are of particular concern because of the increased hand-to-mouth transmission from soil.⁵ In addition, early health disadvantages in a child can affect an individual’s success negatively later in life, long after the original illness has resolved.⁶

It has been well established that indigenous reservations generally experience greater rates of poverty and socioeconomic disadvantages.⁷ A link between a greater burden of soil parasites in populations with a lower socioeconomic status has been established in other areas of the country, so it is reasonable to suspect a similar trend in native lands.⁸ To our knowledge, soil in the native Paiute lands in southern Utah has not been tested for parasites. This study analyzed soil samples collected from various parks and public spaces within the Paiute tribal band lands. We then compared the parasite presence in these samples with those collected from areas in St. George, Utah, with similar communal use. Our goal with this research is to raise awareness regarding parasitic transmission and to analyze differences in the number of organisms found between regions of differing socioeconomic status.

MATERIALS AND METHODS

Written permission to collect soil samples was obtained from The Paiute Indian Tribe of the Utah Tribal Council and the Parks Division of the city of St. George. Soil samples were collected from publicly used spaces in St. George and the Paiute native lands. The Utah and Arizona locations are generally desert habitats or similarly dry environments. The samples were collected during a 12-month period in 2021. Sampling locations in St. George parks were defined by greater socioeconomic status.

A total of 207 soil samples were collected via 50-mL test tubes and stored in airtight plastic storage containers. Soil samples collected were then stored at 4°C on the Rocky Vista University campus (St. George, UT). Samples were photographed and geotagged with the exact location of where they were collected. Soil samples were moved and processed at Baylor College of Medicine (Houston, TX), where they were stored at –20°C prior to undergoing additional investigative methods.

Soil samples were weighed, and dry weight was recorded. Samples were then transferred to a new Falcon tube with no more than 25 mL of solid material per tube. If more than 25 mL of soil was available, the sample was divided evenly between two Falcon tubes. Next, 0.05% Tween/phosphate-buffered saline was added to each sample until the total volume of each tube measured 45 mL. Samples were then centrifuged at 1,500 rpm for 5 minutes. Supernatants were filtered using a 3.0-μm mixed cellulose ester membrane (Millipore, Tullagreen, Ireland). Membranes were processed using the FastDNA SPIN Kit for Soil (MP Biomedicals, Santa Clara, CA) and heated at 90°C for 10 minutes before bead beating. DNA was then analyzed further through multiparallel quantitative polymerase chain reaction (qPCR) to screen for 11 different parasitic-specific DNA sequences (Ancylostoma duodenale, Ascaris lumbricoides, Necator americanus, Strongyloides stercoralis, Toxocara canis/cati, T. trichiura, Acanthamoeba species, Blastocystis species, Cryptosporidium species, Entamoeba histolytica, and G. intestinalis) using primer and probes from a previous study.⁹ Acanthamoeba control DNA came from Acanthamoeba castellanii (American Type Culture Collection strain 30010).¹⁰ Primers and probes for Acanthamoeba species included the forward primer CCCAGATCGTTTACCGTGAA, the reverse primer TAAATATTAATGCCCCCAACTATCC, and the probe 5′ fluorescein amidites minor groove binder CTGCCACCGAATACATTAGCATGG.¹¹

RESULTS

The percentage of population living in poverty on Paiute Reservations in Utah was 28.6%,¹² compared with 10.5% in St. George¹³—a 2.6 times greater increase. For children younger than 18 years, the poverty rate on Paiute Reservations was 49.4% compared with 8% in St. George—an increase of 6.2 times the poverty rate (Figure 1). Parasites detected in Paiute Reservations soils included 15 samples with helminths compared to seven samples from St. George (Table 1).

Figure 1.

The poverty rate on Paiute Reservations compared with St. George.

Table 1.

Prevalence rates of parasites found in soil samples, including dirt, rocks, sand, and woodchips

Parasite	Paiute tribal parks (n = 99 samples), n (%)				All tribal parks, n (%)	St. George parks (n = 108 samples), n (%)				All city parks, n (%)
	Cedar Band (n = 20 samples)	Shivwitts (n = 20 samples)	Koosharem (n = 29 samples)	Kanosh (n = 30 samples)		Canyon View (n = 31 samples)	Mathis (n = 28 samples)	Archie Gubler (n = 29 samples)	Cottonwood Cove (n = 20 samples)
Helminths
Ancylostoma duodenale	0	0	0	0	0	0	0	0	0	0
Ascaris lumbricoides	0	0	0	0	0	0	0	0	0	0
Necator americanus	0	0	0	0	0	0	0	0	0	0
Strongyloides stercoralis	0	0	0	0	0	0	1 (3.6)	0	0	1 (0.92)
Toxocara canis/cati	0	0	0	0	0	0	0	0	0	0
Trichuris trichiura	2 (10)	4 (20)	3 (10.3)	6 (20)	15 (15.2)	0	0	1 (3.4)	5 (25)	6 (5.6)
Total helminths	2	4	3	6	15	0	1	1	5	7
Protozoans
Acanthamoeba species	12 (60)	18 (90)	20 (69)	29 (96.7)	82 (82.8)	22 (71%)	27 (96.4)	28 (95.5)	20 (100)	97 (89.8)
Blastocystis species	1 (5)	0	1 (3.4)	1 (3.3)	3 (3.0)	1 (3.2%)	3 (10.7)	1 (3.4)	1 (5)	6 (5.6)
Cryptosporidium species	0	0	0	0	0	0	0	0	0	0
Entamoeba histolytica	0	0	0	0	0	0	0	0	0	0
Giardia intestinalis	1 (5)	8 (40)	1 (3.4)	2 (6.7)	11 (11.1)	0	0	0	0	0
Total protozoans	30	26	22	32	110	23	30	29	21	103
Total parasites	32	30	25	38	125	23	31	30	26	110

In the Paiute tribal parks, there was a odds ratio (OR) of 3.072 (95% CI: 1.114–8.065) for detecting T. trichiura compared with St. George parks (Table 2).

Table 2.

Odds ratio analysis

Parasite	Paiute tribal parks	St. George parks	Odds ratio (95% CI)	P-value
Helminths	15	7	2.608 (1.006–6.637)	0.0416*
Strongyloides stercoralis	0	1	N/A	N/A
Trichuris trichiura	15	6	3.072 (1.114–8.065)	0.021*
All protozoans	94	103	0.9126 (0.2872–2.902)	0.888
Protozoans†	15	6	3.036 (1.101–7.966)	0.022*
Acanthamoeba species	79	97	0.4479 (0.2076–0.9744)	0.044*
Blastocystis species	3	6	0.5313 (0.1428–2.2029)	0.374
Giardia intestinalis	12	0	N/A	N/A
Total parasites	109	110	N/A	N/A
Total parasites, not Acanthamoeba	30	13	3.177 (1.589–6.256)	0.001*

N/A = not applicable.

^*Statistically significant.

^†With the exception of Acanthamoeba.

DISCUSSION

Our study found many parasites in public parks in the southwestern Utah region and, for the first time, characterized parasites present on Paiute native lands. Furthermore, our data demonstrate a high prevalence of parasites relevant to public health concerns, including T. trichiura and G. intestinalis. Although Acanthamoeba species were found in more samples from the St. George parks, there was no difference in the concentration of DNA. However, Acanthamoeba is known to be a free-living organism found in a very vast array of environments. Although it is an important consideration as an infectious agent itself or as a vector for other infectious agents, its presence does not necessarily reflect the effects of poverty. When this ubiquitous organism was not included in our analysis, the higher all-parasite burden of Paiute parks becomes relatively clear (OR, 3.177; P = 0.0012).

A previous study⁸ demonstrated a significant association between T. catis and lower socioeconomic status in various New York City boroughs. Our findings are similar in demonstrating a greater parasite burden in the lower socioeconomic areas, which may add to the already notable health disparities between native reservations and the rest of the United States.

One major difference that may contribute to the greater rates of parasites in tribal areas is the lack of fencing in the tribal parks as opposed to the fenced St. George parks. Increased fencing could be an important measure to decrease soil-borne parasites. Tribal elders, as well as St. George city officials, should be encouraged to initiate interventions, including measures to increase awareness and surveillance among local health-care workers of Trichuris and Giardia (which often go undiagnosed) as well as Acanthamoeba, which although it rarely causes infection can facilitate other pathogens; measures to control the population of stray dogs and feral cats; and increased sanitation measures within the parks. Educational programs should include handwashing and encouraging children not to put foreign objects or soil in their mouths.

Our study was limited by the precise nature of the qPCR probes, which are specific to human parasites. However, many zoonotic parasites have not yet been sequenced to the degree of detail needed to differentiate them from other species and therefore could have been cross-detected. For example, Trichuris vulpis, a species of whipworm known to infect dogs, has been known to cause false detections with T. trichiura qPCR probes.¹⁴ In addition, our study was limited to the species for which we happened to test with our qPCR probes. Also, the possibility of human error must be considered along with randomization methods of soil retrieval. Soil samples were selected at random; however, specific soil densities and moisture levels were not standardized. Future studies could include animal surveillance to increase our understanding of study results as well as the consideration of factors such as the extent of vegetation and the frequency of nonprecipitation watering in each park.

CONCLUSION

Although important, soil studies are limited in detecting actual transmission and infection rates in a population. Further research is necessary to establish the prevalence of parasites on Paiute Reservations versus other local populations. These studies are necessary to establish whether this increased parasite burden leads to greater infection rates.