New insights into the all-testis differentiation in zebrafish with compromised endogenous androgen and estrogen synthesis

Yonglin Ruan; Xuehui Li; Xinyi Wang; Gang Zhai; Qiyong Lou; Xia Jin; Jiangyan He; Jie Mei; Wuhan Xiao; Jianfang Gui; Zhan Yin

doi:10.1371/journal.pgen.1011170

. 2024 Mar 7;20(3):e1011170. doi: 10.1371/journal.pgen.1011170

New insights into the all-testis differentiation in zebrafish with compromised endogenous androgen and estrogen synthesis

Yonglin Ruan ^1,², Xuehui Li ^1,², Xinyi Wang ^1,², Gang Zhai ^1,^2,^*, Qiyong Lou ¹, Xia Jin ¹, Jiangyan He ¹, Jie Mei ³, Wuhan Xiao ^1,^2,⁴, Jianfang Gui ^1,^2,^4,⁵, Zhan Yin ^1,^2,^4,^5,^*

Editor: Mary C Mullins⁶

PMCID: PMC10919652 PMID: 38451917

Abstract

The regulatory mechanism of gonadal sex differentiation, which is complex and regulated by multiple factors, remains poorly understood in teleosts. Recently, we have shown that compromised androgen and estrogen synthesis with increased progestin leads to all-male differentiation with proper testis development and spermatogenesis in cytochrome P450 17a1 (cyp17a1)-/- zebrafish. In the present study, the phenotypes of female-biased sex ratio were positively correlated with higher Fanconi anemia complementation group L (fancl) expression in the gonads of doublesex and mab-3 related transcription factor 1 (dmrt1)-/- and cyp17a1-/-;dmrt1-/- fish. The additional depletion of fancl in cyp17a1-/-;dmrt1-/- zebrafish reversed the gonadal sex differentiation from all-ovary to all-testis (in cyp17a1-/-;dmrt1-/-;fancl-/- fish). Luciferase assay revealed a synergistic inhibitory effect of Dmrt1 and androgen signaling on fancl transcription. Furthermore, an interaction between Fancl and the apoptotic factor Tumour protein p53 (Tp53) was found in vitro. The interaction between Fancl and Tp53 was observed via the WD repeat domain (WDR) and C-terminal domain (CTD) of Fancl and the DNA binding domain (DBD) of Tp53, leading to the K48-linked polyubiquitination degradation of Tp53 activated by the ubiquitin ligase, Fancl. Our results show that testis fate in cyp17a1-/- fish is determined by Dmrt1, which is thought to stabilize Tp53 by inhibiting fancl transcription during the critical stage of sexual fate determination in zebrafish.

Author summary

Gonadal sex differentiation is known as the queen of problems in evolutionary biology, and the mechanisms that determine sexual fate vary widely among teleosts. Traditionally, Dmrt1 and androgen signaling have been essential for testis differentiation, and estrogen signaling has been essential for ovary differentiation. The all-testis phenotype observed in cyp17a1-/- zebrafish, has led to the conclusion that androgen signaling is dispensable for testis differentiation in zebrafish. By analyzing a series of mutant zebrafish lines, we show here that Dmrt1 sufficiently promotes all-testis differentiation in cyp17a1-deficient zebrafish albeit the compromised androgen and estrogen synthesis. In addition, we observed that zebrafish Dmrt1 and androgen signaling probably stabilize Tp53 by inhibiting the transcription of a ubiquitin ligase, Fancl. Our current study provides new insights into the interactive signals that regulate sexual fate determination in teleosts.

Introduction

In vertebrates, the undifferentiated gonads rely on genetic and environmental sex determination (GSD and ESD) to determine their differentiation along male or female differentiation pathways [1,2]. In teleosts, the GSD are complex due to diversity within the species [3], and diverse master sex determination genes, including dmrt1, dmrt1bY (DMY), anti-Müllerian hormone Y (amhy), gsdfY, etc [4–9]. Additionally, some teleosts may ultimately tip the bipotential gonads towards the male or female fate in response to a continuum of genetic and environmental factors [10,11]. The domesticated experimental strains of zebrafish have lost their natural sex determinants, and lack a single strong genetic determinant [12].

Gonadal sex differentiation is further influenced by sex steroid hormones, especially androgens and estrogens, which are produced by the different steroidogenic lineages in the somatic cells of the testes or ovaries [13]. Genes encoding enzymes involved in sex steroid synthesis are differentially expressed during gonadal differentiation [3]. Cyp19a1a, an aromatase, converts testosterone to the estrogen 17β-estradiol (E2). Estrogen is known to be essential for ovary differentiation and maintenance, as indicated by the all-male phenotype observed in cyp19a1a-/-deficient zebrafish [14–16]. Additional depletion of doublesex and mab-3 related transcription factor 1 (dmrt1), which drives male differentiation and maintains testis development, in cyp19a1a-/-deficient zebrafish resulted in partial ovary differentiation [17–19]. Cyp17a1, a cytochrome P450 enzyme with 17-alpha-hydroxylase and C17,20-lyase activities, is the key enzyme in the production of androgen and estrogen in animals [20]. Depletion of cyp17a1 in zebrafish leads to all-testis differentiation, loss of male-typical secondary sex characteristics and mating behavior, due to their impaired androgen production [21–23]. Similarly phenotypes are also observed in cyp17a1-/- common carp and scl (sex-character-less, P450c17) mutant medaka, irrespective of the individuals’ sex-determining genotypes (XY or XX) [24,25]. The increased progestin signaling seen in cyp17a1-/- fish was found to be responsible for proper testis development and spermatogenesis, which is dependent on the nuclear Progestin receptor (nPgr). It has also been shown that the increased endogenous progestin signaling does not have any effect on the sexual differentiation of the cyp17a1-/- zebrafish [23]. Theoretically, the double knockout of cyp17a1 and dmrt1 could further help to elucidate the mechanism underlying all-testis differentiation in cyp17a1-/- zebrafish with impaired endogenous androgen and estrogen signaling.

Zebrafish gonads initially form an ovary-like structure (called a “bipotential juvenile ovary”), which then develops into either into the ovaries in females or testes in males [26,27]. Gonadal differentiation follows oocyte apoptosis in the bipotential juvenile ovary during a critical window of time (20–30 days post-fertilization, dpf) that lasts for several days [27–29]. In zebrafish, the number of germ cells influences gonadal sex differentiation [30,31]. The complete loss of germ cells in dnd morphants leads to an all-male, sterile zebrafish phenotype [28,32,33]. It has been suggested that adult females can undergo sex reversal from female to male when oocytes in the mature ovary are depleted, as observed in nanos3-null mutants or ziwi-CFP-NTR transgenic zebrafish at age of 5 months post-fertilization (mpf) [30]; Apparently, a sufficient number of germ cells is essential for the female differentiation in zebrafish [31,32]. Therefore, specific levels of oocyte-derived signals are thought to act on somatic cells in the gonads to promote and maintain ovary differentiation in zebrafish.

Fancl plays an important role in several biological processes, including DNA damage and apoptosis. In humans, fancl mutation leads to Fanconi Anemia (FA), which is a disease characterized by failure of bone marrow production, risk of developing cancer, hypogonadism, and impaired fertility [34]. Mutations in the FA pathway genes disrupt the repair of DNA damage caused by DNA inter-strand crosslinking [35]. Among FA genes, fancc, fancg, fanca, fancd1 (brac2), and fancd2 are known to cause hypogonadism, impaired gametogenesis, and infertility [36]. In zebrafish, a complete female-to-male sex reversal was observed for 12 of the 17 FA mutants, including fancd1 and fancj homozygous knockout fish that were infertile [35,37]. Fancl transcripts begin to be observed in immature gonads at 17 and 23 dpf; their expression levels increase in developing germ cells at 26 dpf and persist to increase in developing oocytes and spermatocytes at 33 and 37 dpf [38]. The insufficient number of surviving oocytes caused by fancl depletion masculinizes the gonads in mutant zebrafish [37]. One factor known to mediate apoptosis in the developing gonad is Tp53 [39]. Specifically for male differentiation, Tp53-mediated apoptosis is required for the all-male phenotype in brac2-/- or fancl-/- zebrafish, as the all-male phenotype caused by increased apoptosis in the gonads could be rescued by tp53 mutation [37,38]. However, tp53 depletion can only partially rescue the sex reversal phenotypes exhibited by fancd1, fancl, fancr and fancp mutant zebrafish [35,37,38,40]. These results suggest a possible link between certain FA genes and Tp53, with elusive mechanisms determining gonadal differentiation.

In this study, all-female differentiation was observed in cyp17a1-/-;dmrt1-/- fish accompanied by significantly up-regulated fancl expression. Dmrt1 and androgen signaling probably stabilize Tp53 via inhibiting the transcription of fancl, which interacts with Tp53 and activates its K48-linked ubiquitination. Assuming that similar regulatory relationships exist in the germline and gonads, our results provide mechanistic insight into a novel regulatory function of the interactive germline signals and gonadal somatic signals in teleost gonadal sex determination.

Results

All cyp17a1-/-;dmrt1-/- fish developed as females

The double heterozygotes (cyp17a1+/-;dmrt1+/-) among the F1 progeny were bred to generate cyp17a1-/-;dmrt1-/- fish (S1A and S1B Fig). F2 progeny genotyped at 90 dpf were subjected to anatomical and histological analyses. The results demonstrated that 52.94% and 47.06% of control fish developed into females and males, respectively (Fig 1A, 1B, 1G, 1H and 1M). At 90 dpf, all gonads of cyp17a1-/- fish developed into testes (Fig 1C, 1I and 1M), whereas gonads of mostly dmrt1-/- fish developed into ovaries (78.26%, N = 23) (Fig 1D, 1E, 1J, 1K and 1M). Strikingly, all gonads of cyp17a1-/-;dmrt1-/- fish differentiated into ovaries (100%, N = 14) (Fig 1F, 1L and 1M). The isolation and staging analysis of ovarian follicles were then conducted. In contrast to the ovaries of control females and dmrt1-/- females that contained follicles at the early vitellogenic (EV), middle vitellogenic (MV), and full grown (FG) stages, the ovaries of cyp17a1-/-;dmrt1-/- fish only contained follicles at the primary growth (PG) and previtellogenic (PV) stages (Fig 1N). Both the serum of cyp17a1-/- fish and cyp17a1-/-;dmrt1-/- fish exhibited decreased concentration of estradiol compared to that of the control females (Fig 1O). Analysis of sex ratios in fish at 50 dpf showed that the cyp17a1-/- fish were all males, whereas all of the cyp17a1-/-;dmrt1-/- fish developed into females (Fig 1R, 1U and 1V). Compared with the control and dmrt1-/- female fish, PG follicles of the early folliculogenesis occurred normally in cyp17a1-/-;dmrt1-/- fish (Fig 1P, 1S and 1U). Based on these results, we postulated that a signal other than estrogen signaling induce ovary differentiation in cyp17a1-/-;dmrt1-/- fish.

Fig 1 — (A–F) Anatomical examination of the gonads from the control fish, *cyp17a1*-/- fish, *dmrt1*-/- fish, and *cyp17a1*-/-;*dmrt1*-/- fish at 90 dpf. (G–L) Histological analysis of the gonads from the control fish, *cyp17a1*-/- fish, *dmrt1*-/- fish, and *cyp17a1*-/-;*dmrt1*-/- fish at 90 dpf. (A and G) Control fish ovary. (M) Sex ratios in fish of each genotype mentioned above at 90 dpf. (N) Ratios of PG, PV, EV, MV and FG follicles in fish of each genotype at 90 dpf. PG, primary growth. PV, previtellogenic. EV, early vitellogenic. MV, middle vitellogenic. FG, full grown. (O) Concentration of serum estradiol in control females, control males, *cyp17a1*-/- fish, *dmrt1*-/- females, and *cyp17a1*-/-;*dmrt1*-/- fish. E2, estradiol. (P–U) Histological analysis of the gonads from the control fish, *cyp17a1*-/- fish, *dmrt1*-/- fish, and *cyp17a1*-/-;*dmrt1*-/- fish at 50 dpf. (V) Sex ratios in fish of each genotype mentioned above at 50 dpf. Different letters in the bar charts represent significant differences.

Increased expression of fancl in the gonad of cyp17a1-/-;dmrt1-/- fish

To identify the genes most likely regulate ovary differentiation of cyp17a1-/-;dmrt1-/- fish, which displayed an all-female differentiation, the candidate genes were selected based on the previous transcriptome analyses of the dissected gonads from presumptive female and male wildtype fish at 25 and 30 dpf [41]. Among these candidate genes, fancl was selected based on its early expression in gonads at 17 and 23 dpf [38], and its abundant expression in presumptive ovaries [41]. This aligns with our hypothesis that the gene(s) responsible for the all-female differentiation exhibited by cyp17a1-/-;dmrt1-/- fish should be specifically expressed in the gonads during the critical period of zebrafish gonad differentiation and sex determination (17 to 33 dpf).

In support of this hypothesis, up-regulation of fancl was observed in the cyp17a1-/-;dmrt1-/- fish compared to the control females as verified by qPCR at 17 and 23 dpf (Fig 2A and 2B). Moreover, significantly up-regulated fancl expression was observed in dmrt1-/- fish at 17 dpf, while fancl up-regulation was not significant in dmrt1-/- fish at 23 dpf (Fig 2A and 2B). As cyp17a1-/-;dmrt1-/- fish all developed as females, we analyzed the expression level of fancl by in situ hybridization in presumptive ovaries from control fish and cyp17a1-/-;dmrt1-/- fish at 25 dpf. Compared to the moderate expression of fancl in the presumptive ovary of control fish, that of cyp17a1-/-;dmrt1-/- fish was significantly higher (Fig 2C–2E). In situ hybridization using the sense probe of fancl was also performed on cryosections of presumptive ovaries and as expected, no signals were detected (S2A and S2B Fig).

Fig 2 — (A and B) Relative expression of *fancl* in control fish, *dmrt1*-/- fish and *cyp17a1*-/-;*dmrt1*-/- fish at 17 dpf and 23 dpf was tested with qPCR. For fish RNA sampling at 17 dpf and 23 dpf, every 5 body trunks of fish collected were mixed into one sample, and 3 samples were examined. (C and D) *In situ* hybridization was performed on cryosections of presumptive ovaries from control fish and *cyp17a1*-/-;*dmrt1*-/- fish at 25 dpf using the antisense probe of *fancl*. Arrows point to the immature oocytes. (E) Comparison of differentially expressed gene in the ovaries of control fish and *cyp17a1*-/-;*dmrt1*-/- fish at 80 dpf. Volcano plot shows genes that were differentially expressed in ovaries between control and *cyp17a1*-/-;*dmrt1*-/- fish. (F) Gene set enrichment analysis based on genes differentiated expressed in *cyp17a1*-/-;*dmrt1*-/- fish at 80 dpf. The length of the bar represents the false discovery rate (FDR). (G) Relative expression of *fancl* in the ovaries of control fish and *cyp17a1*-/-;*dmrt1*-/- fish at 80 dpf with qPCR. For fish at 80 dpf, every three dissected ovaries were mixed as one sample, and 3 samples were examined. (H) The effect of Dmrt1 and DHT/Ar in regulating the relative luciferase activity driven by *fancl* promoter. DHT, dihydrotestosterone. ***, p < 0.001. Different letters in the bar chart represent significant differences.

Comparative transcriptomic analyses were performed between ovaries from cyp17a1-/-;dmrt1-/- fish and cyp17a1+/+;dmrt1+/+ female control siblings at 80 dpf. Compared to the ovaries from control fish, those from cyp17a1-/-;dmrt1-/- females exhibited significant expression level alterations of 424 genes (Fig 2F), with 238 genes being up-regulated and 186 genes being down regulated. The most enriched KEGG pathways in cyp17a1-/-;dmrt1-/- fish were significantly up-regulated as shown in Fig 2G. The top enriched pathways were related to intestinal immune network for IgA production, steroid hormone biosynthesis, Toll-like receptor signaling, Notch signaling and FA signaling (fancl). The up-regulated fancl expression in cyp17a1-/-;dmrt1-/- fish ovaries at 80 dpf was further verified by qPCR (Fig 2H). These differentially expressed genes may have important functions in ovary differentiation of cyp17a1-/-;dmrt1-/- fish, although it still could not be excluded that their high expression was caused by their expression in primary oocytes or lower abundance in growing and mature oocytes.

To inspect whether Dmrt1 and androgen signaling could transcriptionally regulate fancl expression, a 2.5 kb region upstream of the zebrafish fancl transcription site was cloned into pGL3-basic vector. Both Dmrt1 and dihydrotestosterone (DHT)/Androgen receptor (Ar) inhibit the relative luciferase activity driven by fancl promoter, and their combinational treatment resulted in the largest inhibitory effect in vitro (Fig 2I).

Increased fancl expression sustained ovary differentiation in cyp17a1-/-;dmrt1-/- females

We then set out to verify whether increased fancl expression sustained female differentiation in dmrt1-/- or cyp17a1-/-;dmrt1-/- females. The cyp17a1-/-;dmrt1-/-;fancl-/- fish was generated by mating triple heterozygotes (cyp17a1+/-;dmrt1+/-;fancl+/-) (S3A–S3D Fig). Anatomical analyses of gonad differentiation in samples obtained from dmrt1-/- fish, cyp17a1-/-;fancl-/- fish, cyp17a1-/-;dmrt1-/-;fancl-/- fish, and control siblings were conducted. Again, 52.63% and 47.36% of the control fish developed into females and males, respectively (Fig 3A, 3B, 3G, 3H and 3M), whereas dmrt1-/- fish mostly developed into females (78.95%, N = 19) (Fig 3C, 3D, 3I, 3J and 3M). All-testis differentiation was observed in cyp17a1-/-;fancl-/- fish (100.00%, N = 21) (Fig 3E, 3K and 3M). Unlike cyp17a1-/-;dmrt1-/- fish which developed as ovaries, the cyp17a1-/-;dmrt1-/-;fancl-/- fish developed as testis with histological apparent abnormalities including fibroblast-like somatic cells and diffuse vacuolation, similar to those observed in cyp17a1-/-;dmrt1-/- fish (100.00%, N = 10) (Fig 3F, 3L and 3M), which resembles the observations in the testes of dmrt1-/- fish (Fig 3J) [19, 42]. Accordingly, dissected testis of dmrt1-/- fish and cyp17a1-/-;dmrt1-/-;fancl-/- fish were hypoplastic compared to controls (Fig 3N–3P).

We observed that the testes of dmrt1-/-;fancl-/- fish were also hypoplastic and lack germ cells similar to dmrt1-/- fish, compared to the control fish (Fig 3Q–3C1). The results highlighting the antagonistic role of Fancl and Dmrt1 in determining gonadal sex, not only suggest that Fancl is required for ovary differentiation in dmrt1-/-;fancl-/- fish, but also imply the existence of other Dmrt1 targets required for testis development, as the testis is impaired in dmrt1-/-;fancl-/- fish.

Zebrafish Fancl interacts with Tp53 in vitro

Fancl plays an important role in the survival of developing oocytes during meiosis, and Tp53-mediated germ cell apoptosis induces sex reversal in fancl mutant zebrafish [38]. Given the higher expression of fancl in the gonadal tissue of cyp17a1-/-;dmrt1-/- fish, which is an all-ovary differentiation context, we postulated that Fancl may play a role in ovary differentiation by interacting with the Tp53 signaling cascade. To test this hypothesis, a co-immunoprecipitation assay was performed in HEK293T cells. Myc-tagged Fancl and Flag-tagged Tp53 plasmids were transfected into HEK293T cells. The interaction between exogenously Flag-tagged Tp53 and Myc-tagged Fancl was observed by a reciprocal Co-immunoprecipitation (Co-IP) experiment (Fig 4A). Domain mapping of the interaction between Fancl and Tp53 indicated that the DNA-binding domain (DBD) of Tp53 is required for their interaction (Fig 4B and 4C). The multiple domains, WD-repeat domain (WDR) and C-terminal domain (CTD), of Fancl are required for their interaction, rather than single functional domain (Figs 4D, 4E, S4A and S4B).

Fig 4 — (A) The interaction of Fancl with Tp53 in HEK293T cells as revealed by the Co-IP assay. Myc-tagged Fancl and Flag-tagged Tp53 were transfected into HEK293T cells, then anti-Flag antibody-conjugated agarose beads were used for immune-precipitation. (B and C) Domain mapping revealed that the DBD domain of Tp53 is required for their interaction. TAD, transactivation domain. DBD, DNA binding domain. TMD, tetramerization domain. (D and E) Domain mapping revealed that the multiple domains, WDR and CTD, of Fancl are required for their interaction. WDR, WD-repeat domain. ULD2, UBC-like domain 2. ULD3, UBC-like domain 3. CTD, C-terminal domain. IP, immunoprecipitation. IB, immunoblotting. TCL, total cell lysate.

Zebrafish Fancl activated K48-linked ubiquitination of Tp53 in vitro

Fancl is a member of the Fanconi Anemia core complex with a plant homeodomain (PHD) that mono-ubiquitinates Fancd2 and Fanci [34]. The experimental results from western blotting analysis of HEK293T cells transfected with Myc-tagged Fancl and Flag-tagged Tp53 demonstrated that transfection of Myc-tagged Fancl decreased the levels of Flag-tagged Tp53 in a dose-dependent manner (Fig 5A and 5B). When MG-132, a proteasome inhibitor, was present, Fancl-mediated Tp53 destabilization was effectively blocked (Fig 5C and 5D). We further demonstrated that Fancl increased K48-linked ubiquitination of Tp53 (Fig 5E). These results suggest that Fancl promotes K48-linked ubiquitination, rather than K6-, K11-, K27-, K29-, K33-, and K63-linked ubiquitination of Tp53.

Fig 5 — (A) Transfection of Myc-tagged Fancl decreased the levels of Flag-tagged Tp53 in a dose-dependent manner. (B) Quantification of the western blot bands of the target protein, Tp53. (C) The proteasome inhibitor, MG-132, blocked the Fancl-mediated Tp53 destabilization. (D) Quantification of the western blot bands of the target protein, Tp53. (E) Fancl promotes K48-linked ubiquitination, rather than K6-, K11-, K27-, K29-, K33-, K63-linked ubiquitination of Tp53. IP, immunoprecipitation. IB, immunoblotting. TCL, total cell lysate. Different letters in the bar charts represent significant differences.

Arrested follicular development in cyp17a1-/-;dmrt1-/- females was rescued by 17β-estradiol

The results described above demonstrated that all the gonads of cyp17a1-/-;dmrt1-/- fish differentiated into ovaries. To identity whether supplementation with estrogen could improve the arrested follicular development of cyp17a1-/-;dmrt1-/- females, treatment with 17β-estradiol was performed in cyp17a1-/-;dmrt1-/- fish from 80 to 110 dpf. Control females at 110 dpf exhibited normal ovaries containing follicles at the vitellogenic (EV+) stage (Fig 6A and 6D), and follicles of the cyp17a1-/-;dmrt1-/- fish were arrested at PG and PV stages (Fig 6B and 6E). However, EV+ follicles were observed in cyp17a1-/-;dmrt1-/- fish after 0.1 μg/L 17β-estradiol administration (Fig 6C, 6F and 6G). These results indicate that 17β-estradiol treatment effectively rescued the arrested folliculogenesis prior the EV+ stage of cyp17a1-/-;dmrt1-/- fish.

Fig 6 — (A–C) Histological analysis of the ovaries from the control fish, *cyp17a1*-/-;*dmrt1*-/- fish, and *cyp17a1*-/-;*dmrt1*-/- fish administrated 17β-estradiol from 80 to 110 dpf. (D–F) Anatomical examination of the ovaries from the control fish, *cyp17a1*-/-;*dmrt1*-/- fish and *cyp17a1*-/-;*dmrt1*-/- fish administrated 17β-estradiol from 80 to 110 dpf. (G) Ratios of PG, PV, EV, MV and FG follicles in fish of each genotype at 110 dpf. PG, primary growth. PV, previtellogenic. EV, early vitellogenic. MV, middle vitellogenic. FG, full grown. Different letters in the bar chart represent significant differences.

Discussion

The key functions of estradiol in zebrafish gonadal sex determination have been extensively documented [14,15,21]. In cyp17a1-/- zebrafish and common carp, it would be interesting to explore the mechanisms underlying the all-testis differentiation and successful spermatogenesis [21,25]. Augmentation of progestin signaling has been proposed to be responsible for the proper testis organization and spermatogenesis in cyp17a1-/-;ar-/- zebrafish. However, additional depletion of npgr in cyp17a1-/-;ar-/- fish leads to the phenotypes of all-testis differentiation with impaired spermatogenesis in cyp17a1-/-;ar-/-;npgr-/- zebrafish [23]. This result suggests progestin is important for normal organization of the testis and spermatogenesis, but not for determination of testis fate [23].

The ovary fate of cyp19a1a-deficient zebrafish can be restored when dmrt1 is additionally depleted (in cyp19a1a-/-;dmrt1-/- fish), suggesting an antagonistic function of Cyp19a1a and Dmrt1 in determining sexual fate in zebrafish [17,18]. Similarly, ovary differentiation in our cyp17a1-/-;dmrt1-/- zebrafish at 90 dpf indicates that Dmrt1 determines testis fate despite the testosterone- and estradiol-deficiency of cyp17a1-/- zebrafish. Ratio of the ovary maintenance in cyp19a1a-/-;dmrt1-/- zebrafish progressively decreases after 60 dpf, with female ratios of 83%, 43% and 13% at 60, 75 and 100 dpf, respectively [17]. In contrast to this, the ratio of the ovaries detected among our cyp17a1-/-;dmrt1-/- fish at 90 dpf was 100% (N = 14). The previous published profiles allowed us to compare the endogenous steroids concentration between cyp17a1-/- fish and cyp19a1a-/- fish. In cyp17a1-/- and cyp19a1a-/- fish, respectively, testosterone was found to be impaired and elevated [14, 21, 23]. Compared to cyp19a1a-/-;dmrt1-/- fish, it is reasonable to assume that the higher frequency of ovary differentiation displayed by cyp17a1a-/-;dmrt1-/- fish could be attributed to its androgen deficiency. In other words, the synergistic effects of simultaneous depletion of dmrt1 and cyp17a1 may promote ovary differentiation. This is also consistent with the ovarian biased differentiation phenotype reported in ar-/- zebrafish, suggesting that androgen signaling may indeed antagonize ovary differentiation in zebrafish [43–45].

In zebrafish, fancl was up-regulated in the presumptive ovaries as compared with the presumptive testes [41]. In our analyses, the increased expression of fancl in presumptive ovaries of cyp17a-/-;dmrt1-/- fish at 17, 23 and 25 dpf compared to that in control females was positively correlated with their female biased sex ratio. Indeed, we also observed a moderate up-regulation of fancl in dmrt1-/- fish at 17–23 dpf; however, it is not as significant as in cyp17a-/-;dmrt1-/- fish. This is unlikely to be driven by differences in the stages of oocytes present in the ovaries in our different mutant contexts, as the dmrt1-/- female zebrafish is fertile and develops normally [42]. The observed synergy between Dmrt1 and androgen signaling in inhibiting fancl transcription in luciferase reporter assays suggests that elevated fancl in cyp17a1-/-;dmrt1-/- fish may result from loss of these synergistic repressors.

Disruption of fancl is known to cause masculinized gonads and testis differentiation due to increased germ cell apoptosis compromises oocyte survival, which could be rescued by tp53-depletion [38]. Fancl is known as a ubiquitin ligase [34]. Our in vitro results indicate that zebrafish Fancl interacts with Tp53 to promote its degradation through K48-linked polyubiquitination. Assuming that similar regulatory relationships exist in the germline and gonads in vivo, these results provide new insights into the regulatory network involved in Fancl functions for ovary differentiation, which may protect germ cells from apoptosis induced by Tp53 signaling in zebrafish. Notably, increased apoptosis and decreased Vasa-positive germ cells were observed with dmrt1 deficiency previously [42]. Additional depletion of fancl resulted in all-testes differentiation in cyp17a1-/-;dmrt1-/- fish, due to impaired ovary differentiation. Therefore, it could be concluded that the Fancl-mediated germ cell survival is determinant in gonadal differentiation in cyp17a1-/-;dmrt1-/- zebrafish.

The severely hypoplastic testes observed in dmrt1-/-;fancl-/- fish and cyp17a1-/-;dmrt1-/-;fancl-/- fish are consistent with our previous view that Dmrt1 is required for the maintenance of male germ cells [42]. This could be interpreted that additional fancl depletion promotes testis differentiation in dmrt1-/- fish and cyp17a1-/-;dmrt1-/- fish, but their male germ cell development is dysregulated due to Dmrt1 deficiency. Similar observations have been reported with zebrafish whole testis differentiation upon depletion of RNA-binding protein of multiple splice forms 2 (rbmps2), a critical germline-expressed factor for female sex differentiation. The severe hypoplastic testes were observed in dmrt1-/-;rbmps2a-/-;rbmps2b-/- zebrafish [18]. Significantly, depletion of genes related to germ cell development and survival in fish results in the same phenotype of the lost germ cells as they attempt to embark on the male fate but suffer from the lack of Dmrt1 [18].

Loss of tp53 can restore ovarian development in fancd1(brca), fancl, fancp and fancr mutant fish [35]. In contrast, introducing tp53 mutation did not restore ovary differentiation in dazl, figla, rbm46, vasa and rbpms2 mutants, which are key factors involved in germ cell survival, meiosis and differentiation [46–50]. We also observed that depletion of tp53 (IHB136, China Zebrafish Resource Center) did not affect sexual differentiation in zebrafish and could not restore ovary differentiation in cyp17a1-/- zebrafish. This suggests that germ cell loss is not exclusively mediated by apoptosis via Tp53. Further studies, such as generating and analyzing dmrt1-/-;fancl-/-;tp53-/- zebrafish, are needed to investigate the mechanisms of Dmrt1 on Fancl/Tp53 signaling on the link between sex fate determination and germ cell survival.

Increased progestin signaling maintains proper testis organization and spermatogenesis in cyp17a1-/-;ar-/- zebrafish, suggesting a dispensable role for androgen in testis organization and spermatogenesis under certain circumstances [23]. In contrast, only PG and PV stage follicles were observed in cyp17a1-/-;dmrt1-/- zebrafish at 90 dpf. Together with a similar follicle status observed in cyp19a1a-/-;dmrt1-/- zebrafish, the arrested follicle development from PV to EV transition with impaired vitellogenesis could be attributed to impaired estrogen synthesis when either cyp19a1a or cyp17a1 was depleted in these mutants [17, 18]. The vitellogenic (EV+) follicles were observed in cyp17a1-/-;dmrt1-/- fish after 17β-estradiol administration from 80 to 110 dpf, supporting the essential function of 17β-estradiol in regulating folliculogenesis via vitellogenesis. Ovarian follicles with failed yolk accumulation were also observed in cyp19a1a-/- female medaka [51]. Taken together, the endogenous estrogens synthesized in zebrafish and medaka are dispensable for ovarian differentiation, but indispensable for ovarian development and oocyte maturation. On the other hand, although cyp17a1 deficiency leads to elevated progestin levels (in cyp17a1-/- fish) [23], it is not sufficient to provide an adequate gonadal steroid hormone environment for folliculogenesis in cyp17a1-/-;dmrt1-/- zebrafish.

Determination of the fate of gonadal supporting cells in mammals plays a critical role in gonadal sex determination, as Sry acts spatiotemporally to switch supporting cells from the female to the male pathway [52]. Both in XX and XY mice, depletion for CYP17A1 exclusively causes phenotypically female appearance (external genital phenotype), abnormal inner genitalia development and infertile phenotypes [53]. Compared to the phenotype observed in CYP17A1-null mice, all-testis differentiation and proper spermatogenesis were observed in cyp17a1-/- zebrafish and common carp [21, 25]. These results demonstrate the evolutionary plasticity of sex determination and gonadal development in vertebrates. Of course, further studies of our proposed regulatory mechanism are needed in other fish species or mammals, which, we believe, would undoubtedly broaden the knowledge underlying sex determination in teleosts.

Materials and methods

Ethics statement

All fish experiments were conducted in accordance with the Guiding Principles for the Care and Use of Laboratory Animals, and were approved by the Institute of Hydrobiology, Chinese Academy of Sciences (Approval ID: IHB 2013724).

Zebrafish maintenance

Zebrafish (Danio rerio) were maintained as previously described [54]. Briefly, the fish were kept in a circulated water system and maintained under standard laboratory conditions at 28.5°C with a light/dark cycle of 14/10 hours; the Fish were fed twice daily with freshly hatched brine shrimp.

The knockout lines

The loss-of-function alleles of cyp17a1 and dmrt1 in zebrafish (mutated with 7 and 14 bp deletion in the first exon) generated by our group as previously described was used in this study [21, 42]. The cyp17a1 heterozygote was bred with a dmrt1 heterozygote of the opposite sex to generate cyp17a1/dmrt1 double heterozygous fish, which were then inbred to generate an offspring population containing cyp17a1-/-;dmrt1-/- fish. The introduction of the fancl knockout into cyp17a1+/-;dmrt1+/- fish could not be achieved by breeding, as fancl and cyp17a1 are both located on chromosome 13. To obtain triple heterozygotes (cyp17a1+/-;dmrt1+/-;fancl+/-), CRISPR/Cas9-mediated cyp17a1 and fancl knockouts were performed in F2 embryos derived from mating between dmrt1+/- females and dmrt1+/- males. The triple heterozygotes were then inbred to generate triple homozygotes (cyp17a1-/-;dmrt1-/-;fancl-/-). The females observed in cyp17a1+/+;dmrt1+/+, cyp17a1+/+;dmrt1-/-, and cyp17a1-/-;dmrt1-/- fish were used for the anatomical analysis and histological analysis. The cyp17a1+/+;dmrt1+/+ and cyp17a1-/-;dmrt1-/- fish at 17, 23, 25 and 80 dpf were used for gene expression analysis. The dmrt1 heterozygous males and females were inbred to generate an offspring population containing dmrt1-/- fish [42]. To obtain the triple heterozygotes (cyp17a1+/-;dmrt1+/-;fancl+/-), the CRISPR/Cas9-mediated deletions of cyp17a1 and fancl were performed in F2 embryos derived from the inbred dmrt1-/- fish for the generation of the triple heterozygotes (mutated cyp17a1 with a 31 bp deletion in the first exon and fancl with a 37 bp deletion in the ninth exon). The triple heterozygotes were then inbred to generate the triple homozygotes (cyp17a1-/-;dmrt1-/-;fancl-/-). The guide RNA sequences for the knockout lines and the primers used for genotyping are listed in Table 1.

Table 1. Primers used in this study.

Gene	Primer direction and sequence (5’-3’)	Product size (bp)	Reference
qPCR
fancl	F: GAACCCTGACTGCACTGTCCTAC	232	[38]
fancl	R: GCTTTGGCGACTGGTTGGCAGAC	232	[38]
β-actin	F: ACTCAGGATGCGGAAACTGG	118	[55]
β-actin	R: AGGGCAAAGTGGTAAACGCT	118	[55]
Genotyping
cyp17a1	F: GCAGTGCTGTTCAGAAGAGCT	559	[22]
cyp17a1	R: GGCAGTTCATTCTGCTCTGA	559	[22]
dmrt1	F: CGTTATCAAACCTCAGACCCTA	549	[42]
dmrt1	R: TAGCCAAAGCAGTCAACAAT	549	[42]
cyp17a1	F: GACAGTCCTCCGCACATCTTC	250	This study
cyp17a1	R: ACCATATGCAGATGGGCC	250	This study
fancl	F: CCAGCAGATCATCCACCATCC	237	This study
fancl	R: GAGCTGCCTCTCACACGCAGG	237	This study
Guide RNA sequences
cyp17a1	GGATCTCCTTCGCATGATGG		This study
fancl	GGATCTCCTTCGCATGATGG		This study
Promoter amplification
fancl	F: TTTACTAGGTATACTTGAAAC	2500	This study
fancl	R: CCTAGCAAAGCGAAAGTAACTT	2500	This study

Open in a new tab

F, Forward. R, Reverse. bp, base pair.

Histological analysis

Hematoxylin and eosin staining was performed as previously described [21]. Dissected gonads were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) at room temperature. Fixed samples were dehydrated, infiltrated, and embedded in paraffin for sectioning. Sections (7 μm-thick) were stained with hematoxylin and eosin and visualized under a Nikon Eclipse Ni-U microscope (Nikon, Tokyo, Japan). The oocytes at 50 and 90 dpf are shown with with a scale bar of 50 and 300 μm, respectively. Normal testes are shown with a scale bar of 25 μm, and the hypoplastic testes are shown with a scale bar of 10 μm.

In situ hybridization

The in situ hybridization on cryosections of presumptive ovaries were performed as previous described [56]. Sense and anti-sense digoxigenin-labeled cRNAs of fancl were synthesized and used in this study. The cDNA fragment of 786 nt containing the PHD domain of fancl was used to synthesize probe as previously described [38]. The in situ hybridization were photographed using a Nikon Eclipse Ni-U microscope (Nikon, Tokyo, Japan). Staining intensity in germ cells were quantified by analyzing the gray values using Image J software (National Institutes of Health, Bethesda, MD, USA). There were three independent replicates for the fish of each genotype.

Isolation and staging of ovarian follicles

The staging system adopted for ovarian follicles was conducted based on the original definition of Selman et al. [57] as modified by the researchers [17, 58–61]. Ovaries, which were dissected out from females of each genotype after anesthetization, were placed in a 60 mm culture dish containing 60% L-15 medium (Gibco, Carlsbad, CA, United States). The follicles of different stages were manually isolated and divided into five stages according to their size and vitellogenic stage: primary growth stage (~0.1 mm), previtellogenic stage (cortical alveolus, ~0.3 mm), early vitellogenic stage (~0.4 mm), midvitellogenic stage (~0.5 mm), and full grown but immature stage (~0.65 mm).

Serum estradiol measurement

The concentrations of serum estradiol in fish at 3 mpf were measured using commercial ELISA kit (582251, Cayman Chemical Company, Ann Arbor, MI) as previously described [21]. There were four independent replicates for the fish of each genotype.

RNA extraction and quantitative real-time PCR (qPCR)

Total RNA was extracted from zebrafish using TRIzol reagent (15596–026; Invitrogen, Carlsbad, CA, United States) following a previously described standard protocol [21]. For zebrafish at 17 and 23 dpf, truncated zebrafish bodies, which contained the gonads, were used for RNA extraction. We synthesized cDNA using One-Step gDNA Removal and cDNA Synthesis SuperMix (AE311-02; Transgen Biotech, Beijing, China). qPCR was performed using SYBR Green Real-Time PCR Mix (AQ131-01; Transgen Biotech) and a real-time PCR system (Bio-Rad, Hercules, CA, United States). The housekeeping gene β-actin was used as endogenous control, and the expression level of fancl was calculated as the fold change relative to β-actin [62]. The primers used for qPCR are listed in Table 1. The cyp17a1+/+;dmrt1+/+ female fish of the cyp17a1-/-;dmrt1-/- siblings served as control. The comparison was performed between the fish of different genotypes.

Transcriptome analysis

At the indicated time points, total RNA from the dissected ovaries was extracted using TRIzol reagent. RNA-seq reads were generated using the Illumina NovaSeq 6000 system. High-quality mRNA reads were mapped to the Danio rerio genome (GRCz11) using HISAT2 (version 2.2.4, http://daehwankimlab.github.io/hisat2/). Differential expression analysis was performed using the DESeq2 package (v1.30.1) with a fold change of two and a p-value cutoff of 0.05.

Plasmid constructions

Zebrafish Fancl, Tp53, Dmrt1 and Ar were cloned into the vectors of pCMV-myc modified pCMV-flag, and pcDNA3.1(+), respectively. For fancl luciferase construction, a 2.5 kb region upstream of the transcription initiation site of zebrafish fancl was cloned into the pGL3-basic plasmid. The primers used for fancl promoter amplification are listed in Table 1.

Cell culture and transfection

Human embryonic kidney (HEK) 293T cells (originally obtained from American Type Culture Collection, Manassas, VA, United States) were grown at 37°C in a humidified incubator containing 5% CO₂ in high glucose Dulbecco’s Modified Eagle’s Medium (DMEM) (06-1055-57-1A; BI, Israel) supplemented with 10% fetal bovine serum (FBS). Plates at 60% confluency were transfected with X-tremeGene HP (6366236001; Roche, Basel, Switzerland) according to the manufacturer’s instructions. After 12 h post transfection, cells were recovered to the culture medium containing dimethyl sulfoxide (DMSO) or DHT (10 nmol/L) (D413176, Aladdin, Shanghai, China), and harvested at 24 h post transfection.

Luciferase reporter assay

Luciferase activity was measured using the dual-luciferase reporter assay system following the manufacturer’s instructions (E1910, Promega, Madison, WI, United States). Data were normalized to Renilla luciferase. The relative luciferase activity in transfected cells was detected using a Sirius Luminometer from Berthold Detection Systems. Data were obtained from three independent experiments.

Western blotting

Total protein content from HEK 293T cells was extracted with RIPA buffer containing 50 mM Tris (pH 7.4), 1% NP-40, 0.25% sodium deoxycholate, 1 mM EDTA (pH 8), 150 mM NaCl, 1 mM NaF, 1 mM PMSF, 1 mM Na3VO4, and a 1:50 dilution of the protease inhibitor mixture (P1045; Beyotime, Shanghai, China). Then, the proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred on a polyvinylidene fluoride (PVDF) membrane. Mouse anti-Myc (1:1000, Santa Cruz, Dallas, TX, United States), mouse anti-Flag (1:1000, Sigma-Aldrich, St. Louis, MO, United States), and rabbit anti-β-Actin (1:1000, Abclonal, Wuhan, China) were used as the primary antibodies. Horseradish peroxidase (HRP) conjugated anti-mouse (SA00001-1; Proteintech, Wuhan, China) and rabbit secondary (AS014; Abclonal Wuhan, China) antibodies were used at a 1:5000 dilution. The membranes were stained with Immobilon Western Chemiluminescent HRP substrate (WBKLS0500; Millipore, Billerica, MA, United States) and detected by using an ImageQuant LAS 4000 system (GE Healthcare, Fairfield, MA, United States).

Co-IP analysis

For Co-IP analysis, HEK 293T cells grown to 60% confluency were transfected with a total of 10 μg of the indicated plasmids. At 24 h post-transfection, the medium was carefully removed, and the cells were washed with ice-cold PBS. Then the cells were lysed in 1 mL RIPA buffer at 4°C on a horizontal shaker for 1 h. Cells lysates were centrifugated at 16000 × g at 4°C for 20 min, then the supernatant was incubated with anti-Flag (M8823; Sigma-Aldrich, St. Louis, MO, United States) or Myc magnetic beads (88842, Thermo Fisher Scientific, Waltham, MA, United States) overnight at 4°C. Finally, immunoprecipitates and total cell lysates (TCL) were analyzed by western blotting using the indicated antibodies.

Ubiquitination inhibitor administration

HEK 293T cells were transfected with the intended plasmids. At 24 h post-transfection, the cells were treated with proteasome inhibitor MG132 (10 μg/mL) (S2619; Selleck, Shanghai, China) or dimethyl sulfoxide for 6 h. Total protein from the cells was extracted using RIPA buffer for western blot analysis.

Ubiquitination assay

Transfected HEK 293T cells were washed twice with ice-cold PBS, lysed in buffer A (6 M guanidium-HCl, 0.1 M Na₂HPO₄/NaH₂PO₄ and 10 mM imidazole) and incubated with Ni2+-NTA beads (Qiagen, Germantown, MD, United States) at 4°C on a horizontal shaker overnight. The beads were washed sequentially with wash buffer I (mix buffer A and wash buffer II to a ratio of 1 to 4) and wash buffer II (25mM Tris-Cl pH 8.0 and 20mM imidazole) three times. The bound proteins were eluted with wash buffer II and subjected to western blotting.

17β-estradiol administration

The cyp17a1-/-;dmrt1-/- fish were treated with 0.1 μg/L 17β-estradiol (E8875, Sigma-Aldrich) from 80 to 110 dpf. Fish ovaries were harvested for histological analysis. Ovaries dissected from the control fish and cyp17a1-/-;dmrt1-/- fish reared in the system water were used as positive and negative controls, respectively.

Statistical analysis

Each experiment was performed in triplicate. Detailed information regarding the number of zebrafish used per experiment is provided for each experiment and corresponding figure. The results are expressed as the mean ± SD. All analyses were performed with the GraphPad Prism 6.0 software program and the differences were assessed using the Student’s t-test for paired comparisons and one-way ANOVA, followed by Fisher’s LSD test for multiple comparisons. For all statistical comparisons, a p value < 0.05 was used to indicate a statistically significant difference. Significant differences marked with asterisks and letters were analyzed using Student’s t-test for paired comparisons, and one-way ANOVA followed by Fisher’s LSD test for multiple comparisons, respectively.

Supporting information

S1 Fig. Targeted disruption of cyp17a1 and dmrt1.

(A) Schematic representation of wildtype (cyp17a1+/+) and the mutant line of cyp17a1 alleles in the first exon. (B) Schematic representation of the putative peptide of wildtype (cyp17a1+/+) and the mutated Cyp17a1 peptides. (C) Schematic representation of wildtype (dmrt1+/+) and the mutant line of dmrt1 alleles in the sixth exon. (D) Schematic representation of the putative peptide of wildtype (dmrt1+/+) and the mutated Dmrt1 peptides.

(TIF)

pgen.1011170.s001.tif^{(6.2MB, tif)}

S2 Fig. In situ hybridization was performed on cryosections of presumptive ovaries using the sense probe of fancl.

(A) Control fish at 25 dpf. (B) cyp17a1-/-;dmrt1-/- fish at 25 dpf. Arrows point to the immature oocytes.

(TIF)

pgen.1011170.s002.tif^{(7.3MB, tif)}

S3 Fig. Additional target disruptions of cyp17a1 and fancl in dmrt1-/- zebrafish.

(A) Schematic representation of the genomic locus for target disruption of cyp17a1. UTR, untranslated region. (B) The PCR results using the fish genomic DNA for genotyping cyp17a1, including cyp17a1+/+, cyp17a1+/- and cyp17a1-/-. (C) Schematic representation of genomic locus for target disruption of fancl. E, exon. (D) The PCR results using the fish genomic DNA for genotyping fancl, including fancl+/+, fancl+/- and fancl-/-.

(TIF)

pgen.1011170.s003.tif^{(8.4MB, tif)}

S4 Fig. The single domain mutation of Fancl did not affect its association with TP53.

(A) Myc-tagged Fancl with single domain mutation and Flag-tagged TP53 were transfected into HEK293T cells. Both the anti-Myc and anti-Flag antibody-conjugated agarose beads were used for immunoprecipitation. (B) Domain mapping revealed that the single domain mutation of Fancl did not affect its association with TP53. WDR, WD-repeat domain. ULD2, UBC-like domain 2. ULD3, UBC-like domain 3. CTD, C-terminal domain. IP, immunoprecipitation. IB, immunoblotting. TCL, total cell lysate.

(TIF)

pgen.1011170.s004.tif^{(8.1MB, tif)}

S1 Data. Source data for Fig 1M, 1N, 1O and 1V.

(XLSX)

pgen.1011170.s005.xlsx^{(14.4KB, xlsx)}

S2 Data. Source data for Fig 2A, 2B, 2E, 2H and 2I.

(XLSX)

pgen.1011170.s006.xlsx^{(13.4KB, xlsx)}

S3 Data. Source data for Fig 3M and 3C1.

(XLSX)

pgen.1011170.s007.xlsx^{(11KB, xlsx)}

S4 Data. Source data for Fig 4B, and 4D.

(XLSX)

pgen.1011170.s008.xlsx^{(10.2KB, xlsx)}

S5 Data. Source data for Fig 5B, and 5D.

(XLSX)

pgen.1011170.s009.xlsx^{(10.3KB, xlsx)}

S6 Data. Source data for Fig 6G.

(XLSX)

pgen.1011170.s010.xlsx^{(9.9KB, xlsx)}

Acknowledgments

We thank the China Zebrafish Resource Center for providing the zebrafish strain of tp53 mutant line (IHB 136). We thank Mr. Wenyou Chen of the Institute of Hydrobiology, Chinese Academy of Sciences, for handling the zebrafish stock. We thank the Center for Instrumental Analysis and Metrology, Institute of Hydrobiology, Chinese Academy of Sciences, for technical assistance with section scanning and image capture.

Data Availability

The RNA-seq raw data are available from the BioProject database (accession number: PRJNA999043). The other relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by the National Natural Science Foundation, China (32230108 to ZY), National Key Research and Development Program, China (2022YFD2401800 to GZ), National Natural Science Foundation, China (31972779 to GZ), Foundation of Hubei Hongshan Laboratory (2021hszd021 to ZY and 2021hskf013 to GZ), Pilot Program A Project from the Chinese Academy of Sciences (XDA24010206 to ZY), Youth Innovation Promotion Association of CAS (2020336 to GZ), and State Key Laboratory of Freshwater Ecology and Biotechnology (2016FBZ05 to ZY). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Dai S, Qi S, Wei X, Liu X, Li Y, Zhou X, et al. Germline sexual fate is determined by the antagonistic action of dmrt1 and foxl3/foxl2 in tilapia. Development. 2021;148(8). doi: 10.1242/dev.199380 [DOI] [PubMed] [Google Scholar]
2.Bell G. The masterpiece of nature: the evolution and genetics of sexuality. Berkeley: The University of California Press. 1982:1–635. [Google Scholar]
3.Devlin RH, Nagahama Y. Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences. Aquaculture. 2002;208:191–364. [Google Scholar]
4.Myosho T, Otake H, Masuyama H, Matsuda M, Kuroki Y, Fujiyama A, et al. Tracing the Emergence of a Novel Sex-Determining Gene in Medaka, Oryzias luzonensis. Genetics. 2012;191(1):163–+. doi: 10.1534/genetics.111.137497 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, et al. DMY is a Y-specific DM-domain gene required for male development in the medaka fish. Nature. 2002;417(6888):559–63. doi: 10.1038/nature751 [DOI] [PubMed] [Google Scholar]
6.Li MH, Sun YL, Zhao JE, Shi HJ, Zeng S, Ye K, et al. A Tandem Duplicate of Anti-Mullerian Hormone with a Missense SNP on the Y Chromosome Is Essential for Male Sex Determination in Nile Tilapia, Oreochromis niloticus. Plos Genet. 2015;11(11). [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Hattori RS, Murai Y, Oura M, Masuda S, Majhi SK, Sakamoto T, et al. A Y-linked anti-Mullerian hormone duplication takes over a critical role in sex determination. P Natl Acad Sci USA. 2012;109(8):2955–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Chen SL, Zhang GJ, Shao CW, Huang QF, Liu G, Zhang P, et al. Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle. Nat Genet. 2014;46(3):253-+. doi: 10.1038/ng.2890 [DOI] [PubMed] [Google Scholar]
9.Nanda I, Kondo M, Hornung U, Asakawa S, Winkler C, Shimizu A, et al. A duplicated copy of DMRT1 in the sex-determining region of the Y chromosome of the medaka, Oryzias latipes. P Natl Acad Sci USA. 2002;99(18):11778–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Tao B, Hu W. Research Progress on Sex Control Breeding of Fish. J Agr Sci Tech-Iran. 2021;24(2):1–10. [Google Scholar]
11.Sato T, Endo T, Yamahira K, Hamaguchi S, Sakaizumi M. Induction of female-to-male sex reversal by high temperature treatment in Medaka, Oryzias latipes. Zoolog Sci. 2005;22(9):985–8. doi: 10.2108/zsj.22.985 [DOI] [PubMed] [Google Scholar]
12.Wilson CA, High SK, McCluskey BM, Amores A, Yan YL, Titus TA, et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 2014;198(3):1291–308. doi: 10.1534/genetics.114.169284 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Matson CK, Zarkower D. Sex and the singular DM domain: insights into sexual regulation, evolution and plasticity. Nat Rev Genet. 2012;13(3):163–74. doi: 10.1038/nrg3161 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Yin Y, Tang H, Liu Y, Chen Y, Li G, Liu X, et al. Targeted Disruption of Aromatase Reveals Dual Functions of cyp19a1a During Sex Differentiation in Zebrafish. Endocrinology. 2017;158(9):3030–41. doi: 10.1210/en.2016-1865 [DOI] [PubMed] [Google Scholar]
15.Lau ES, Zhang Z, Qin M, Ge W. Knockout of Zebrafish Ovarian Aromatase Gene (cyp19a1a) by TALEN and CRISPR/Cas9 Leads to All-male Offspring Due to Failed Ovarian Differentiation. Sci Rep. 2016;6:37357. doi: 10.1038/srep37357 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Dranow DB, Hu K, Bird AM, Lawry ST, Adams MT, Sanchez A, et al. Bmp15 Is an Oocyte-Produced Signal Required for Maintenance of the Adult Female Sexual Phenotype in Zebrafish. Plos Genet. 2016;12(9). doi: 10.1371/journal.pgen.1006323 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Wu K, Song W, Zhang Z, Ge W. Disruption of dmrt1 rescues the all-male phenotype of the cyp19a1a mutant in zebrafish—a novel insight into the roles of aromatase/estrogens in gonadal differentiation and early folliculogenesis. Development. 2020;147(4). doi: 10.1242/dev.182758 [DOI] [PubMed] [Google Scholar]
18.Romano S, Kaufman OH, Marlow FL. Loss of dmrt1 restores zebrafish female fates in the absence of cyp19a1a but not rbpms2a/b. Development. 2020;147(18). [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Webster KA, Schach U, Ordaz A, Steinfeld JS, Draper BW, Siegfried KR. Dmrt1 is necessary for male sexual development in zebrafish. Dev Biol. 2017;422(1):33–46. doi: 10.1016/j.ydbio.2016.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Nakajin S, Hall PF, Onoda M. Testicular microsomal cytochrome P-450 for C21 steroid side chain cleavage. Spectral and binding studies. J Biol Chem. 1981;256(12):6134–9. [PubMed] [Google Scholar]
21.Zhai G, Shu T, Xia Y, Lu Y, Shang G, Jin X, et al. Characterization of Sexual Trait Development in cyp17a1-Deficient Zebrafish. Endocrinology. 2018;159(10):3549–62. doi: 10.1210/en.2018-00551 [DOI] [PubMed] [Google Scholar]
22.Zhai G, Shu TT, Xia YG, Jin X, He JY, Yin Z. Androgen signaling regulates the transcription of anti-Mullerian hormone via synergy with SRY-related protein SOX9A. Sci Bull. 2017;62(3):197–203. [DOI] [PubMed] [Google Scholar]
23.Zhai G, Shu T, Yu G, Tang H, Shi C, Jia J, et al. Augmentation of progestin signaling rescues testis organization and spermatogenesis in zebrafish with the depletion of androgen signaling. eLife. 2022;11. doi: 10.7554/eLife.66118 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Sato T, Suzuki A, Shibata N, Sakaizumi M, Hamaguchi S. The novel mutant scl of the medaka fish, Oryzias latipes, shows no secondary sex characters. Zoolog Sci. 2008;25(3):299–306. doi: 10.2108/zsj.25.299 [DOI] [PubMed] [Google Scholar]
25.Zhai G, Shu T, Chen K, Lou Q, Jia J, Huang J, et al. Successful production of an all-female common carp (Cyprinus carpio L.)population using cyp17a1-deficient neomale carp. Engineering. 2021. [Google Scholar]
26.Clelland E, Peng C. Endocrine/paracrine control of zebrafish ovarian development. Mol Cell Endocrinol. 2009;312(1–2):42–52. doi: 10.1016/j.mce.2009.04.009 [DOI] [PubMed] [Google Scholar]
27.Orban L, Sreenivasan R, Olsson PE. Long and winding roads: testis differentiation in zebrafish. Mol Cell Endocrinol. 2009;312(1–2):35–41. doi: 10.1016/j.mce.2009.04.014 [DOI] [PubMed] [Google Scholar]
28.Slanchev K, Stebler J, de la Cueva-Mendez G, Raz E. Development without germ cells: the role of the germ line in zebrafish sex differentiation. Proc Natl Acad Sci U S A. 2005;102(11):4074–9. doi: 10.1073/pnas.0407475102 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Uchida D, Yamashita M, Kitano T, Iguchi T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J Exp Biol. 2002;205(Pt 6):711–8. doi: 10.1242/jeb.205.6.711 [DOI] [PubMed] [Google Scholar]
30.Dranow DB, Tucker RP, Draper BW. Germ cells are required to maintain a stable sexual phenotype in adult zebrafish. Dev Biol. 2013;376(1):43–50. doi: 10.1016/j.ydbio.2013.01.016 [DOI] [PubMed] [Google Scholar]
31.Tzung KW, Goto R, Saju JM, Sreenivasan R, Saito T, Arai K, et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 2015;4(1):61–73. doi: 10.1016/j.stemcr.2014.10.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Dai X, Jin X, Chen X, He J, Yin Z. Sufficient numbers of early germ cells are essential for female sex development in zebrafish. PLoS One. 2015;10(2):e0117824. doi: 10.1371/journal.pone.0117824 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Siegfried KR, Nusslein-Volhard C. Germ line control of female sex determination in zebrafish. Dev Biol. 2008;324(2):277–87. doi: 10.1016/j.ydbio.2008.09.025 [DOI] [PubMed] [Google Scholar]
34.Meetei AR, de Winter JP, Medhurst AL, Wallisch M, Waisfisz Q, van de Vrugt HJ, et al. A novel ubiquitin ligase is deficient in Fanconi anemia. Nat Genet. 2003;35(2):165–70. doi: 10.1038/ng1241 [DOI] [PubMed] [Google Scholar]
35.Ramanagoudr-Bhojappa R, Carrington B, Ramaswami M, Bishop K, Robbins GM, Jones M, et al. Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility. Plos Genet. 2018;14(12):e1007821. doi: 10.1371/journal.pgen.1007821 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Parmar K, D’Andrea A, Niedernhofer LJ. Mouse models of Fanconi anemia. Mutat Res. 2009;668(1–2):133–40. doi: 10.1016/j.mrfmmm.2009.03.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Rodriguez-Mari A, Wilson C, Titus TA, Canestro C, BreMiller RA, Yan YL, et al. Roles of brca2 (fancd1) in oocyte nuclear architecture, gametogenesis, gonad tumors, and genome stability in zebrafish. Plos Genet. 2011;7(3):e1001357. doi: 10.1371/journal.pgen.1001357 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Rodriguez-Mari A, Canestro C, Bremiller RA, Nguyen-Johnson A, Asakawa K, Kawakami K, et al. Sex reversal in zebrafish fancl mutants is caused by Tp53-mediated germ cell apoptosis. Plos Genet. 2010;6(7):e1001034. doi: 10.1371/journal.pgen.1001034 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Fridman JS, Lowe SW. Control of apoptosis by p53. Oncogene. 2003;22(56):9030–40. doi: 10.1038/sj.onc.1207116 [DOI] [PubMed] [Google Scholar]
40.Botthof JG, Bielczyk-Maczynska E, Ferreira L, Cvejic A. Loss of the homologous recombination gene rad51 leads to Fanconi anemia-like symptoms in zebrafish. Proc Natl Acad Sci U S A. 2017;114(22):E4452–E61. doi: 10.1073/pnas.1620631114 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Ye D, Tu Y, Wang H, He M, Wang Y, Chen Z, et al. A landscape of differentiated biological processes involved in the initiation of sex differentiation in zebrafish. Water Biology and Security. 2022;1:100059. [Google Scholar]
42.Lin Q, Mei J, Li Z, Zhang X, Zhou L, Gui JF. Distinct and Cooperative Roles of amh and dmrt1 in Self-Renewal and Differentiation of Male Germ Cells in Zebrafish. Genetics. 2017;207(3):1007–22. doi: 10.1534/genetics.117.300274 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Yu G, Zhang D, Liu W, Wang J, Liu X, Zhou C, et al. Zebrafish androgen receptor is required for spermatogenesis and maintenance of ovarian function. Oncotarget. 2018;9(36):24320–34. doi: 10.18632/oncotarget.24407 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Tang H, Chen Y, Wang L, Yin Y, Li G, Guo Y, et al. Fertility impairment with defective spermatogenesis and steroidogenesis in male zebrafish lacking androgen receptor. Biol Reprod. 2018;98(2):227–38. doi: 10.1093/biolre/iox165 [DOI] [PubMed] [Google Scholar]
45.Crowder CM, Lassiter CS, Gorelick DA. Nuclear Androgen Receptor Regulates Testes Organization and Oocyte Maturation in Zebrafish. Endocrinology. 2018;159(2):980–93. doi: 10.1210/en.2017-00617 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Bertho S, Clapp M, Banisch TU, Bandemer J, Raz E, Marlow FL. Zebrafish dazl regulates cystogenesis and germline stem cell specification during the primordial germ cell to germline stem cell transition. Development. 2021;148(7). doi: 10.1242/dev.187773 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Qin M, Zhang Z, Song W, Wong QW, Chen W, Shirgaonkar N, et al. Roles of Figla/figla in Juvenile Ovary Development and Follicle Formation During Zebrafish Gonadogenesis. Endocrinology. 2018;159(11):3699–722. doi: 10.1210/en.2018-00648 [DOI] [PubMed] [Google Scholar]
48.Dai X, Cheng X, Huang J, Gao Y, Wang D, Feng Z, et al. Rbm46, a novel germ cell-specific factor, modulates meiotic progression and spermatogenesis. Biol Reprod. 2021;104(5):1139–53. doi: 10.1093/biolre/ioab016 [DOI] [PubMed] [Google Scholar]
49.Hartung O, Forbes MM, Marlow FL. Zebrafish vasa is required for germ-cell differentiation and maintenance. Mol Reprod Dev. 2014;81(10):946–61. doi: 10.1002/mrd.22414 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Kaufman OH, Lee K, Martin M, Rothhämel S, Marlow FL. rbpms2 functions in Balbiani body architecture and ovary fate. Plos Genet. 2018;14(7):e1007489. doi: 10.1371/journal.pgen.1007489 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Nakamoto M, Shibata Y, Ohno K, Usami T, Kamei Y, Taniguchi Y, et al. Ovarian aromatase loss-of-function mutant medaka undergo ovary degeneration and partial female-to-male sex reversal after puberty. Mol Cell Endocrinol. 2018;460:104–22. doi: 10.1016/j.mce.2017.07.013 [DOI] [PubMed] [Google Scholar]
52.Hiramatsu R, Matoba S, Kanai-Azuma M, Tsunekawa N, Katoh-Fukui Y, Kurohmaru M, et al. A critical time window of Sry action in gonadal sex determination in mice. Development. 2009;136(1):129–38. doi: 10.1242/dev.029587 [DOI] [PubMed] [Google Scholar]
53.Aherrahrou R, Kulle AE, Alenina N, Werner R, Vens-Cappell S, Bader M, et al. CYP17A1 deficient XY mice display susceptibility to atherosclerosis, altered lipidomic profile and atypical sex development. Sci Rep. 2020;10(1):8792. doi: 10.1038/s41598-020-65601-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Westerfield M. The zebrafish book, a guide for the laboratory use of zebrafish (Danio rerio). OR 4rd ed. University of Oregon, Eugene. 2020. [Google Scholar]
55.Shi C, Lu Y, Zhai G, Huang J, Shang G, Lou Q, et al. Hyperandrogenism in POMCa-deficient zebrafish enhances somatic growth without increasing adiposity. J Mol Cell Biol. 2020;12(4):291–304. doi: 10.1093/jmcb/mjz053 [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Zhu J, Zhang D, Liu X, Yu G, Cai X, Xu C, et al. Zebrafish prmt5 arginine methyltransferase is essential for germ cell development. Development. 2019;146(20). doi: 10.1242/dev.179572 [DOI] [PubMed] [Google Scholar]
57.Selman K, Wallace RA, Sarka A, Qi X. Stages of oocyte development in the zebrafish, Brachydanio rerio. J Morphol. 1993;218(2):203–24. doi: 10.1002/jmor.1052180209 [DOI] [PubMed] [Google Scholar]
58.Wang Y, Ge W. Developmental profiles of activin betaA, betaB, and follistatin expression in the zebrafish ovary: evidence for their differential roles during sexual maturation and ovulatory cycle. Biol Reprod. 2004;71(6):2056–64. doi: 10.1095/biolreprod.104.032649 [DOI] [PubMed] [Google Scholar]
59.Pang Y, Thomas P. Role of G protein-coupled estrogen receptor 1, GPER, in inhibition of oocyte maturation by endogenous estrogens in zebrafish. Dev Biol. 2010;342(2):194–206. doi: 10.1016/j.ydbio.2010.03.027 [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Chu L, Li J, Liu Y, Hu W, Cheng CH. Targeted gene disruption in zebrafish reveals noncanonical functions of LH signaling in reproduction. Mol Endocrinol. 2014;28(11):1785–95. doi: 10.1210/me.2014-1061 [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Li J, Huang D, Sun X, Li X, Cheng CHK. Zinc mediates the action of androgen in acting as a downstream effector of luteinizing hormone on oocyte maturation in zebrafish. Biol Reprod. 2019;100(2):468–78. [DOI] [PubMed] [Google Scholar]
62.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]

PLoS Genet. doi: 10.1371/journal.pgen.1011170.r001

Decision Letter 0

Gregory S Barsh, Mary C Mullins

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

24 Oct 2023

Dear Dr Zhai,

Thank you very much for submitting your Research Article entitled 'Insights into the all-testis differentiation without endogenous androgen signaling in zebrafish' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers and editors appreciated the further deciphering of the sex determination pathway in zebrafish, evidence for the mechanism by which Fancl regulates Tp53, and the strength of the genetic analysis performed. Some concerns, however, were raised about the current manuscript that need to be addressed, including improving the quality of the in situs shown in Figure 1 and that quantitative analysis of expression levels of such in situs is not a rigorous method. There are many helpful comments from the reviewers to improve and clarify the figures and text throughout the manuscript. Please include also the Selman staging designations, as suggested, in addition to the current staging ones used. We do not require new experiments for the revision, except those needed to strengthen current results presented. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version.

Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

Mary C. Mullins

Academic Editor

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: The factors regulating sex determination and differentiation are not fully understood, even in organisms where dedicated sex chromosomes are present. In zebrafish, domesticated strains have lost the ZW based sex determination that is found in wild strains and as in other animals, the mechanisms of sex determination and sex-specific differentiation are not understood. Despite differences in upstream activators or triggers, differentiation of primary and secondary sex traits converges on regulation of androgen and estrogen levels. Remarkably, prior work in zebrafish established that normal spermatogenesis could occur in the absence androgen receptor or the Cytochrome P450, Cyp17a1a, when supplemented with progestin. In this work the authors investigated the relationship between a conserved male differentiation factor, Dmrt1, and Cyp17a1a, a key enzyme in androgen and estrogen synthesis. The authors took a genetic approach to examine the relationship between these factors and sex determination and differentiation and found that in contrast to loss of Cyp17a1a, which causes testis only development in zebrafish, loss of Dmrt1 in cyp17a1a mutants resulted in development of ovaries with only early-stage oocytes. They provide evidence that supplementing dmrt1;cyp17a1a mutants with estradiol supported oocyte development to later stages. Based on these observations the authors conclude that Dmrtt1 is required for testis differentiation and that estradiol is not required for ovary differentiation but is important for ovary development and maturation. Using an RNAseq approach, the authors determined that fancl expression was higher in dmrt1;cyp17a1a double mutants. Based on its elevated expression and because prior work in the field implicated Fanc family members in ovary development, and germ cell loss in ovary to testis transformation, the authors generated triple mutants lacking Dmrt1, Cyp17a1a, and Fancl. The authors found that these triple mutants, like cyp17a1a and fancl single mutants, developed exclusively as males, but unlike the fancl or cyp17a1a single mutants, the triple mutants had hypoplastic and abnormal testis development due to lack of Dmrt1. Tunel and germ cell analyses showed abnormal germ cell development and cell death in triple mutant testis. Since Tp53 was previously shown to suppress the loss of oocytes and sex reversal previously associated with mutations of Fancl family members, the authors investigated a potential role for Fancl in repressing Tp53. The authors provide evidence that Fancl and Tp53 bind to one another in 293 cells and identified the TMD domain as Tp53 as important for that interaction. Similar attempts to map the interaction domain of Fancl suggest that multiple domains may be involved and are sufficient for interaction with Tp53 in 293 cells. The authors performed in vitro assays in 293 cells in the presence and absence of Fancl and proteosome inhibitors and conclude that Fancl promotes degradation of Tp53 via the proteosome. Their model is that Fancl acts in the ovary to prevent oocyte loss by ubiquitinating Tp53 and promoting its degradation via the proteosome. Further they propose that Dmrt1 negatively regulates fancl levels to promote oocyte loss and later testis differentiation. Although there are a few missing methods descriptions and some missing statistical analyses, overall, the data in the manuscript are clear, with appropriate numbers of individuals examined and statistical analysis, and are mostly consistent with the authors conclusions. However, the exciting conclusions are somewhat inaccessible, especially to the broader scientific readership, in the current draft. In particular in the abstract, introduction, and discussion sections.

Major:

1. The major concern is with the writing, which would benefit from major revision. I have listed a few examples by section below; however, more comprehensive revision to set up the questions and exciting conclusions more clearly would greatly strengthen the manuscript and make it accessible to nonexperts.

2. Without measuring testosterone, estradiol in the various mutant contexts, it might be prudent to qualify some of the conclusions regarding “absence of androgen signaling” “absence of estradiol” etc. and instead stating that the specific genes are dispensable for ovary/testis determination, differentiation etc. This would allow for the possibility of other compensating enzymes or ways to make these steroid hormones. For example, it is fair to conclude that cyp17a1 is dispensable but is estradiol signaling completely eliminated or is it just reduced? Further, the authors and prior work indicate that some of the mutants have secondary sex trait deficits.

3. Regarding the conclusions regarding Fancl and Tp53, because gonads and germ cells were not examined, it should be clearly stated that these are interactions and activities in 293 cells. Further, the conclusions with respect gonad development should be qualified to state that they are extrapolated from 293 to gonad. For example, “ assuming similar regulatory relationships exist in the germline and gonads, these results provide novel insights into the regulatory network involved in Fancl functions for ovarian differentiation…”

4. Regarding the interaction domain of Fancl, do truncations that eliminate multiple domains abolish or attenuate binding?

5. For the western blots in Figure 3 and the supplemental figures, the abbreviation TCL should be defined in the legend.

6. Appropriate allele designations need to be provided for all mutants analyzed.

7. In Figure 1N and 2G, 4N “ratios” of various stages are reported. How were these ratios determined, from how many sections and individuals? Please clarify and describe this in the methods.

8. Figure 1R, relative to what? How was this normalized across samples? Please clarify and describe in the methods. Also, because comparisons are made between single and compound mutants, statistics should be included for Dmrt and double mutants as well.

9. Figure 1T-V, I understand that in situ on sections is challenging, but the image quality is not sufficient to reach a conclusion. In addition, quantitative conclusions are made based these experiments, but NBT:BCIP staining is not quantitative method since the researcher stops the reaction. Also, panel V is mislabeled as H on the figure.

10. Figure 5E, statistics should be included for dmrt1 single mutants and triple mutants to distinguish between an effect due to loss of Dmrt1 alone as opposed to synergistic effects.

11. The models in Figure 6 are helpful, but a few genotypes are combined under the same scenarios based on the labels, but they are not really equivalent. For example, in scenario F, ,Dmrt1 and AR would still be present in Fancl loss of function, but taking away Dmrt1 doesn't suppress. It would help also to distinguish between fertile and sterile ovaries and testis in the various models because these are not functionally equivalent outcomes.

12. In the methods under “transcriptome analysis” line 430, “At the indicated time points, total RNA from zebrafish gonads”. Please clarify if these were gonads or truncated bodies that contain gonads as described in the RNA extraction and qPCR section above.

13.

Minor:

14. Supporting figure S1 and S3 are nice but not necessary.

Writing:

Abstract:

1. “The laboratory strains of zebrafish lack a typical sex chromosome, and the gonadal differentiation genes downstream of a sex determination gene that regulates the animals develop as males or females, though conserved among vertebrates, is still unknown yet in zebrafish.” This is a complex sentence with many ideas that can be separated into simpler sentences.

2. From the abstract, “exclusive gonadal sex shift from the testes to the ovaries was caused by depletion of doublesex and mab-3 related transcription factor 1

(dmrt1) in cyp17a1-/- zebrafish.” This is potentially misleading as written as it might imply the double mutants make a testis that then becomes an ovary. And later “cyp17a1-/-;dmrt1-/- zebrafish, comparative gonadal transcriptome analysis revealed that the phenotypes shifting from testes to ovaries correlated with up-regulated gonadal fancl.”

3. “Mechanistically, the degradation of TP53 with the activation of its K48-linked polyubiquitination within its DNA-binding domain (DBD), mediated via the ubiquitin ligase Fancl, has been demonstrated.” This sentence is unclear.

4. “Taken together, our results revealed that Dmrt1 signaling determines testis fate for gonadal differentiation even in the absence of androgen synthesis in cyp17a1-/- fish, which antagonizes Fancl/TP53 signaling during the critical stage..” This is a complex sentence and seems inconsistent with the previous sentence states that the triple mutants male even in the absence of Dmrt1 and Cyp17a1.

Author summary:

1. “Without the presence of testosterone and estradiol in cyp17a1-deficient zebrafish, Dmrt1 signaling sufficiently promotes the all-testis differentiation via activating germ cell apoptosis mediated through TP53 by suppressing the expression of fancl.”

Introduction:

1. “Besides, unlike the female biased ratio phenotype and impaired spermatogenesis seen in ar-/- zebrafish [18], all-testis differentiation and normal spermatogenesis have been achieved in our cyp17a1-/-;ar-/- zebrafish.” This is unclear as written and seems inconsistent with the statements later in the paragraph thar ar and androgen is dispensable.

2. “Moreover, the interaction between Fancl and TP53 led to the discovery of the activation of K48- linked ubiquitination of TP53, which contributes to the survival of germ cells in zebrafish during gonadal differentiation.” This is misleading as written because the interactions and modifications were demonstrated for somatic cells, 293, and not for germ cells. Further it is unclear as written if the authors are referring to this work or other work.

3. “Dmrt1 can repress fancl expression, disrupt Fancl/TP53 interaction, promote apoptosis in germ cells during the critical gonadal differentiation window period, and determine all-testis differentiation, without the antagonistic effect of estradiol signaling in cyp17a1-/- zebrafish.” This sentence mixes multiple contexts and is not fully consistent with the data shown.

Discussion:

1. The authors report results including new results and refer back to the earlier figures 1 and 2. This is not typical of a discussion section which is typically a synthesis of results. Usually, the only figures referred to are new model or summary figures.

2. “However, when the nuclear progestin receptor (npgr) was deleted in cyp17a1-/-;ar-/- fish, the phenotype of all-testis differentiation was sustained even with impaired spermatogenesis in cyp17a1-/-;ar-/-;npgr-/- zebrafish.” “even with” should be “albeit with”

3. “This indicates that Dmrt1 signaling can still cancel the testis fate for gonadal differentiation, under testosterone and estradiol absence in cyp17a1-/- zebrafish.” This is inconsistent with the data shown and is potentially confusing phrasing. The data show Dmrt1 is required for testis fate not to cancel it.

4. “Therefore, it is reasonable to speculate that the synergistic effects on testis fate determination could be ensured by both discrete Dmrt1 and androgen signaling in our cyp17a1-/-;dmrt1-/- zebrafish”. This sentence is unclear as written.

5. “It is in lines with our previous view that Dmrt1 is required for the maintenance, self-renewal, and differentiation of male germ cells, and implying that in cyp17a1-/-;dmrt1-/- fish, the additional depletion of fancl resulted in sex reversal from ovaries to testes, which was compromised due to dmrt1-deficiency, which in turns, caused dysregulated male germ cells development afterwards.” This is a complex sentence with many ideas that can be separated into simpler sentences.

6. “Depletion of tp53 (IHB136, China Zebrafish Resource Center) did not lead to a female-biased zebrafish population and did not reverse all-testis differentiation in cyp17a1-/- zebrafish (S5 Fig), suggesting that TP53 signaling might only provide complementary, sustainable, but not decisive, roles for ovarian differentiation in zebrafish.” This is unclear. Do the authors mean to say that it is only a factor in the context of ovarian failure and not normal sex determination and differentiation.

7. “Our results further indicate that Dmrt1 is a key determining factor for testis differentiation in certain fish even in the absence of testosterone nor estradiol, partially via the suppression of fancl expression, which leads to elevated TP53-induced germ cell apoptosis in zebrafish (Fig 6).” This may be a bit confusing. It might help to add something about when Tp53-induced death of oocytes occurs during ovarian failure or in the bipotential gonad.

8. “S2 Fig. Every single domain mutation of Fancl did not affect its association with TP53.”

Reviewer #2: Previous work from this lab showed that, remarkably, cyp17a1 mutants, which cannot produce either the male-promoting hormone testosterone or 11KT, or the female-promoting hormone 17ß-estradiol, all develop as fertile males. Iin this present study they extend these findings by analyzing the phenotype of cyp17a1;dmrt1 double mutants. dmrt1 is a highly conserved regulator of male development and all dmrt1 zebrafish mutants are fertile females. The authors found that dmrt1;cyp17a1 double mutants develop as females. However, these females are presumably sterile as the oocytes they produce never progress past stage IB (primary growth stage). They further show that oocyte development can be rescued in the double mutants by estradiol treatment. By comparing the transcriptomes of normal and double mutant ovaries they identify many genes that are differentially regulation. One in particular is fancl, which was previously shown to be required for female development by suppression of Tp53-mediated germ cell apoptosis. Using proteomic analysis, they demonstrate that Fancl directly interacts with the DNA binding domain of Tp53, and that it can promote polyubiquitinate on K48. They further show that polyubiquitinate leads to the degradation of Tp53, thus providing a mechanistic model for the role of Fancl in ovary development. Finally, they show that removing fancl function in cyp17a1;dmrt1 mutants, which was not a trivial task given that fancl and cyp17a1 are on the same chromosome, lead to an all sterile male phenotype.

Two main conclusions can be drawn from this data: 1) In the absence of dmrt1 and androgen production, estrogen production is not required for ovary differentiation in zebrafish, but is required for oocytes to progress past stage IB. 2) Suppression of fancl expression by Dmrt1 is necessary for male/testis development. The data in the paper are clear and well presented, and the results will be of interest to a wide audience. The comments/suggestion below are mostly minor and intended to increase the clarity of the paper.

L47: …Dmrt1 signaling… (it is not a signal.) Better to say …Dmrt1 transcriptional regulation…

L68: “Cyp17A1 is a key enzyme involved in testosterone synthesis in animals.” It would be good to point out here that Cyp17a1 is required for both testosterone and estrogen production, as this is important to understanding the result presented here.

L102: For completeness in referencing primary publications, please add Dranow et al., 2016, which also analyzed cyp19a1a mutants.

L104: For completeness in referencing primary publications, please add Romano et al., 2020, which also analyzed the cyp19a1a;dmrt1 double mutants.

L101-111: A more appropriate reference for this statement is Tzung et al., 2015.

L 112: For completeness in referencing primary publications, please add Siegfried and Nusslein-Volhard, 2008, which also analyzed sex determination in dnd morphants.

L117: For completeness in referencing primary publications, please add Tzung et al., 2015.

L117: It would be more accurate to say “…specific levels of signals derived from oocytes…” as it

is oocytes, not pre-meiotic germ cells, that are required for female development (see also Rodriguez-Mari et al., 2010).

L132: More accurate to say: “…surviving oocytes…”

L141: “mysterious” is not a scientific term and should be avoided.

L165 & L280: For completeness in referencing primary publications, please add Webster et al., 2017, as they also showed dmrt1-/- fish are primarily female and the few males are sterile

Fig 1: This labels for the various oocyte stages appear accurate based on histological criteria, but the scale bar in Fig 1G does not appear to be accurate. Based on this bar, the FG oocytes are ~80-90 µm in diameter, which is the size of primary growth stage oocytes (Selman et al. 1993). FG oocytes should be 730-750 µm. Perhaps the bar is actually 50 µm. Please confirm all scale bars are accurate.

Fig 1: Please consider changing the oocyte stage designations (i.e. PG, EV, FG) to that of Selman et al., (1993) as it allows you to define the oocyte stages more precisely. For example, it is stated that cyp17a1;dmrt1 double mutant ovaries contain only pre-vitellogenic oocytes. However, pre-vitellogenic oocytes encompass pre-follicle (Stage 1A), follicle stage/primary growth stage (Stage IB), and cortical alveolus stage (Stage II) oocytes. Based on Fig 1L, cyp17a1;dmrt1 ovaries do not contain any oocytes that have progressed passed Stage IB. Thus, use of the Selman et al., staging allows a more precise description of the phenotype.

L170: “These results suggest…” This statement needs more context for the general audience to understand. Please explain the logic behind the conclusion that estradiol signaling is important for maturation but not differentiation.

Fig. 1T-H: How many independent gonads were examined and are the images in T-H representative? Please give n’s for each genotype. This is mainly a concern for the control gonads, because some may have already begun to transition to testes and may therefore have downregulated fancl. The image in U is of poor quality due to the many salt crystals that formed over the tissue. This panel should be replaced with a higher quality image. Please add labels for oocytes, if they are present (e.g. it looks like a stage IB oocyte is present in H).

L325: “Therefore it is…” The point being made by the sentence is not clear to this reviewer.

L334: cyp17a1-/- should be dmrt1-/-

Reviewer #3: The gene network that directs gonad to develop into ovary or testis is far from clear in zebrafish as well as in other vertebrates. In this study, the authors demonstrate that Dmrt1 determines the testis fate of gonads possibly via antagonizing Fancl/TP53 signaling even in the absence of androgen synthesis in cyp17a1-/- fish. Firstly, the authors analyzed the gonadal phenotypes of cyp17a1-/-, dmrt1-/- single mutants and cyp17a1-/-;dmrt1-/- double mutants in zebrafish. They showed that dmrt1 deletion reversed the all-testis phenotype of cyp17a1-/- zebrafish into all-ovary. Next, by comparing gene expression in the gonads of cyp17a1-/-;dmrt1-/- fish and control fish and rescue experiments by fancl (FA signaling gene) mutation, they showed that the up-regulation of fancl was responsible for the all-ovary development of cyp17a1-/-;dmrt1-/- zebrafish. Finally, they proved that fancl was involved in the regulation of germ cell apoptosis by mediating the degradation of the apoptotic factor TP53 via activating K48-linked polyubiquitination in the DNA binding domain. This study provides additional insights for zebrafish gonadal differentiation. The study is innovative, and the experiments are designed properly. However, several concerns should be addressed before publication.

Major:

1. The most attractive point of this manuscript is that the authors found Dmrt1 can antagonize Fancl/TP53 signaling to regulate gonad differentiation in cyp17a1-/- zebrafish with neither estrogen nor androgen. Considering that the expression of Fancl in developing germ cells and its function in TP53-mediated germ cell apoptosis and gonadal differentiation have been reported in zebrafish previously (Rodríguez-Marí et al., 2010), the authors need to focus their research on the relationship between Dmrt1 and Fancl, rather than studying how Fancl affects TP53. Is it possible to prove that Dmrt1 can directly suppress fancl expression and Fancl can mediate the degradation of Dmrt1 via polyubiquitination in vitro?

2. The transcriptome data displayed in the results section of this manuscript is not persuasive enough to convince readers that fancl up-regulation is the main reason for the all-ovary phenotype of cyp17a1-/-;dmrt1-/- zebrafish. Gonads should be sampled at early stage of gonadal differentiation rather than at 80 dpf, the up-regulation of fancl might be the consequence rather than the reason of sex reversal. Also, to find out the key gene that reversed the all-testis phenotype of cyp17a1-/- fish into all-ovary after dmrt1 deletion, gonadal gene expression should be compared between cyp17a1-/-;dmrt1-/- fish and cyp17a1-/- fish and between cyp17a1-/-;dmrt1-/- fish and dmrt1-/- fish, rather than between cyp17a1-/-;dmrt1-/- fish and wild type female fish.

3. It is widely accepted that estrogen but not androgens plays essential role in fish sex determination and differentiation. Blocking estrogen synthesis led to female to male sex reversal and estrogen administration led to male to female sex reversal in many fish species, including zebrafish. There has been no report showing that blocking androgen synthesis changes sex in fish. The all-testis phenotype of cyp17a1-/- and cyp17a1-/-;ar-/- zebrafish in this study should be explained by estrogen deficiency. It has nothing to do with androgen or progestin augmentation. The authors should change their description in the Title, Abstract (line 24-27) and Discussion (298-303) section of this manuscript to avoid misleading the readers.

4. Expression of fancl is upregulated in the dmrt1-/- fish. How about the gonadal development in the dmrt1-/-;fancl-/- fish? The authors should provide these data.

Minor:

1. Line 183-185, “The top enriched pathways were related to FA, steroid hormone biosynthesis, apoptosis, Notch signaling, Toll-like receptor signaling and mTOR signaling”. The order of the enriched pathway should be written according to either the gene numbers or the significance of pathways enriched. Also, the criteria for the identification of fancl as the key regulators need to be clarified.

2. Line 260-269, “However, the introduction ...... with a 37 bp deletion in the ninth exon”. This part should be move to the Materials and Methods section.

3. This MS focus on sex differentiation of zebrafish mutants. The authors should show the phenotype at different stages of gonadal development in these mutants. Not just only at adult stage.

4. In Figure 1Q, please show the expression of fancl in dmrt1-/- fish at 80 dpf? In Figure 1S, why fancl was not upregulated in the dmrt1-/- fish compared with control? In Figure 1T, no sense probe was shown as control. The signal was not specific in germ cell, but with a universal expression pattern. Why? It has been reported that fancl is specifically expressed in the germ cells (Rodríguez-Marí et al., 2010).

5. This study and other reports showed the dysgenesis testis in some dmrt1-/- fish. The germ cell was lost in these mutants, as shown in Figure 4J. Why Vasa-positive germ cell was observed in the dmrt1-/- fish in Figure 5B? In the gonadal histology of cyp17a1-/-;dmrt1-/-;fancl-/- fish, no cystic germ cells was observed as shown in Figure 4L. However, it was observed by Vasa staining in Figure 5D. Whether mutation of tp53 can rescue the germ cell survival in dmrt1-/- and cyp17a1-/-;dmrt1-/-;fancl-/- fish?

6. In Figure 3, the authors should demonstrate the protein interaction between TP53 and Fancl in vivo. Whether ubiquitination of TP53 showed difference in female and male gonads during zebrafish sex differentiation? Whether de-ubiquitination of TP53 can be detected in the fancl-/- fish? Fig 3D, the result of “IB: Myc” in the TCL group is missing.

7. In Figure 5, no obvious TUNEL/Vasa co-location was presented. The authors should show high quality figures. Whether apoptosis was observed in the cyp17a1 mutants?

8. Line 23-24, the sentence “Zebrafish has been used as a convenient model for teleost gonadal differentiation for many years” may not be necessary in abstract.

9. It should be noted that the sex reversal in mice are quite different from that in fish after cyp17a1 deletion. In mice, cyp17a1 deletion only resulted in underdeveloped accessory reproductive organs, leading to female-like external genitalia, the gonadal sex are not reversed. However, in fish, cyp17a1 deletion resulted in complete sex reversal. So, the results in mice cannot be used as evidence to support or discuss the role of androgen in gonadal differentiation or sex determination. The authors should consider to remove or adjust such description in Line 50, Line 68-70, Line 83, Line 381-383.

10. It is well known that double mutation of cyp19a1a and dmrt1 resulted in ovary development in zebrafish and other fish species. In fact, the cyp19a1a;dmrt1 double mutants were equivalent to the cyp17a1;dmrt1 double mutants in absence of estrogen synthesis. Both are males due to estrogen deficiency. Therefore, the analyses of cyp17a1;dmrt1 double mutants did not provide us more information about fish sex differentiation. However, the different female rate in dmrt1-/-, cyp19a1a-/-;dmrt1-/- and cyp17a1-/-;dmrt1-/- zebrafish deserves more investigation.

11. The introduction should be refined according to the findings of this research to make the questions clear. In Line 110, “in some teleosts” should be revised as “in zebrafish”, because the references cited in this paragraph only studied zebrafish.

12. Three main findings of this study are: Dmrt1 antagonizes Fancl/TP53 signaling to regulate gonad differentiation in zebrafish without both estrogen and androgen; Fancl regulates the degradation of TP53 via K48 mediated polyubiquitination; Different female rate was observed between dmrt1-/- and cyp17a1-/-;dmrt1-/- zebrafish. The discussion needs to be re-structured according to the main findings of this study to make it more logical.

13. The phenotype of cyp17a1-/-;dmrt1-/-;fancl-/- fish in this study was similar to that of the dmrt1-/-;rbmps2a-/-;rbmps2b-/- triple mutants. In zebrafish, maybe loss of genes related to germ cell development and survival results in the same phenotype. Please discuss it.

14. The scale bar in this manuscript should be adjusted to make it clear and consistent in each figure.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: None

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

PLoS Genet. 2024 Mar 7;20(3):e1011170. doi: 10.1371/journal.pgen.1011170.r002

Author response to Decision Letter 0

4 Jan 2024

Attachment

Submitted filename: Response letter to P Genet 0104.doc

pgen.1011170.s011.doc^{(6.3MB, doc)}

PLoS Genet. doi: 10.1371/journal.pgen.1011170.r003

Decision Letter 1

Gregory S Barsh, Mary C Mullins

17 Jan 2024

Dear Dr Zhai,

Thank you very much for submitting your Research Article entitled 'New Insights into the All-testis Differentiation in Zebrafish with Compromised Endogenous Androgen and Estrogen Synthesis' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the changes made to the revised manuscript but identified numerous minor issues that we ask you address in a revised manuscript.

We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer.

In addition we ask that you:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

Please let us know if you have any questions while making these revisions.

Yours sincerely,

Mary C. Mullins

Academic Editor

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: This revised manuscript from Ruan and colleagues investigates the factors regulating sex determination and differentiation in zebrafish. In this work the authors investigated the relationship between a conserved male differentiation factor, Dmrt1, and Cyp17a1a, a key enzyme in androgen and estrogen synthesis.

In this revised version the authors have addressed the missing methods descriptions and statistical analyses. The authors have significantly revised the writing and added additional experiments to address concerns raised in the prior version; however, a few points, mostly related to writing, remain to be clarified.

1) Allele designations are needed throughout the manuscript.

2) Line 192: The point is lost in the sentence beginning “on the other hand..” Stage of oocytes is an important factor here. If Fancl is more highly expressed in early oocytes and DM gonads are blocked in oocyte progression, there will be an enrichment in early oocyte expressed genes in DMs compared to SM or controls, thus expression would remain high. If fancl is less abundant in older oocytes this will appear as increased expression in double mutants since they will lack the later stage oocytes and genes expressed at later stages will be less abundant or absent in DMs. If fancl has multiple roles, its expression may be dynamic in oocytes - is this seen in in situ or in the published single cell RNAseq datasets? Also, if Dmrt1 represses fancl in oocytes, their expression patterns might be reciprocal in oocytes e.g. when Dmrt1 is high, fancl would be low... was this relationship analyzed in the scRNAseq datasets?

3) Line 230: The sentence beginning “There results suggest..” The wording here is not entirely consistent with the data. These results suggest that Fancl is required for ovary differentiation. While fancl might be a target, negatively regulated by Dmrt1, the data suggest that other Dmrt1 targets are required for testis development since the DM testis is infertile.

4) Line 278-280: a reference is needed for the sentence on progestin signaling.

5) Line 309-310: “Indeed, we also observed a moderate up-regulation of fancl in dmrt1-/- fish at 17-23 dpf; however, it is not as significant as in cyp17a-/-;dmrt1-/- fish.” Can the possibility that this could be driven by differences in the stages of oocytes present in ovaries in these different mutant contexts be excluded? If not, please add a statement to qualify.

6) Line 342 and 343: Loss of Tp53 also did not rescue loss of Rbpms2 – Kaufman et al PLoSGenetics. Also, differentiation should be added along with cell survival and meiosis as failed differentiation will result in oocyte death.

7) In the “knockout lines” section of the methods, the guide RNA sequences and diagnostic primers should be provided. Alternatively, these sequences can be included in the supplemental table with the other primers.

Minor writing:

1) Line 47-48: “With the all-testis phenotype observed in cyp17a1-/- zebrafish, it has been suggested that androgen signaling is dispensable for testis differentiation in zebrafish.” Consider instead: “The all testis phenotype observed in cyp17a1-/- zebrafish, has led to the conclusion that androgen signaling is dispensable for testis differentiation in zebrafish”

1) Line 58: Instead of “entry into” consider “differentiation along”.

2) Line 59 and 60: “are complex due to its multiple types” Instead consider “are complex due to diversity within the species”

3) Line 66: Consider “influenced” rather than “enhanced”.

4) Line 77: “which” is not needed.

5) Line 79: “with” is not needed.

6) Lines 80-81: “Similarly these…” Consider instead “Similar phenotypes..”

7) Lines 93-95: The sentence beginning “It has been suggested that” should come later in the paragraph before the sentence on line 98 beginning “Dranow..”

8) Line 99: Need to be specific and state that this is Nanos3 because mutants in the different nanos genes have different phenotypes.

9) Line 112: “in mutants with 12 of the 17 FA genes…” Instead consider, “ for 12 of the 17 FA mutants.

10) Line 116: Instead of “continue” consider “persist or continue to increase”.

11) Line 118: A linker or transition phrase would be helpful here." One factor known to mediate apoptosis in the developing gonad is Tp53".

12) Line 119: Required seems more appropriate than responsible here since Tp53 alone is probably not the sole factor.”

13) Line 122: By “effectively” do you mean partially?

14) Line 127: By “with” do you mean "accompanied by", "associated with" or "along with"?

15) Line 154: “a signal” or “signals” rather than “the signal”.

16) Line 154: “induce” rather than “exist in inducing”.

17) Line 157: “regulate” rather than “to be required for”.

18) Line 157: “of” is needed after differentiation.

19) Line 160: should indicate that this is in wildtype.

20) Line 160: “Based on their results…” this sentence is a bit unclear. Consider something like “Among these candidate genes fancl was selected based on its early expression in gonads at 17 and 23 dpf and its abundant expression in presumptive female gonads”.

21) Line 163: consider “aligns” rather than “correlates”.

22) Line 168: “the up-regulated..” Consider instead “Upregulation of fancl genes was observed...”

23) Line 170: “Moreover” rather than “besides”.

24) Line 172: The sentence beginning, “To rule out the possibility..” There is a logic problem as written. It is not clear why a later change would be examined to control for a timing difference. The important issue is the ability to compare the stages present in the gonad to exclude the possibility that the expression difference is due to a difference in stages/types of cells present withing the gonads. Based on the images shown, it appears that there may be more early-stage cells present in the cyp17;dmrt double mutants compared to controls. To determine if increased expression is due to upregulation or more cells expressing, cells of the same stage should be compared.

25) Line 178 and elsewhere: Consider greater, higher, or more abundant rather than “upregulated” because expression could be higher due to increased expression (upregulation) or stability.

26) Line 180: “but exhibited no obvious signals of staining..” Consider instead, “and as expected no signals were detected”.

27) Line 181: “The” is not needed before comparative, and “in ovaries” should be “between ovaries”.

28) Line 182: “the” is not needed before “cyp17a1” and “fish of their” is not needed between female and control.

29) Line 184 “alterations of the expression levels..” Consider instead “expression level alterations of 424 genes”.

30) Line 186: “The majority of KEGG..” Consider instead “the most enriched KEGG pathways in..”

31) Line 220: The sentence beginning “However” is unclear. Do you mean “Unlike cyp;dmrt1 DMs which developed ovaries, cyp;dmrtq;fancl TMs developed testis with histologically apparent abnormalities including fb like somatic cells.....similar to those observed in...”

32) Line 224: The sentence beginning “The dissected testes..” can be simplified. “Accordingly, dissected testis of SM and TM were hypoplastic compared to controls.” Details about fixative should be in the methods section.

33) Line 228: “also has a hypoplastic testis…” Consider instead “testes were also hypoplastic and lack germ cells similar to dmrtt1-/-“.

34) Line 237: “which is an all-ovary differentiation mechanism..” Should be "context" rather than "mechanism".

35) Line 247: “mutant domain” should be “functional domain” unless the activity of the domain was altered.

36) Line 262: “albeit the” should be deleted.

37) Line 262 “the additional supplement..” consider instead “supplementation with estrogen..”

38) Line 265 “the” is not needed before treatment and “of” should be “with”

39) Line 266: “ovary” should be “ovaries”.

40) Line 267: “follicles of the” rather than “that of the”.

41) Line 268: “were” rather than “was” and “at PG..” rather than “in the PG”.

42) Line 268: “stages” rather than “stage”.

43) Line 275: “the” is not needed before cyp17a1

44) Line 277: “albeit” should be deleted.

45) Line 278: “The” is not needed before augmentation.

46) Line 278: Consider “proposed” rather than “found”.

47) Lines 280-282: This section is somewhat confusing as written. If supplementing with Progestin supports testis organization, then it makes sense that the receptor would be required for normal testis development. This result suggests progestin is important for normal organization of the testis and spermatogenesis, but not for determination of testis fate.

48) Line 286-287: By “an interactive function” do the authors mean antagonistic rather than interactive.

49) Line 289: “despite” rather than “albeit”.

50) Line 290: “the” is not needed before ovarian differentiation. In the same sentence, the data suggest this would be maintenance rather than ovary differentiation if ovaries are found among mutants prior to d60 but decline thereafter.

51) Line 293: “the ovarian appearance..” Consider instead “ovaries detected among”..

52) Line 297: “elevated” rather than “accumulated”.

53) Line 298: “incidence or frequency” rather than “rate”.

54) Line 300-301: “may exist in promoting gonadal embarkation on ovarian differentiation.” Consider instead “may promote ovary differentiation”.

55) Line 310: The sentence beginning “The highest up regulation of fancl” can be simplified “Elevated fancl..” Later in the same sentence starting on line 312 “, as their synergistic effect in inhibiting the relative” can be deleted. This sentence would be clearer if these thoughts were inverted. "The observed synergy between Dmrt1 and Androgen signaling in inhibiting fancl transcription in luciferase reporter assays suggests that elevated fancl in cyp17;dmrt1 DM may result from loss of these synergistic repressors.”

56) It would help to start the paragraph starting on line 315 with a broad sentence regarding cell death/oocyte survival and implicated pathways to introduce Tp53 which otherwise appears out of the blue.

57) Line 325 “it could not maintain ovary differentiation” can be simplified “due to impaired ovary differentiation”.

58) Line 326 “germ cell survival”. Do the authors mean oocyte? or are the authors proposing that Fancl might regulated GC survival in ovary and testis?

59) Line 345-346: “(in cyp17a1-/- ;tp53-/- fish, N=12).” This should be in the results section not the discussion.

60) Line 351: “maintains proper” rather than “properly maintains”.

61) Line 365: “elevated” rather than “accumulated”.

62) Line 369: “The” is not needed before determination.

63) Line 372: “the” is not needed before depletion.

64) Line 372: “for” is needed before “CYP17A1”.

65) Line 389: “respectively” is not needed.

66) Line 394 and 396: “used” rather than “adopted”.

Reviewer #2: The authors have addressed all of my previous concerns and I have no further concerns.

Reviewer #3: The authors have answered almost all my questions. The writing of the current manuscript becomes more readable and friendlier for readers. I think it would be better if the following suggestion can be considered before publication.

Abstract

1. Line 31-32: The description “The all-ovary differentiation phenotype observed in cyp17a1-/-;dmrt1-/- zebrafish can be rescued by additional depletion of fancl” feels like that the gonads of cyp17a1-/-;dmrt1-/-;fancl-/- fish will develop into all-ovary”.

2. Line 26-32: In the present study, the female-biased sex ratio phenotypes were positively correlated with upregulated levels of Fanconi anemia complementation group L (fancl) in the gonads of doublesex and mab-3 related transcription factor 1 (dmrt1)-/- and cyp17a1-/-;dmrt1-/- fish, as fancl transcription being synergistically inhibited by Dmrt1 and androgen signaling. The all-ovary differentiation phenotype observed in cyp17a1-/-;dmrt1-/- zebrafish can be rescued by additional depletion of fancl”. Is it possible to write in the following way: “In the present study, the female-biased sex ratio phenotypes......, and additional depletion of fancl in cyp17a1-/-;dmrt1-/- zebrafish reversed the female-biased sex ratio to...... Luciferase assay revealed synergistic inhibitory effect of Dmrt1 and androgen signaling to fancl transcription”. “as fancl transcription being synergistically inhibited by Dmrt1 and androgen signaling” should be “as fancl transcription is/was synergistically inhibited by Dmrt1 and androgen signaling”

3. Line 33: Change “Tumor Protein p53” into “Tumor protein p53”.

Author summary

4. Line 53-55: “Our current study provides new insights into the interactive signals that regulate sexual fate determination with impaired androgen and estrogen synthesis in teleosts”. It would be better to remove the description “with impaired androgen and estrogen synthesis”.

Introduction

5. Line 67: Change “including” to “especially”.

Results

6. Line 205-213: “cyp17a1-/-;dmrt1-/- fish were derived...... then inbred to generate triple homozygotes (cyp17a1-/-;dmrt1-/-;fancl-/-)”. I think this part can be moved to Materials and methods section.

7. Line 231-232: “strengthen the notion that fancl is the downstream regulator of dmrt1 in determining testis fate”. Maybe it is not suitable to say that fancl is the downstream regulator of dmrt1 in testis fate determination. Is fancl expressed in testis? Is fancl downstream of dmrt1 in testis? Maybe it can be written as “highlighting the antagonistic role of fancl and dmrt1 in determining gonad sex”.

Figures

8. Figure 2C, D: Please quantify the increased expression observed for fancl.

Figure legends

9. Line 840: “90 dpf” should be “110 dpf”.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: None

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: Yes: Deshou Wang

PLoS Genet. 2024 Mar 7;20(3):e1011170. doi: 10.1371/journal.pgen.1011170.r004

Author response to Decision Letter 1

24 Jan 2024

Attachment

Submitted filename: 0 Response letter to P Genet 0124 .doc

pgen.1011170.s012.doc^{(165KB, doc)}

PLoS Genet. doi: 10.1371/journal.pgen.1011170.r005

Decision Letter 2

Gregory S Barsh, Mary C Mullins

5 Feb 2024

Dear Dr Zhai,

We are pleased to inform you that your manuscript entitled "New Insights into the All-testis Differentiation in Zebrafish with Compromised Endogenous Androgen and Estrogen Synthesis" has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

Mary C. Mullins

Academic Editor

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-23-01005R2

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

PLoS Genet. doi: 10.1371/journal.pgen.1011170.r006

Acceptance letter

Gregory S Barsh, Mary C Mullins

22 Feb 2024

PGENETICS-D-23-01005R2

New Insights into the All-testis Differentiation in Zebrafish with Compromised Endogenous Androgen and Estrogen Synthesis

Dear Dr Zhai,

We are pleased to inform you that your manuscript entitled "New Insights into the All-testis Differentiation in Zebrafish with Compromised Endogenous Androgen and Estrogen Synthesis" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Judit Kozma

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Targeted disruption of cyp17a1 and dmrt1.

(TIF)

pgen.1011170.s001.tif^{(6.2MB, tif)}

S2 Fig. In situ hybridization was performed on cryosections of presumptive ovaries using the sense probe of fancl.

(A) Control fish at 25 dpf. (B) cyp17a1-/-;dmrt1-/- fish at 25 dpf. Arrows point to the immature oocytes.

(TIF)

pgen.1011170.s002.tif^{(7.3MB, tif)}

S3 Fig. Additional target disruptions of cyp17a1 and fancl in dmrt1-/- zebrafish.

(TIF)

pgen.1011170.s003.tif^{(8.4MB, tif)}

S4 Fig. The single domain mutation of Fancl did not affect its association with TP53.

(TIF)

pgen.1011170.s004.tif^{(8.1MB, tif)}

S1 Data. Source data for Fig 1M, 1N, 1O and 1V.

(XLSX)

pgen.1011170.s005.xlsx^{(14.4KB, xlsx)}

S2 Data. Source data for Fig 2A, 2B, 2E, 2H and 2I.

(XLSX)

pgen.1011170.s006.xlsx^{(13.4KB, xlsx)}

S3 Data. Source data for Fig 3M and 3C1.

(XLSX)

pgen.1011170.s007.xlsx^{(11KB, xlsx)}

S4 Data. Source data for Fig 4B, and 4D.

(XLSX)

pgen.1011170.s008.xlsx^{(10.2KB, xlsx)}

S5 Data. Source data for Fig 5B, and 5D.

(XLSX)

pgen.1011170.s009.xlsx^{(10.3KB, xlsx)}

S6 Data. Source data for Fig 6G.

(XLSX)

pgen.1011170.s010.xlsx^{(9.9KB, xlsx)}

Attachment

Submitted filename: Response letter to P Genet 0104.doc

pgen.1011170.s011.doc^{(6.3MB, doc)}

Attachment

Submitted filename: 0 Response letter to P Genet 0124 .doc

pgen.1011170.s012.doc^{(165KB, doc)}

Data Availability Statement

The RNA-seq raw data are available from the BioProject database (accession number: PRJNA999043). The other relevant data are within the paper and its Supporting Information files.

[pgen.1011170.ref001] 1.Dai S, Qi S, Wei X, Liu X, Li Y, Zhou X, et al. Germline sexual fate is determined by the antagonistic action of dmrt1 and foxl3/foxl2 in tilapia. Development. 2021;148(8). doi: 10.1242/dev.199380 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref002] 2.Bell G. The masterpiece of nature: the evolution and genetics of sexuality. Berkeley: The University of California Press. 1982:1–635. [Google Scholar]

[pgen.1011170.ref003] 3.Devlin RH, Nagahama Y. Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences. Aquaculture. 2002;208:191–364. [Google Scholar]

[pgen.1011170.ref004] 4.Myosho T, Otake H, Masuyama H, Matsuda M, Kuroki Y, Fujiyama A, et al. Tracing the Emergence of a Novel Sex-Determining Gene in Medaka, Oryzias luzonensis. Genetics. 2012;191(1):163–+. doi: 10.1534/genetics.111.137497 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref005] 5.Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, et al. DMY is a Y-specific DM-domain gene required for male development in the medaka fish. Nature. 2002;417(6888):559–63. doi: 10.1038/nature751 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref006] 6.Li MH, Sun YL, Zhao JE, Shi HJ, Zeng S, Ye K, et al. A Tandem Duplicate of Anti-Mullerian Hormone with a Missense SNP on the Y Chromosome Is Essential for Male Sex Determination in Nile Tilapia, Oreochromis niloticus. Plos Genet. 2015;11(11). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref007] 7.Hattori RS, Murai Y, Oura M, Masuda S, Majhi SK, Sakamoto T, et al. A Y-linked anti-Mullerian hormone duplication takes over a critical role in sex determination. P Natl Acad Sci USA. 2012;109(8):2955–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref008] 8.Chen SL, Zhang GJ, Shao CW, Huang QF, Liu G, Zhang P, et al. Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle. Nat Genet. 2014;46(3):253-+. doi: 10.1038/ng.2890 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref009] 9.Nanda I, Kondo M, Hornung U, Asakawa S, Winkler C, Shimizu A, et al. A duplicated copy of DMRT1 in the sex-determining region of the Y chromosome of the medaka, Oryzias latipes. P Natl Acad Sci USA. 2002;99(18):11778–83. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref010] 10.Tao B, Hu W. Research Progress on Sex Control Breeding of Fish. J Agr Sci Tech-Iran. 2021;24(2):1–10. [Google Scholar]

[pgen.1011170.ref011] 11.Sato T, Endo T, Yamahira K, Hamaguchi S, Sakaizumi M. Induction of female-to-male sex reversal by high temperature treatment in Medaka, Oryzias latipes. Zoolog Sci. 2005;22(9):985–8. doi: 10.2108/zsj.22.985 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref012] 12.Wilson CA, High SK, McCluskey BM, Amores A, Yan YL, Titus TA, et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 2014;198(3):1291–308. doi: 10.1534/genetics.114.169284 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref013] 13.Matson CK, Zarkower D. Sex and the singular DM domain: insights into sexual regulation, evolution and plasticity. Nat Rev Genet. 2012;13(3):163–74. doi: 10.1038/nrg3161 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref014] 14.Yin Y, Tang H, Liu Y, Chen Y, Li G, Liu X, et al. Targeted Disruption of Aromatase Reveals Dual Functions of cyp19a1a During Sex Differentiation in Zebrafish. Endocrinology. 2017;158(9):3030–41. doi: 10.1210/en.2016-1865 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref015] 15.Lau ES, Zhang Z, Qin M, Ge W. Knockout of Zebrafish Ovarian Aromatase Gene (cyp19a1a) by TALEN and CRISPR/Cas9 Leads to All-male Offspring Due to Failed Ovarian Differentiation. Sci Rep. 2016;6:37357. doi: 10.1038/srep37357 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref016] 16.Dranow DB, Hu K, Bird AM, Lawry ST, Adams MT, Sanchez A, et al. Bmp15 Is an Oocyte-Produced Signal Required for Maintenance of the Adult Female Sexual Phenotype in Zebrafish. Plos Genet. 2016;12(9). doi: 10.1371/journal.pgen.1006323 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref017] 17.Wu K, Song W, Zhang Z, Ge W. Disruption of dmrt1 rescues the all-male phenotype of the cyp19a1a mutant in zebrafish—a novel insight into the roles of aromatase/estrogens in gonadal differentiation and early folliculogenesis. Development. 2020;147(4). doi: 10.1242/dev.182758 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref018] 18.Romano S, Kaufman OH, Marlow FL. Loss of dmrt1 restores zebrafish female fates in the absence of cyp19a1a but not rbpms2a/b. Development. 2020;147(18). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref019] 19.Webster KA, Schach U, Ordaz A, Steinfeld JS, Draper BW, Siegfried KR. Dmrt1 is necessary for male sexual development in zebrafish. Dev Biol. 2017;422(1):33–46. doi: 10.1016/j.ydbio.2016.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref020] 20.Nakajin S, Hall PF, Onoda M. Testicular microsomal cytochrome P-450 for C21 steroid side chain cleavage. Spectral and binding studies. J Biol Chem. 1981;256(12):6134–9. [PubMed] [Google Scholar]

[pgen.1011170.ref021] 21.Zhai G, Shu T, Xia Y, Lu Y, Shang G, Jin X, et al. Characterization of Sexual Trait Development in cyp17a1-Deficient Zebrafish. Endocrinology. 2018;159(10):3549–62. doi: 10.1210/en.2018-00551 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref022] 22.Zhai G, Shu TT, Xia YG, Jin X, He JY, Yin Z. Androgen signaling regulates the transcription of anti-Mullerian hormone via synergy with SRY-related protein SOX9A. Sci Bull. 2017;62(3):197–203. [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref023] 23.Zhai G, Shu T, Yu G, Tang H, Shi C, Jia J, et al. Augmentation of progestin signaling rescues testis organization and spermatogenesis in zebrafish with the depletion of androgen signaling. eLife. 2022;11. doi: 10.7554/eLife.66118 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref024] 24.Sato T, Suzuki A, Shibata N, Sakaizumi M, Hamaguchi S. The novel mutant scl of the medaka fish, Oryzias latipes, shows no secondary sex characters. Zoolog Sci. 2008;25(3):299–306. doi: 10.2108/zsj.25.299 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref025] 25.Zhai G, Shu T, Chen K, Lou Q, Jia J, Huang J, et al. Successful production of an all-female common carp (Cyprinus carpio L.)population using cyp17a1-deficient neomale carp. Engineering. 2021. [Google Scholar]

[pgen.1011170.ref026] 26.Clelland E, Peng C. Endocrine/paracrine control of zebrafish ovarian development. Mol Cell Endocrinol. 2009;312(1–2):42–52. doi: 10.1016/j.mce.2009.04.009 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref027] 27.Orban L, Sreenivasan R, Olsson PE. Long and winding roads: testis differentiation in zebrafish. Mol Cell Endocrinol. 2009;312(1–2):35–41. doi: 10.1016/j.mce.2009.04.014 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref028] 28.Slanchev K, Stebler J, de la Cueva-Mendez G, Raz E. Development without germ cells: the role of the germ line in zebrafish sex differentiation. Proc Natl Acad Sci U S A. 2005;102(11):4074–9. doi: 10.1073/pnas.0407475102 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref029] 29.Uchida D, Yamashita M, Kitano T, Iguchi T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J Exp Biol. 2002;205(Pt 6):711–8. doi: 10.1242/jeb.205.6.711 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref030] 30.Dranow DB, Tucker RP, Draper BW. Germ cells are required to maintain a stable sexual phenotype in adult zebrafish. Dev Biol. 2013;376(1):43–50. doi: 10.1016/j.ydbio.2013.01.016 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref031] 31.Tzung KW, Goto R, Saju JM, Sreenivasan R, Saito T, Arai K, et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 2015;4(1):61–73. doi: 10.1016/j.stemcr.2014.10.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref032] 32.Dai X, Jin X, Chen X, He J, Yin Z. Sufficient numbers of early germ cells are essential for female sex development in zebrafish. PLoS One. 2015;10(2):e0117824. doi: 10.1371/journal.pone.0117824 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref033] 33.Siegfried KR, Nusslein-Volhard C. Germ line control of female sex determination in zebrafish. Dev Biol. 2008;324(2):277–87. doi: 10.1016/j.ydbio.2008.09.025 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref034] 34.Meetei AR, de Winter JP, Medhurst AL, Wallisch M, Waisfisz Q, van de Vrugt HJ, et al. A novel ubiquitin ligase is deficient in Fanconi anemia. Nat Genet. 2003;35(2):165–70. doi: 10.1038/ng1241 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref035] 35.Ramanagoudr-Bhojappa R, Carrington B, Ramaswami M, Bishop K, Robbins GM, Jones M, et al. Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility. Plos Genet. 2018;14(12):e1007821. doi: 10.1371/journal.pgen.1007821 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref036] 36.Parmar K, D’Andrea A, Niedernhofer LJ. Mouse models of Fanconi anemia. Mutat Res. 2009;668(1–2):133–40. doi: 10.1016/j.mrfmmm.2009.03.015 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref037] 37.Rodriguez-Mari A, Wilson C, Titus TA, Canestro C, BreMiller RA, Yan YL, et al. Roles of brca2 (fancd1) in oocyte nuclear architecture, gametogenesis, gonad tumors, and genome stability in zebrafish. Plos Genet. 2011;7(3):e1001357. doi: 10.1371/journal.pgen.1001357 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref038] 38.Rodriguez-Mari A, Canestro C, Bremiller RA, Nguyen-Johnson A, Asakawa K, Kawakami K, et al. Sex reversal in zebrafish fancl mutants is caused by Tp53-mediated germ cell apoptosis. Plos Genet. 2010;6(7):e1001034. doi: 10.1371/journal.pgen.1001034 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref039] 39.Fridman JS, Lowe SW. Control of apoptosis by p53. Oncogene. 2003;22(56):9030–40. doi: 10.1038/sj.onc.1207116 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref040] 40.Botthof JG, Bielczyk-Maczynska E, Ferreira L, Cvejic A. Loss of the homologous recombination gene rad51 leads to Fanconi anemia-like symptoms in zebrafish. Proc Natl Acad Sci U S A. 2017;114(22):E4452–E61. doi: 10.1073/pnas.1620631114 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref041] 41.Ye D, Tu Y, Wang H, He M, Wang Y, Chen Z, et al. A landscape of differentiated biological processes involved in the initiation of sex differentiation in zebrafish. Water Biology and Security. 2022;1:100059. [Google Scholar]

[pgen.1011170.ref042] 42.Lin Q, Mei J, Li Z, Zhang X, Zhou L, Gui JF. Distinct and Cooperative Roles of amh and dmrt1 in Self-Renewal and Differentiation of Male Germ Cells in Zebrafish. Genetics. 2017;207(3):1007–22. doi: 10.1534/genetics.117.300274 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref043] 43.Yu G, Zhang D, Liu W, Wang J, Liu X, Zhou C, et al. Zebrafish androgen receptor is required for spermatogenesis and maintenance of ovarian function. Oncotarget. 2018;9(36):24320–34. doi: 10.18632/oncotarget.24407 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref044] 44.Tang H, Chen Y, Wang L, Yin Y, Li G, Guo Y, et al. Fertility impairment with defective spermatogenesis and steroidogenesis in male zebrafish lacking androgen receptor. Biol Reprod. 2018;98(2):227–38. doi: 10.1093/biolre/iox165 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref045] 45.Crowder CM, Lassiter CS, Gorelick DA. Nuclear Androgen Receptor Regulates Testes Organization and Oocyte Maturation in Zebrafish. Endocrinology. 2018;159(2):980–93. doi: 10.1210/en.2017-00617 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref046] 46.Bertho S, Clapp M, Banisch TU, Bandemer J, Raz E, Marlow FL. Zebrafish dazl regulates cystogenesis and germline stem cell specification during the primordial germ cell to germline stem cell transition. Development. 2021;148(7). doi: 10.1242/dev.187773 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref047] 47.Qin M, Zhang Z, Song W, Wong QW, Chen W, Shirgaonkar N, et al. Roles of Figla/figla in Juvenile Ovary Development and Follicle Formation During Zebrafish Gonadogenesis. Endocrinology. 2018;159(11):3699–722. doi: 10.1210/en.2018-00648 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref048] 48.Dai X, Cheng X, Huang J, Gao Y, Wang D, Feng Z, et al. Rbm46, a novel germ cell-specific factor, modulates meiotic progression and spermatogenesis. Biol Reprod. 2021;104(5):1139–53. doi: 10.1093/biolre/ioab016 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref049] 49.Hartung O, Forbes MM, Marlow FL. Zebrafish vasa is required for germ-cell differentiation and maintenance. Mol Reprod Dev. 2014;81(10):946–61. doi: 10.1002/mrd.22414 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref050] 50.Kaufman OH, Lee K, Martin M, Rothhämel S, Marlow FL. rbpms2 functions in Balbiani body architecture and ovary fate. Plos Genet. 2018;14(7):e1007489. doi: 10.1371/journal.pgen.1007489 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref051] 51.Nakamoto M, Shibata Y, Ohno K, Usami T, Kamei Y, Taniguchi Y, et al. Ovarian aromatase loss-of-function mutant medaka undergo ovary degeneration and partial female-to-male sex reversal after puberty. Mol Cell Endocrinol. 2018;460:104–22. doi: 10.1016/j.mce.2017.07.013 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref052] 52.Hiramatsu R, Matoba S, Kanai-Azuma M, Tsunekawa N, Katoh-Fukui Y, Kurohmaru M, et al. A critical time window of Sry action in gonadal sex determination in mice. Development. 2009;136(1):129–38. doi: 10.1242/dev.029587 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref053] 53.Aherrahrou R, Kulle AE, Alenina N, Werner R, Vens-Cappell S, Bader M, et al. CYP17A1 deficient XY mice display susceptibility to atherosclerosis, altered lipidomic profile and atypical sex development. Sci Rep. 2020;10(1):8792. doi: 10.1038/s41598-020-65601-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref054] 54.Westerfield M. The zebrafish book, a guide for the laboratory use of zebrafish (Danio rerio). OR 4rd ed. University of Oregon, Eugene. 2020. [Google Scholar]

[pgen.1011170.ref055] 55.Shi C, Lu Y, Zhai G, Huang J, Shang G, Lou Q, et al. Hyperandrogenism in POMCa-deficient zebrafish enhances somatic growth without increasing adiposity. J Mol Cell Biol. 2020;12(4):291–304. doi: 10.1093/jmcb/mjz053 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref056] 56.Zhu J, Zhang D, Liu X, Yu G, Cai X, Xu C, et al. Zebrafish prmt5 arginine methyltransferase is essential for germ cell development. Development. 2019;146(20). doi: 10.1242/dev.179572 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref057] 57.Selman K, Wallace RA, Sarka A, Qi X. Stages of oocyte development in the zebrafish, Brachydanio rerio. J Morphol. 1993;218(2):203–24. doi: 10.1002/jmor.1052180209 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref058] 58.Wang Y, Ge W. Developmental profiles of activin betaA, betaB, and follistatin expression in the zebrafish ovary: evidence for their differential roles during sexual maturation and ovulatory cycle. Biol Reprod. 2004;71(6):2056–64. doi: 10.1095/biolreprod.104.032649 [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref059] 59.Pang Y, Thomas P. Role of G protein-coupled estrogen receptor 1, GPER, in inhibition of oocyte maturation by endogenous estrogens in zebrafish. Dev Biol. 2010;342(2):194–206. doi: 10.1016/j.ydbio.2010.03.027 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref060] 60.Chu L, Li J, Liu Y, Hu W, Cheng CH. Targeted gene disruption in zebrafish reveals noncanonical functions of LH signaling in reproduction. Mol Endocrinol. 2014;28(11):1785–95. doi: 10.1210/me.2014-1061 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011170.ref061] 61.Li J, Huang D, Sun X, Li X, Cheng CHK. Zinc mediates the action of androgen in acting as a downstream effector of luteinizing hormone on oocyte maturation in zebrafish. Biol Reprod. 2019;100(2):468–78. [DOI] [PubMed] [Google Scholar]

[pgen.1011170.ref062] 62.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]

PERMALINK

New insights into the all-testis differentiation in zebrafish with compromised endogenous androgen and estrogen synthesis

Yonglin Ruan

Xuehui Li

Xinyi Wang

Gang Zhai

Qiyong Lou

Xia Jin

Jiangyan He

Jie Mei

Wuhan Xiao

Jianfang Gui

Zhan Yin

Roles

Abstract

Author summary

Introduction

Results

All cyp17a1-/-;dmrt1-/- fish developed as females

Fig 1. Additional depletion of dmrt1 restored the phenotype of ovary differentiation in cyp17a1-/- zebrafish.

Increased expression of fancl in the gonad of cyp17a1-/-;dmrt1-/- fish

Fig 2. The cyp17a1-/-;dmrt1-/- fish exhibited increased expression of fancl.

Increased fancl expression sustained ovary differentiation in cyp17a1-/-;dmrt1-/- females

Fig 3. Additional depletion of fancl blocked female-biased sex ratio of cyp17a1-/-;dmrt1-/- fish and dmrt1-/- fish.

Zebrafish Fancl interacts with Tp53 in vitro

Fig 4. Fancl interacts with Tp53 in HEK293T cells.

Zebrafish Fancl activated K48-linked ubiquitination of Tp53 in vitro

Fig 5. Fancl promoted K48-linked ubiquitination of Tp53 in HEK293T cells.

Arrested follicular development in cyp17a1-/-;dmrt1-/- females was rescued by 17β-estradiol

Fig 6. Administration of 17β-estradiol rescued the arrested folliculogenesis of cyp17a1-/-;dmrt1-/- fish.

Discussion

Materials and methods

Ethics statement

Zebrafish maintenance

The knockout lines

Table 1. Primers used in this study.

Histological analysis

In situ hybridization

Isolation and staging of ovarian follicles

Serum estradiol measurement

RNA extraction and quantitative real-time PCR (qPCR)

Transcriptome analysis

Plasmid constructions

Cell culture and transfection

Luciferase reporter assay

Western blotting

Co-IP analysis

Ubiquitination inhibitor administration

Ubiquitination assay

17β-estradiol administration

Statistical analysis

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Gregory S Barsh

Mary C Mullins

Roles

Transfer Alert

Author response to Decision Letter 0

Decision Letter 1

Gregory S Barsh

Mary C Mullins

Roles

Author response to Decision Letter 1

Decision Letter 2

Gregory S Barsh

Mary C Mullins

Roles

Acceptance letter

Gregory S Barsh

Mary C Mullins

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK