Abstract
In order to explore the impact of circadian disturbance on erectile function, we randomly divided 24 adult male rats into groups of control (light on at 8:00 a.m. and off at 8:00 p.m.), dark/dark (DD; constant dark), light/light (LL; constant light), and shift dark/light (DL; light off at 8:00 a.m. and on at 8:00 p.m.). Four weeks later, erectile function was measured and corpora cavernosa were harvested for analysis. The maximum intracavernous pressure (mICP) and mICP/mean arterial pressure (MAP) ratio in the DD, LL, and DL groups were significantly lower than that in the control group. The LL and DL groups showed significantly attenuated endothelial nitric oxide synthase (eNOS), while DD, LL, and DL showed reduced neuronal nitric oxide synthase (nNOS) at both mRNA and protein levels. The production of nitric oxide (NO) and cyclic guanosine monophosphate (cGMP) was inhibited by altered light/dark cycles to varying degrees. Circadian disturbance impaired endothelial function and contributed to erectile dysfunction. For the core circadian elements, mRNA expression of circadian locomotor output cycles kaput (Clock) and brain/muscle aryl-hydrocarbon receptor nuclear translocator-like protein 1 (Bmal1) was elevated in the DL group, but their protein expression was not significantly changed. DD, LL, and DL increased period 1 (Per1) and Per3 levels, while LL and DL increased PER1 levels. No significant difference was found for Per2 levels, and PER2 and PER3 concentrations were not significantly changed. Moreover, LL and DL significantly increased cryptochrome-1 (CRY1) and CRY2 at both mRNA and protein levels. The altered light/dark rat model showed that circadian disturbance contributed to erectile dysfunction probably by impairing endothelial function. Meanwhile, the core circadian elements were detected in the corpora cavernosa, but these were disrupted. However, which circadian element regulates erectile function and how it works need further analysis.
Keywords: circadian disturbance, endothelial function, erectile function, light/dark cycle, NO/cGMP
INTRODUCTION
Erectile dysfunction (ED) brings huge distress to couples and seriously impairs their health.1,2 Being a result of altered lifestyle, elevated work pressure, and polluted living environments, the incidence of ED is rapidly increasing, with estimates reaching 322 million in 2025.2,3 As global economies have improved, individuals have paid more attention to higher life quality and the number of consultations for ED has dramatically increased. Considering the limitations of current treatments, it is necessary to clarify relevant risk factors to reduce the incidence of ED, decreasing patient burdens and health-related costs.
All plants and animals have evolved an intrinsic and inherent timing system to synergize with solar days and adapt to external alterations.4,5,6,7 This is called circadian rhythm4,5,6,7 which is essential to maintain physiological functions and guarantee optimal performance for organisms.6,7 At molecular level for circadian system,8,9 the circadian locomotor output cycles kaput (CLOCK) and brain/muscle aryl-hydrocarbon receptor nuclear translocator-like protein 1 (BMAL1) polymerize the positive complex to activate transcription of other clock genes (such as period 1/2/3 [PER1/2/3], cryptochrome 1/2 [CRY1/2], retinoic acid-related orphan nuclear receptor [REV-ERB], and retinoic acid-related orphan receptor [ROR]) and clock-controlled genes.10,11 PER and CRY accumulate in the cytoplasm and translocate to the nucleus to restrict the activity of CLOCK/BMAL1, forming the main negative feedback loop.6,7,10,11 The PER/CRY complex is subsequently disassembled and resolved; a new 24-h circadian cycle is then started.6,7,10,11
During the past century, technological advancements and global industrialization have significantly altered lifestyle and work patterns, which have inevitably changed daily wake/sleep cycles and disrupted intrinsic circadian rhythm.11 Numerous studies have shown that circadian disturbance increases the incidence of hypertension, diabetes, overweight, hyperlipidemia, and atherosclerosis,10,11,12 which are all risk factors for ED. In addition, Pastuszak et al.13 found that the international index of erectile function (IIEF) score was linearly associated with sleep quality. Rodriguez et al.14 revealed that patients with shift work sleep disorder suffered from significantly reduced IIEF scores, and Kling et al.15 reported that insufficient sleep (<5 h per night) predicted lower sexual activity and less sexual satisfaction.
Thus, epidemiological studies demonstrated complex interactions between circadian disturbance and ED;13,14,16,17 however, the underlying mechanism has never been explored and which clock gene/protein is involved in the regulatory process also needs clarification. We investigated the association between circadian disturbance and erectile function, using a rat model with altered light/dark cycles.18,19
MATERIALS AND METHODS
This study was approved by the Animal Ethics Committee of Affiliated Hospital of Guizhou Medical University (Guiyang, China; Approval No. 2022063). Twenty-four Sprague–Dawley male rats (7 weeks; about 260 g body weight) were purchased (Dashuo Experimental Animal, Co., Ltd., Chengdu, China) and housed in accordance with standard guidelines. The rats were kept in transparent acrylic cages and acclimatized to a light/dark (LD; light on at 8:00 a.m. and off at 8:00 p.m.) cycle for 1 week. Then, they were randomly divided into four groups (n = 6 each): control (LD cycle), dark/dark (DD; constant dark), light/light (LL; constant light), and shift dark/light (DL; light off at 8:00 a.m. and on at 8:00 p.m.).19,20,21 All rats were kept under different light/dark regimes for 4 weeks and their final weights were measured before subsequent analysis.
Erectile function detection
Erectile function was measured from 8:00 a.m. to 10:00 a.m. (8 rats per day; 2 rats were analyzed from each of the four groups), and the penile tissue was subsequently dissected; we collected the data over 3 days to detect penile erections for all 24 rats. Moreover, erectile function was assessed by recording the maximum intracavernous pressure (mICP) and mICP/mean arterial pressure (MAP) ratio as previously described.22 After anesthetization by intraperitoneal chloraldurate injection (10%, 0.35 ml per 100 g body weight), the left carotid was carefully exposed and cannulated with a heparinized (200 IU ml−1) detaining venipuncture (26G) needle to monitor the arterial pressure through a pressure transducer. The left cavernous nerve was carefully separated with a low midline abdominal incision, and the penis was denuded of skin; then, a heparinized scalp acupuncture (24G) needle was inserted into the left penile crus to record ICP through another pressure transducer. When the cavernous nerve was electrically stimulated (using a voltage of 5 V at frequency of 20 Hz, pulse width was 5 ms and sustained for 60 s),22 the ICP and arterial pressure were simultaneously recorded using a BL420 bio-function experiment system (Chengdu TME Technology Co., Ltd., Chengdu, China). The basic ICP (bICP; before electrical stimulation), mICP, and MAP were analyzed, and the final mICP/MAP ratio was calculated and compared between groups.
Tissue harvesting
After erectile assessment, the penises were harvested and washed with cold phosphate-buffered saline (PBS). The corpora cavernosa (below the cartilage of the glans to penile crus) were cut into three sections (including distal, medial, and proximal) and stored in liquid nitrogen for further analysis. Meanwhile, arterial blood from the carotid artery was also collected for hormone detection.
Western blot
The frozen distal corpora cavernosa were snipped and homogenized in radioimmunoprecipitation assay (RIPA) lysis buffer supplemented with inhibitors of protease and phosphatase (MedChemExpress, Monmouth Junction, NJ, USA), followed by centrifugation at 12 000g for 20 min at 4°C (YXJ-2; Xiangyi Laboratory Instrument Development Co., Ltd., Changsha, China). The protein concentration was evaluated using Coomassie brilliant blue G250, while equal samples were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore Corporation, Billerica, MA, USA) according to standard procedures. After blocking with 5% powdered skim milk in Tris-buffered saline with Tween (TBS-T) for 1 h at room temperature, the membranes were incubated with primary antibodies against endothelial nitric oxide synthase (eNOS; 1:800, ab76198; Abcam, Cambridge, UK), neuronal nitric oxide synthase (nNOS; 1:800, ab3511; Abcam), CLOCK (1:1000, A7265; ABclonal Technology, Wuhan, China), BMAL1 (1:1000, A4714; ABclonal Technology), PER1/2/3 (1:1000/1000/1000, A8449/A3217/A2219; ABclonal Technology), CRY1/2 (1:1000/400, A13662/A17465; ABclonal Technology), and REV-ERBα (1:1000, A20452; ABclonal Technology) for 24 h at 4°C. The membranes were washed and then incubated with secondary glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibodies (Zen BioScience Co., Ltd., Chengdu, China) for 1 h. The protein band densitometry was measured using a Bio-Rad ChemiDoc MP (Bio-Rad, Hercules, CA, USA) and quantified using Image J software (National Institutes of Health, Bethesda, MD, USA).
Real-time quantitative polymerase chain reaction (RT-qPCR)
The medial corpus cavernosum samples were selected for RT-qPCR analysis. According to the manufacturer’s instructions, total cellular RNA was extracted using the BIOzol total RNA extraction kit (BioFlux Co., Tokyo, Japan) and then reverse-transcribed to cDNA using RT Easy II with gDNase (RT-01032; FOREGENE, Chengdu, China). RT-qPCR was performed using a 2× TSINGKE Master qPCR Mix SYBR Green I (TSE201; TSINGKE, Beijing, China) in CFX connected to a real-time PCR detector (Bio-Rad). The primer sequences used are shown in Supplementary Table 1. The relative gene expression was calculated using the 2−ΔΔCt method with 18S as a housekeeping gene. Experiments were repeated three times.
Supplementary Table 1.
Primer sequences of real-time quantitative polymerase chain reaction
| Gene | Sequence |
|---|---|
| Clock-forward | GCCATCCACCTATGAATATGTGAG |
| Clock-reverse | GTGCGCTGTATAGTTCCTTCGAA |
| Bmal1-forward | AGCACCGTCCTTCCAATGG |
| Bmal1-reverse | TGCTCAGGGAACCGGAGA |
| Rev-erbα-forward | GGTTATGTGGCGTCCTTGAAC |
| Rev-erbα-reverse | GAAGCTGCCATTGGAGCTGT |
| Cry1-forward | ACCATCCGCTGCGTGTACA |
| Cry1-reverse | GGCATCAAGGTCCTCAAGACA |
| Cry2-forward | GCTGTCCTGCAGTGCTTTCTT |
| Cry2-reverse | CAGGTATCGCCGGATGTAGTC |
| Per1-forward | CAATAAGGCAGAGAGCGTGGT |
| Per1-reverse | TCATGATGATGTCCGACTCCG |
| Per2-forward | GCTCCAGCGGAAATGAAAAC |
| Per2-reverse | TCCGCCTCTGTCATCATGAGT |
| Per3-forward | GAAGCACAAACGGAAGAAGC |
| Per3-reverse | GGAGTCCCCTACTCCCTGAG |
| eNOS-forward | ACAGGCATCACCAGGAAGAAG |
| eNOS-reverse | CAGAGCCATACAGGATAGTCG |
| nNOS-forward | CCTATGCCAAGACCCTGTGTGA |
| nNOS-reverse | CATTGCCAAAGGTGCTGGTG |
| Rat-18S-forward | AGTTGGTGGAGCGATTTGTC |
| Rat-18S-reverse | GCTGAGCCAGTTCAGTGTAGC |
nNOS: neuronal nitric oxide synthase; Cry: cryptochrome; Bmal1: brain/muscle aryl-hydrocarbon receptor nuclear translocator-like protein 1; REV-ERB: retinoic acid-related orphan nuclear receptor; Per1/2/3: period 1/2/3; eNOS: endothelial nitric oxide synthase
Nitric oxide (NO) and cyclic guanosine monophosphate (cGMP)
The proximal corpora cavernosa were used to detect NO and cGMP levels. The tissues were cut and homogenized in PBS and then centrifuged to obtain supernatants. Concentrations of NO (E-BC-K035-M; Elabscience Biotechnology Co., Ltd., Wuhan, China) and cGMP (E-EL-0083c; Elabscience Biotechnology Co., Ltd.) were measured by enzyme-linked immunosorbent assay (ELISA) kits according to manufacturer’s instructions. After corresponding operation procedures, the optical density (OD) value of samples was detected using a molecular device SpectraMax 190 (Molecular Devices Corporation, San Jose, CA, USA), while levels of NO and cGMP were calculated by the provided standard curves.
Testosterone detection
Arterial blood was centrifuged to obtain serum samples that were used to detect testosterone (E-EL-0155c; Elabscience Biotechnology Co., Ltd.) levels using an ELISA kit. The final OD values of each sample were determined using a microplate reader (450 nm), and testosterone levels were calculated using affiliated standard curves.
Statistical analyses
Data were expressed as mean ± standard deviation and were analyzed using GraphPad Prism 5.0 (GraphPad Software, San Diego, CA, USA). One-way analysis of variance was used to calculate differences among multiple groups, using Tukey’s test to compare all pairs of columns. For the differences between two groups, Student’s t-test was used. When P < 0.05, the difference was considered statistically significant.
RESULTS
During the experiments, there were no significant differences in rats’ primary body weight among the groups (P = 0.4622), while rats’ final body weights were also consistent (P = 0.3147), as shown in Table 1 and Supplementary Figure 1 (50.2KB, tif) .
Table 1.
Basic information of rats
| Variable | Control group | DD group | LL group | DL group | P |
|---|---|---|---|---|---|
| Primary weight (g) | 261.00±6.29 | 262.33±3.08 | 259.83±4.62 | 259.00±4.52 | 0.4622 |
| Final weight (g) | 452.33±13.66 | 451.50±2.44 | 424.17±39.82 | 437.33±34.12 | 0.3147 |
| bICP (mmHg) | 7.85±1.15 | 7.21±0.70 | 7.31±0.90 | 7.00±0.97 | 0.4715 |
| mICP (mmHg) | 80.45±6.43 | 68.35±3.70 | 69.42±4.05 | 69.05±6.64 | 0.0022 |
| MAP (mmHg) | 122.53±15.76 | 120.60±8.69 | 123.77±7.29 | 125.91±7.58 | 0.8433 |
| mICP/MAP ratio | 0.66±0.07 | 0.57±0.02 | 0.56±0.03 | 0.55±0.07 | 0.0051 |
All data were expressed as mean±standard deviation. Control: light on at 8:00 a.m. and off at 8:00 p.m.; DD: dark/dark (constant dark); LL: light/light (constant light); DL: dark/light (light off at 8:00 a.m. and on at 8:00 p.m.). ICP: intracavernous pressure; bICP: basic ICP; mICP: maximum ICP; MAP: mean arterial pressure
Erectile function assessment
The control rats showed insignificantly higher bICP (7.85 ± 1.15 mmHg; P = 0.4715) than the DD (7.21 ± 0.70 mmHg), LL (7.31 ± 0.90 mmHg), and DL (7.00 ± 0.97 mmHg) groups, while the four groups revealed similar MAP levels (P = 0.8433), as shown in Table 1 and Figure 1.
Figure 1.

Circadian disturbance dramatically impairs erectile function. (a) Representative images of mICP under cavernous nerve stimulation for 50 s. (b) Statistical analysis of bICP. (c) Statistical analysis of MAP. Statistical analysis of (d) mICP and (e) mICP/MAP ratio under cavernous nerve stimulation for 50 s. *P < 0.05, **P < 0.01. Control: light on at 8:00 a.m. and off at 8:00 p.m.; DD: dark/dark (constant dark); LL: light/light (constant light); DL: dark/light (light off at 8:00 a.m. and on at 8:00 p.m.). mICP: maximum intracavernous pressure; bICP: basic intracavernous pressure; MAP: mean arterial pressure.
For mICP, the control group presented significantly higher values (80.45 ± 6.43 mmHg; P = 0.0022) than the DD (68.35 ± 3.70 mmHg), LL (69.42 ± 4.05 mmHg), and DL (69.05 ± 6.64 mmHg) groups; however, there was no difference among the DD, LL, and DL groups (P > 0.05). For the mICP/MAP ratio, control rats also had significantly higher values (0.66 ± 0.07; P = 0.0051) than the DD (0.57 ± 0.02), LL (0.56 ± 0.03), and DL (0.55 ± 0.07) groups, while no significant difference was demonstrated among the DD, LL, and DL groups (P > 0.05), as shown in Table 1 and Figure 1.
Molecular analysis of erectile function
Key molecular indicators were detected to confirm altered erectile function. For RT-qPCR, the DD, LL, and DL groups revealed significantly lower eNOS mRNA level than the control group (P < 0.0001), while eNOS level in the DL group was also lower than that in the DD group (P < 0.0001). The nNOS mRNA levels in the DD, LL, and DL groups were significantly lower than that in the control group (P < 0.0001), while nNOS levels in the LL and DL groups were also lower than that in the DD group (P < 0.0001), as shown in Figure 2.
Figure 2.

Circadian disturbance sharply damages endothelium and decreased NO/cGMP productions. (a) Representative western blot images for eNOS. (b) Representative western blot images for nNOS. (c) Statistical analysis for protein concentrations of eNOS. (d) Statistical analysis for protein concentrations of nNOS. (e) Statistical analysis for eNOS mRNA levels. (f) Statistical analysis for nNOS mRNA levels. (g) Statistical analysis for NO production. (h) Statistical analysis for cGMP production. *P < 0.05, **P < 0.01, ***P < 0.001. The definition of different groups is shown in Figure 1. eNOS: endothelial nitric oxide synthase; nNOS: neuronal nitric oxide synthase; NO: nitric oxide; cGMP: cyclic guanosine monophosphate; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
For western blot analysis, the LL and DL groups revealed significantly decreased eNOS expression compared with control rats (P = 0.0013), while the DD, LL, and DL groups demonstrated lower nNOS protein levels (P = 0.0010). No other significant differences were found for eNOS or nNOS (all P > 0.05; Figure 2).
Furthermore, the LL and DL groups showed significantly lower NO levels than the control group (P < 0.0001), while DL showed significantly decreased NO production compared with the DD and LL groups (P < 0.0001). In addition, the LL and DL groups showed lower cGMP levels than control rats (P < 0.0001), while cGMP in the LL group was also significantly lower compared with the DD group (P < 0.0001), as shown in Figure 2.
The phosphodiesterase type 5 (Pde5) mRNA levels in the LL and DL groups were also significantly higher than that in the control group (P = 0.0296; Supplementary Figure 2 (48.3KB, tif) ).
Disrupted circadian rhythm
For the heterodimer of CLOCK/BMAL1, mRNA levels of Clock in the control and DD groups were significantly lower than that in the DL group (P = 0.0082), and no other significant difference was found (P > 0.05). Moreover, Bmal1 mRNA levels in the control and DD groups were significantly lower than that in the DL group (P = 0.0025), while Bmal1 level in the DD group was also significantly lower than that in the LL group (P = 0.0025). However, the CLOCK and BMAL1 protein levels were similar among the groups (P > 0.05; Figure 3).
Figure 3.

Circadian elements of corpora cavernosa are changed by light/dark alteration. (a) Representative western blot images for CLOCK, and statistical analysis for CLOCK and Clock. (b) Representative western blot images for BMAL1, and statistical analysis for BMAL1 and Bmal1. (c) Representative western blot images for REV-ERBα, and statistical analysis for REV-ERBα and Rev-erbα. *P < 0.05, **P < 0.01, ***P < 0.001. The definition of different groups is shown in Figure 1. CLOCK: circadian locomotor output cycles kaput; BMAL1: brain/muscle aryl-hydrocarbon receptor nuclear translocator-like protein 1; REV-ERBα: retinoic acid-related orphan nuclear receptor alpha; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
For the PER/CRY complex, Per1 (P = 0.0266) and Per3 (P = 0.0003) mRNA levels in the control group were significantly lower compared with the DD, LL, and DL groups, and Per3 levels in the DD and DL groups were also significantly lower than that in the LL group (P = 0.0003). There was no other difference for Per1 or Per3 among the remaining groups (P > 0.05), and Per2 was consistent among the four groups (P = 0.3208). For the corresponding proteins, PER1 in the LL and DL groups was significantly increased compared with the control group (P = 0.0172), but no significant difference was found between other groups (all P > 0.05). Moreover, PER2 (P = 0.3299) and PER3 (P = 0.5305) were similarly expressed among the groups (Figure 4).
Figure 4.

Circadian elements of corpora cavernosa are changed by light/dark alteration. (a) Representative western blot images for PER1, and statistical analysis for PER1 and Per1. (b) Representative western blot images for PER2, and statistical analysis for PER2 and Per2. (c) Representative western blot images for PER3, and statistical analysis for PER3 and Per3. (d) Representative western blot images for CRY1, and statistical analysis for CRY1 and Cry1. (e) Representative western blot images for CRY2, and statistical analysis for CRY2 and Cry2. *P < 0.05, **P < 0.01, ***P < 0.001. The definition of different groups is shown in Figure 1. PER: period; CRY: cryptochrome; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
The Cry1 (P < 0.0001) and Cry2 (P = 0.0003) mRNA levels in the LL and DL groups were higher than those in the control group, while Cry1 (P < 0.0001) and Cry2 (P = 0.0003) levels in the LL group were significantly higher than those in the DD and DL groups. In addition, CRY1 (P = 0.0077) and CRY2 (P = 0.0187) protein expression in the LL and DL groups was significantly elevated compared with the control group, while no other difference was found (P > 0.05; Figure 4).
The Rev-erbα mRNA levels in the DD and LL groups were significantly higher than that in the control group (P = 0.0050), while Rev-erbα in the LL group was also significantly higher than that in the DL group (P = 0.0050). Regarding the protein concentration, REV-ERBα in the DD group was higher than those in the control, LL, and DL groups (P < 0.0001), while REV-ERBα in the LL group was also significantly higher than that in the DL group (P < 0.0001), as shown in Figure 3.
Testosterone levels
The DD, LL, and DL groups revealed slightly higher testosterone secretion than the control group; however, the difference was not significant (P = 0.0643; Supplementary Figure 2 (48.3KB, tif) ).
DISCUSSION
The penis is regulated by the circadian clock, and circadian disturbance or wake/sleep disturbance theoretically contributes to ED;12 this has been shown by some epidemiological studies,13,14,16,17 but no fundamental research has explored it.
Light is the primary zeitgeber or “time giver” to synchronize internal circadian rhythm to the external environment,4,5,6,7,20 so using altered light/dark cycles is an important and effective modeling method to explore circadian rhythm.19 For instance, Yoshinaka et al.23 found that repetitive reversal of light/dark alterations for 4 weeks triggered irregular estrous cycles in mice, while a 3-day rotation was more severe than a 6-day cycle. Summa et al.24 observed that 6-h phase light/dark shifts every 5–6 days significantly decreased pregnancy success in mice. Green et al.25 demonstrated that smartphone or tablet usage in the evening and after bedtime decreased sperm motility, motility, and concentration, and increased the percentage of immotile sperm.
We thus explored the association between circadian rhythm and erectile function by altering daily light/dark cycles.19,20,21 As a result, although the bICP and MAP values were constant, the DD, LL, and DL groups revealed significantly decreased mICP and mICP/MAP ratios compared with the control group, suggesting that erectile function was impaired by disrupted photoperiods. As a highly vascularized organ, penile erections require an intact endothelium and smooth muscle cells (SMCs) of sinusoids,1,26,27 while NO released from the endothelium and parasympathetic nerve terminals is the primary neurotransmitter.1,18,27 We further found that eNOS and nNOS mRNA levels were lower in the DD, LL, and DL groups, while eNOS expression was lower in the LL and DL groups, and nNOS was reduced in the DD, LL, and DL groups. In addition, NO production was also significantly attenuated by altered light/dark cycles, especially in the DL group. These findings showed that circadian disturbance damaged the endothelium and reduced NO secretion, which might finally contribute to ED. Moreover, downstream cGMP decreases calcium (Ca2+) levels in SMCs and leads to vasodilation of smooth muscle in the corpora cavernosa,1,18,26,27 while PDE5 inactivates cGMP to increase cytosolic Ca2+ concentrations and induce contraction of smooth muscle.26 We also found that Pde5 mRNA levels were higher in the LL and DL groups while cGMP concentrations were lower, suggesting that circadian misalignment might accelerate cGMP degradation by activating Pde5. In conclusion, we reported that circadian disturbance impaired endothelial function to lead to ED from a fundamental research.
Apart from the central oscillator in the suprachiasmatic nucleus, circadian genes are expressed in almost all tissues and independently regulate cellular behavior.6,7,11 However, no study has investigated these in the penis. As a result, we detected core circadian genes and coded proteins in corpus cavernosum tissue, and how circadian rhythm regulated penile erections was highly interesting. There are complex interactions between environmental light and the NOS/NO/cGMP/protein kinase G (PKG) pathway.28 Light stimulation at CT14/18 induces Ca2+/calmodulin-dependent protein kinase II (CaMKII) phosphorylation of NOS29 to increase its activity and NO concentrations,28 which finally elevates cGMP production to induce PKG activity.28,30 Meanwhile, the increased cGMP accelerates light-induced phase advances and re-entrainment to advancing light/dark cycles.28,31 However, this interaction needs further exploration, especially in penile erections.
Numerous studies have shown that CLOCK/BMAL1 plays essential roles in endothelial function.11,32,33,34,35 For instance, Anea et al.33 found that Bmal1 knockout mice revealed impaired aortic endothelial function as elevated superoxide anions decreased NO production by inhibiting eNOS activation. Clock mutants and Bmal1 knockout mice suffered from endothelial dysfunction and vascular injury from damaged protein kinase B (PKB) and NO signaling.11,34 Moreover, CLOCK upregulated intercellular adhesion molecule-1 expression and promoted monocyte adhesion to endothelial cells,11,36 while Bmal1 knockout deteriorated endothelial integrity and induced barrier dysfunction by promoting the expression of adhesion molecules.32,37 In the present study, we found that Clock and Bmal1 mRNA levels in corpus cavernosum tissue in the DL group were significantly higher than that in controls; however, the corresponding proteins were not changed. Research has suggested that patterns in mRNA and proteins on the same time scale might result from time dislocation in transcription and translation, while the periodic oscillation of clock genes also exists in translation, posttranslational modification, and degradation mechanisms.38,39 However, how CLOCK/BMAL1 regulates penile endothelial function is not clear.
The negative arm of PER/CRY is essential to maintain 24-h circadian oscillations,6,7 while PER is tightly involved in the regulation of vascular endothelial function.11,32 For instance, the Per1/2 mRNA levels in the healthy mouse aorta peaked during the dark phase and were the lowest during the day,11,40,41 and the aortic endothelium-dependent relaxation was increased in wild-type mice but not changed in Per2 mutant mice during the transition between resting to active phases.41,42 Meanwhile, Viswambharan et al.43 observed that Per2 mutant mice were associated with aortic endothelial dysfunction by reducing the secretion of NO and vasodilatory prostaglandins. Furthermore, Per2 impaired endothelial function by decreasing NO production and inducing senescence.32,41,43,44 We found that Per2 mRNA and PER2 protein in corpora cavernosa were not changed, Per1/3 was significantly increased in the DD, LL, and DL groups, and PER1 was enhanced in the LL and DL groups. We wonder whether the elevated Per1/3 or PER1 also impairs endothelial function by decreasing NO production; how it works also requires further exploration.
The mouse aortic Cry1/2 also peaked in the early evening and was the lowest during the day,40 while CRY1 in human saphenous vein showed peak expression at 6:00 a.m. and the minimum at 6:00 p.m.45 Yang et al.46 found that patients with atherosclerosis showed significantly decreased CRY1 levels, while overexpression of Cry1 in an atherosclerotic mouse model decreased plaque in the aortic sinus and reduced adhesion molecules. Qin and Deng47 observed that sleep deprivation dramatically decreased Cry1 in endothelial cells, increased adhesion molecules, and induced monocyte binding to vascular endothelial cells; however, overexpression of Cry1 inhibited these processes. However, the association between CRY1/2 and the endothelium or NO was slightly less. Although we have observed that Cry1/2 mRNA and coded proteins were higher in the LL and DL groups, whether and how the elevated Cry/CRY affects endothelial function also need investigation.
Androgens are essential for penile erection and testosterone deficiency impairs it.18,27 Testosterone is normally rhythmically secreted; it starts rising at sleep onset and peaks during the first rapid eye movement sleep bout.18 However, whether circadian disturbance alters testosterone levels remains controversial.12,18,48 For instance, Leproult and Van Cauter49 observed that the daytime testosterone concentrations decreased by 10%–15% when sleep was restricted to 5 h per night for 1 week; however, Smith et al.50 claimed that neither acute severe (sleeping 4 h per night for 5 nights) nor chronic mild (reduction by 1.5 h per night for 6 weeks) sleep restriction reduced testosterone levels. In addition, Papantoniou et al.51 found that night workers revealed higher androgen production than day workers. Thus, the association between circadian disturbance and testosterone secretion is complex and controversial. Although we found that testosterone levels were marginally increased by altered light/dark cycles, whether its rhythmic secretion was shifted remains unknown. Moreover, whether circadian disturbance impaired penile erections by regulating testosterone production also needs research.
This study showed that circadian disturbance deteriorated erectile function in rats; however, there were some limitations in the study. First, studies showed that circadian disruptions impaired endothelium structures and induced endothelial dysfunction, but how it damaged penile endothelial cells was not explored. Second, the altered light/dark cycles changed almost all circadian genes and proteins, but which elements mainly regulate penile endothelial function and induce ED require further investigation. Moreover, as the main pathway in the erectile process, how NO/cGMP signaling was influenced by circadian disruptions was still unclear. Finally, we measured penile erections under a unique stimulation parameter, which could not fully reflect the characteristics of natural erections; whether the expression of certain gene was influenced by cavernous nerve stimulation needs further exploration.
CONCLUSIONS
The rats with altered light/dark cycles revealed decreased mICP and mICP/MAP ratio, suggesting that penile erection was impaired. Reduced NOS/NO/cGMP signaling implied that circadian disturbance likely induced ED through deterioration of endothelial function. All main circadian genes and relevant proteins were detected in corpus cavernosum tissue and were altered by different light/dark cycles. However, which clock genes/proteins regulate erectile function and the related mechanisms require further exploration. Although the prospect is worth anticipating, there is much to do before more scientific sleep patterns and rational lifestyles can be recommended to improve erectile function in the public.
AUTHOR CONTRIBUTIONS
TL and YTJ conceived the project and wrote the paper. XZQ and PC raised rats to establish animal model. JHZ and FL performed western blot, PCR, and other fundamental analyses. JQ and JG supervised and interpreted the data. GSD and QW drafted and revised the manuscript. All authors read and approved the final manuscript.
COMPETING INTERESTS
All authors declared no competing interests.
Circadian disturbance has no impact on rats’ primary and final weight.
Circadian disturbance induces Pde5 mRNA level but does not change testosterone production.
ACKNOWLEDGMENTS
This manuscript was funded by the National Nature Science Foundation of China (No. 82360295 and No. 82060276), the Science and Technology Foundation Project of Guizhou Provincial Health Commission (gzwkj2024-150), the Doctor Start-up Fund of Affiliated Hospital of Guizhou Medical University (gyfybsky-2023-03), and the Science and Technology Department of Guizhou Province (QianKeHeJiChu-ZK[2021]YiBan382).
Supplementary Information is linked to the online version of the paper on the Asian Journal of Andrology website.
REFERENCES
- 1.Yafi FA, Jenkins L, Albersen M, Corona G, Isidori AM, et al. Erectile dysfunction. Nat Rev Dis Primers. 2016;2:16003. doi: 10.1038/nrdp.2016.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Frederick LR, Cakir OO, Arora H, Helfand BT, McVary KT. Undertreatment of erectile dysfunction:claims analysis of 6.2 million patients. J Sex Med. 2014;11:2546–53. doi: 10.1111/jsm.12647. [DOI] [PubMed] [Google Scholar]
- 3.Bacon C, Mittleman M, Kawachi I, Giovannucci E, Glasser D, et al. Sexual function in men older than 50 years of age:results from the health professionals follow-up study. Ann Intern Med. 2003;139:161–8. doi: 10.7326/0003-4819-139-3-200308050-00005. [DOI] [PubMed] [Google Scholar]
- 4.Chan MC, Spieth PM, Quinn K, Parotto M, Zhang H, et al. Circadian rhythms:from basic mechanisms to the intensive care unit. Crit Care Med. 2012;40:246–53. doi: 10.1097/CCM.0b013e31822f0abe. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bass J, Takahashi JS. Circadian integration of metabolism and energetics. Science. 2010;330:1349–54. doi: 10.1126/science.1195027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Walker WH, 2nd, Bumgarner JR. Light pollution and cancer. Int J Mol Sci. 2020;21:9360. doi: 10.3390/ijms21249360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Noh JY, Han DH, Yoon JA, Kim MH, Kim SE, et al. Circadian rhythms in urinary functions:possible roles of circadian clocks? Int Neurourol J. 2011;15:64–73. doi: 10.5213/inj.2011.15.2.64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Li T, Bai Y, Jiang Y, Jiang K, Tian Y, et al. Potential effect of the circadian clock on erectile dysfunction. Aging Dis. 2022;13:8–23. doi: 10.14336/AD.2021.0728. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Li T, Bai Y, Jiang Y, Jiang K, Tian Y, et al. The potential impacts of circadian rhythm disturbances on male fertility. Front Endocrinol (Lausanne) 2022;13:1001316. doi: 10.3389/fendo.2022.1001316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Xu H, Huang L, Zhao J, Chen S, Liu J, et al. The circadian clock and inflammation:a new insight. Clin Chim Acta. 2020;512:12–7. doi: 10.1016/j.cca.2020.11.011. [DOI] [PubMed] [Google Scholar]
- 11.McAlpine CS, Swirski FK. Circadian influence on metabolism and inflammation in atherosclerosis. Circ Res. 2016;119:131–41. doi: 10.1161/CIRCRESAHA.116.308034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Vignozzi L, Maggi M. Circadian rhythm and erectile function:is there a penile clock? Nat Rev Urol. 2020;17:603–4. doi: 10.1038/s41585-020-00376-7. [DOI] [PubMed] [Google Scholar]
- 13.Pastuszak AW, Moon YM, Scovell J, Badal J, Lamb DJ, et al. Poor sleep quality predicts hypogonadal symptoms and sexual dysfunction in male nonstandard shift workers. Urology. 2017;102:121–5. doi: 10.1016/j.urology.2016.11.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Rodriguez KM, Kohn TP, Kohn JR, Sigalos JT, Kirby EW, et al. Shift work sleep disorder and night shift work significantly impair erectile function. J Sex Med. 2020;17:1687–93. doi: 10.1016/j.jsxm.2020.06.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kling JM, Manson JE, Naughton MJ, Temkit M, Sullivan SD, et al. Association of sleep disturbance and sexual function in postmenopausal women. Menopause. 2017;24:604–12. doi: 10.1097/GME.0000000000000824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Zhang XB, Lin QC, Zeng HQ, Jiang XT, Chen B, et al. Erectile dysfunction and sexual hormone levels in men with obstructive sleep apnea:efficacy of continuous positive airway pressure. Arch Sex Behav. 2016;45:235–40. doi: 10.1007/s10508-015-0593-2. [DOI] [PubMed] [Google Scholar]
- 17.Smith L, Grabovac I, Veronese N, Soysal P, Isik AT, et al. Sleep quality, duration, and associated sexual function at older age:findings from the English Longitudinal Study of Ageing. J Sex Med. 2019;16:427–33. doi: 10.1016/j.jsxm.2019.01.005. [DOI] [PubMed] [Google Scholar]
- 18.Cho JW, Duffy JF. Sleep, sleep disorders, and sexual dysfunction. World J Mens Health. 2019;37:261–75. doi: 10.5534/wjmh.180045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Schwartz M, Wotus C, Liu T, Friesen W, Borjigin J, et al. Dissociation of circadian and light inhibition of melatonin release through forced desynchronization in the rat. Proc Natl Acad Sci U S A. 2009;106:17540–5. doi: 10.1073/pnas.0906382106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Ogo FM, Siervo G, de Moraes AM, Machado KG, Scarton S, et al. Extended light period in the maternal circadian cycle impairs the reproductive system of the rat male offspring. J Dev Orig Health Dis. 2021;12:595–602. doi: 10.1017/S2040174420000975. [DOI] [PubMed] [Google Scholar]
- 21.Moustafa A. Effect of light-dark cycle misalignment on the hypothalamic-pituitary-gonadal axis, testicular oxidative stress, and expression of clock genes in adult male rats. Int J Endocrinol. 2020;2020:1426846. doi: 10.1155/2020/1426846. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Yuan J, Lin H, Li P, Zhang R, Luo A, et al. Molecular mechanisms of vacuum therapy in penile rehabilitation:a novel animal study. Eur Urol. 2010;58:773–80. doi: 10.1016/j.eururo.2010.07.005. [DOI] [PubMed] [Google Scholar]
- 23.Yoshinaka K, Yamaguchi A, Matsumura R, Node K, Tokuda I, et al. Effect of different light-dark schedules on estrous cycle in mice, and implications for mitigating the adverse impact of night work. Genes Cells. 2017;22:876–84. doi: 10.1111/gtc.12522. [DOI] [PubMed] [Google Scholar]
- 24.Summa K, Vitaterna M, Turek F. Environmental perturbation of the circadian clock disrupts pregnancy in the mouse. PLoS One. 2012;7:e37668. doi: 10.1371/journal.pone.0037668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Green A, Barak S, Shine L, Kahane A, Dagan Y. Exposure by males to light emitted from media devices at night is linked with decline of sperm quality and correlated with sleep quality measures. Chronobiol Int. 2020;37:414–24. doi: 10.1080/07420528.2020.1727918. [DOI] [PubMed] [Google Scholar]
- 26.Fazio L, Brock G. Erectile dysfunction:management update. CMAJ. 2004;170:1429–37. doi: 10.1503/cmaj.1020049. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Shamloul R, Ghanem H. Erectile dysfunction. Lancet. 2013;381:153–65. doi: 10.1016/S0140-6736(12)60520-0. [DOI] [PubMed] [Google Scholar]
- 28.Plano S, Alessandro M, Trebucq L, Endo S, Golombek D, et al. Role of G-substrate in the NO/cGMP/PKG signal transduction pathway for photic entrainment of the hamster circadian clock. ASN Neuro. 2021;13:1759091420984920. doi: 10.1177/1759091420984920. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Agostino P, Ferreyra G, Murad A, Watanabe Y, Golombek D. Diurnal, circadian and photic regulation of calcium/calmodulin-dependent kinase II and neuronal nitric oxide synthase in the hamster suprachiasmatic nuclei. Neurochem Int. 2004;44:617–25. doi: 10.1016/j.neuint.2003.09.005. [DOI] [PubMed] [Google Scholar]
- 30.Ding J, Faiman L, Hurst W, Kuriashkina L, Gillette M. Resetting the biological clock:mediation of nocturnal CREB phosphorylation via light, glutamate, and nitric oxide. J Neurosci. 1997;17:667–75. doi: 10.1523/JNEUROSCI.17-02-00667.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Agostino P, Plano S, Golombek D. Sildenafil accelerates reentrainment of circadian rhythms after advancing light schedules. Proc Natl Acad Sci U S A. 2007;104:9834–9. doi: 10.1073/pnas.0703388104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Zhang Z, Yu B, Wang X, Luo C, Zhou T, et al. Circadian rhythm and atherosclerosis (Review) Exp Ther Med. 2020;20:96. doi: 10.3892/etm.2020.9224. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Anea CB, Cheng B, Sharma S, Kumar S, Caldwell RW, et al. Increased superoxide and endothelial NO synthase uncoupling in blood vessels of Bmal1-knockout mice. Circ Res. 2012;111:1157–65. doi: 10.1161/CIRCRESAHA.111.261750. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Anea CB, Zhang M, Stepp DW, Simkins GB, Reed G, et al. Vascular disease in mice with a dysfunctional circadian clock. Circulation. 2009;119:1510–7. doi: 10.1161/CIRCULATIONAHA.108.827477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ninivaggi M, Kelchtermans H, Kuijpers MJ, Hemmeryckx B, Heemskerk JW, et al. Whole blood thrombin generation in Bmal1-deficient mice. Thromb Haemost. 2014;112:271–5. doi: 10.1160/TH13-11-0910. [DOI] [PubMed] [Google Scholar]
- 36.Gao Y, Meng D, Sun N, Zhu Z, Zhao R, et al. Clock upregulates intercellular adhesion molecule-1 expression and promotes mononuclear cells adhesion to endothelial cells. Biochem Biophys Res Commun. 2014;443:586–91. doi: 10.1016/j.bbrc.2013.12.022. [DOI] [PubMed] [Google Scholar]
- 37.Gibbs J, Ince L, Matthews L, Mei J, Bell T, et al. An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action. Nat Med. 2014;20:919–26. doi: 10.1038/nm.3599. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Meng Q, Logunova L, Maywood E, Gallego M, Lebiecki J, et al. Setting clock speed in mammals:the CK1εtau mutation in mice accelerates circadian pacemakers by selectively destabilizing PERIOD proteins. Neuron. 2008;58:78–88. doi: 10.1016/j.neuron.2008.01.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Etchegaray J, Lee C, Wade P, Reppert S. Rhythmic histone acetylation underlies transcription in the mammalian circadian clock. Nature. 2003;421:177–82. doi: 10.1038/nature01314. [DOI] [PubMed] [Google Scholar]
- 40.Maruo T, Nakatani S, Kanzaki H, Kakuchi H, Yamagishi M, et al. Circadian variation of endothelial function in idiopathic dilated cardiomyopathy. Am J Cardiol. 2006;97:699–702. doi: 10.1016/j.amjcard.2005.09.118. [DOI] [PubMed] [Google Scholar]
- 41.Man AW, Li H, Xia N. Circadian rhythm:potential therapeutic target for atherosclerosis and thrombosis. Int J Mol Sci. 2021;22:676. doi: 10.3390/ijms22020676. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Wang CY, Wen MS, Wang HW, Hsieh IC, Li Y, et al. Increased vascular senescence and impaired endothelial progenitor cell function mediated by mutation of circadian gene Per2. Circulation. 2008;118:2166–73. doi: 10.1161/CIRCULATIONAHA.108.790469. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Viswambharan H, Carvas JM, Antic V, Marecic A, Jud C, et al. Mutation of the circadian clock gene Per2 alters vascular endothelial function. Circulation. 2007;115:2188–95. doi: 10.1161/CIRCULATIONAHA.106.653303. [DOI] [PubMed] [Google Scholar]
- 44.Carvas JM, Vukolic A, Yepuri G, Xiong Y, Popp K, et al. Period2 gene mutant mice show compromised insulin-mediated endothelial nitric oxide release and altered glucose homeostasis. Front Physiol. 2012;3:337. doi: 10.3389/fphys.2012.00337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Anea C, Merloiu A, Fulton D, Patel V, Rudic R. Immunohistochemistry of the circadian clock in mouse and human vascular tissues. Vessel Plus. 2018;2:16. doi: 10.20517/2574-1209.2018.46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Yang L, Chu Y, Wang L, Wang Y, Zhao X, et al. Overexpression of CRY1 protects against the development of atherosclerosis via the TLR/NF-κB pathway. Int Immunopharmacol. 2015;28:525–30. doi: 10.1016/j.intimp.2015.07.001. [DOI] [PubMed] [Google Scholar]
- 47.Qin B, Deng Y. Overexpression of circadian clock protein cryptochrome (CRY) 1 alleviates sleep deprivation-induced vascular inflammation in a mouse model. Immunol Lett. 2015;163:76–83. doi: 10.1016/j.imlet.2014.11.014. [DOI] [PubMed] [Google Scholar]
- 48.Liu PY. A clinical perspective of sleep and andrological health:assessment, treatment considerations and future research. J Clin Endocrinol Metab. 2019;104:4398–417. doi: 10.1210/jc.2019-00683. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Leproult R, Van Cauter E. Effect of 1 week of sleep restriction on testosterone levels in young healthy men. JAMA. 2011;305:2173–4. doi: 10.1001/jama.2011.710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Smith I, Salazar I, RoyChoudhury A, St-Onge MP. Sleep restriction and testosterone concentrations in young healthy males:randomized controlled studies of acute and chronic short sleep. Chronobiol Int. 2019;5:580–6. doi: 10.1016/j.sleh.2019.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Papantoniou K, Pozo O, Espinosa A, Marcos J, Castaño-Vinyals G, et al. Increased and mistimed sex hormone production in night shift workers. Cancer Epidemiol Biomarkers Prev. 2015;24:854–63. doi: 10.1158/1055-9965.EPI-14-1271. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Circadian disturbance has no impact on rats’ primary and final weight.
Circadian disturbance induces Pde5 mRNA level but does not change testosterone production.
