Abstract
The black soldier fly (BSF), Hermetia illucens, has the potential to serve as a valuable resource for waste bioconversion due to the ability of the larvae to thrive in a microbial-rich environment. Being an ecological decomposer, the survival of BSF larvae (BSFL) relies on developing an efficient defense system. Cathepsin L (CTSL) is a cysteine protease that plays roles in physiological and pathological processes. In this study, the full-length of CTSL was obtained from BSF. The 1,020-bp open reading frame encoded a preprotein of 339 amino acids with a predicted molecular weight of 32 kDa. The pro-domain contained the conserved ERFNIN, GNYD, and GCNGG motifs, which are all characteristic of CTSL. Homology revealed that the deduced amino acid sequence of BSF CTSL shared 74.22–72.99% identity with Diptera flies. Immunohistochemical (IHC) analysis showed the CTSL was predominantly localized in the gut, especially in the midgut. The mRNA expression of CTSL in different larval stages was analyzed by quantitative real-time PCR (RT-qPCR), which revealed that CTSL was expressed in the second to sixth instar, with the highest expression in the fifth instar. Following an immune challenge in vivo using Escherichia coli (E. coli), CTSL mRNA was significantly up-regulated at 6 h post-stimulation. The Z-Phe-Arg-AMC was gradually cleaved by the BSFL extract after 3 h post-stimulation. These results shed light on the potential role of CTSL in the defense mechanism that helps BSFL to survive against pathogens in a microbial-rich environment.
Introduction
The black soldier fly (BSF), Hermetia illucens (Diptera: Stratiomyidae), populate tropical and temperate regions worldwide [1–4]. Its life cycle spans nearly forty days and comprises five distinct stages, including egg, larvae (from the first to the fifth instar), pre-pupa (the sixth instar), pupa, and adult [5–8]. It plays a crucial role by utilizing animal manure and organic waste as their primary food source in the larval stages. BSF larvae (BSFL) are now considered a valuable bio-converter with the ability to convert biomass into energy for their growth [9–16]. Cultivating BSFL offers several notable advantages. Firstly, they can transform various decaying plant and animal materials into valuable resources for animal feed and biofuel production [17–20]. Secondly, they represent an enticing opportunity as a potential substitute for conventional meal sources by virtue of their high protein and lipid content [21–23]. Thirdly, their ease of cultivation contributes significantly to environmental sustainability and the efficient recycling of resources [24]. These remarkable characteristics of BSFL align perfectly with sustainable development goals, particularly in promoting sustainable circular agriculture [25]. Owing to these BSFL advantages, they have become a commercially important species.
BSFL are utilized to convert low-grade food waste into valuable high-end proteins and fats within intensive production facilities; however, this could expose them to high concentrations of harmful microorganisms [26]. They are very plausible that this insect species has developed a heightened and more efficient immune response mechanism to cope with such environmental challenges [27]. In order to unravel their disease control mechanisms, develop effective disease control strategies, and optimize the yield of BSFL cultures, the complex immune mechanisms in these remarkable insects require in-depth study. Current knowledge regarding the immune response of BSFL indicates that a tough cuticular layer covers them to isolate themselves from their environment [28]. In their exposed digestive tract, salivary glands and digestive organs such as the midgut secrete digestive fluids to break down microorganisms from their food. Upon the invasion of microorganisms into the body, blood cells or fat body cells secrete soluble protein molecules, including lectins [29], immune peptides, and antimicrobial peptides [30–34]. These bioactive molecules play a crucial role in combating the invading pathogens [35–37]. This process leads to nodule formation and encapsulation responses to inhibit the spread of infections or direct phagocytosis of pathogens by blood cells [38–40]. Despite appearing to adapt to environments rich in microorganisms, some reports indicate that BSFL can also be susceptible to various entomopathogens that cause damage, including fungi, viruses, protozoa, and bacteria [26, 41]. Therefore, a thorough understanding of the immune system of BSFL will better equip us to utilize them in large-scale applications for environmental sustainability and provide insights into disease control strategies.
Cathepsin L (CTSL) is a crucial cysteine protease widely present across various organisms, including insects [42–46]. It plays a pivotal role in numerous facets of insect biology, thus drawing significant attention from entomologists. This enzyme exhibits a remarkable involvement in a variety of life processes, including molting [43], the catabolism of fat bodies [44], programmed cell death [44], wing disc differentiation [47], eclosion [48], metamorphosis [49, 50], and immune responses [51]. In the context of insects, CTSL is predominantly localized within the digestive tract, specifically the midgut [51]. It is worth noting that CTSL is also present in other organs, such as in the testis, head, midgut, and hemocytes [52, 53]. Notably, its involvement in the degradation of foreign pathogens is crucial within the scope of the insect immune response, where the primary function of CTSL involves food digestion and the prevention of pathogenic invasion of the digestive tract [51]. CTSL also demonstrates antibacterial activity [35], particularly in cases of digestive tract invasion, potentially influencing various facets of innate immune responses [54, 55]. Nevertheless, the specific expression patterns of CTSL in BSFL and its precise role in microbial infection remain intriguing areas of inquiry that await further investigation from the perspective of entomological research.
In this study, our aim was to elucidate the molecular characteristics of CTSL in BSFL. We took a multifaceted approach and integrated various approaches. First, we obtained the CTSL gene in BSFL using rapid amplification of cDNA ends (RACE) by designing degenerate primers derived from different Diptera strains. These primers helped to obtain partial CTSL sequences. Then, we performed RACE to gain the complete open reading frame of the CTSL sequence in BSFL. Second, hematoxylin and eosin (H&E) staining was used to gain a comprehensive understanding of the overall tissue structure and morphology of BSFL, and in parallel, we generated anti-CTSL serum to precisely visualize CTSL localization within BSFL tissue by immunohistochemistry (IHC) analysis. Third, we performed CTSL mRNA expression profiling to thoroughly examine CTSL mRNA expression levels in various larval stages of BSFL. This process provided essential insights into the dynamic regulatory patterns of CTSL at different developmental stages. At last, a microbial challenge experiment was conducted in which pathogen invasion in vivo was simulated. We challenged BSFL with Escherichia coli (E. coli) by physically inducing damage and then explored the changes in CTSL mRNA expression levels and proteolytic activity. The mRNA expression levels were assessed at multiple time points using quantitative real-time PCR (RT-qPCR), and proteolytic activity was quantified using the Z-Phe-Arg-AMC.
Our comprehensive investigation greatly enhanced the understanding of CTSL in BSFL. Furthermore, we revealed the dynamic changes in CTSL expression during microbial infection, revealing the critical role of CTSL in the BSFL immune response. Given the great significance of BSFL in the context of the circular economy, an in-depth exploration of its immunology is crucial. This research has provided further insight into our knowledge of entomology. It has the potential to drive advancements in industry and practices rooted in BSFL by which to achieve sustainability and ecological efficiency.
Materials and methods
Insect rearing
BSFL were supplied by Prof. Han-Tso Lin’s lab at Ming Chuan University, Taiwan. BSFL were reared in a 5-liter plastic bucket with 500 g of wheat bran on the bottom as bedding material and feed. The environment was maintained at 27±1°C in a 16 h photoperiod at 60–70% relative humidity [56]. BSFL were divided into six instar stages based on their characteristics and lengths, according to the report by Barros [8]. The second to sixth instar were selected in each group for the following experiments, which were performed in triplicate.
RNA isolation and cDNA synthesis from BSFL
Total RNA extraction was performed for cDNA sequence and mRNA expression analysis. Fresh BSFL (5–10 mg body weight) were snap-frozen in liquid nitrogen and then homogenized and frozen by mortar and pestle. Total RNA was extracted using TRIzol reagent (Invitrogen, CA, USA) and GENEzol TriRNA Pure Kit (Geneaid Biotech, Taiwan) with an additional chloroform extraction step. RNA was eluted in 50 μl of RNase-free double distilled water; the quality, concentration, and purity (the absorbance ratios in 260/280 nm and 260/230 nm) were analyzed by measuring the absorbance using a spectrophotometer (Synergy HT, BioTek Instruments, VT, USA). Total RNA (200 ng) was used directly as a template for cDNA synthesis, in which the RNA samples were reverse transcribed using M-MLV reverse transcriptase (M-MLV RT) (Promega Corp, Madison, WI, USA) and oligo(dT)-primers (Promega Corp, Madison, WI, USA). The reaction was incubated at 42°C for 60 min and then at 95°C for 15 min. The final synthesized cDNA was stored at -80°C for subsequent use.
Obtaining the total open reading frame of the CTSL cDNA sequence from BSFL
Degenerated primers (Table 1) were utilized to amplify a partial cathepsin L gene cDNA. Two pairs of degenerated primers were designed on the conserved cDNA sequences of CTSL from six species of Diptera flies, including Drosophila bipectinata (XM_017251151.1), Drosophila eugracilis (XM_017213434.1), Drosophila serrata (XM_020945285.1), Anopheles gambiae (XM_001689230.2), Aedes aegypti (XM_001655949.2), and Culex quinquefasciatus (XM_001848292.1). These CTSL cDNA sequences were aligned by Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo). The conserved sequences were selected to represent the wide spectrum of phylogenetic diversity in CTSL. PCR was performed in a 30 μl volume with 2 mM of 2X Perfect Read PCR Master Mix (Ten Giga Bio, Taiwan), cDNA (200 ng), and degenerate primers (1 mM). PCR amplification conditions for the partial sequence were as follows. The cycling parameters included a 95°C hot start for 5 s, followed by 35 cycles of a three-step PCR: 95°C for 30 s, an annealing temperature of 53°C for 30 s, and a 72°C extension step for 45 s, with a final extension at 72°C for 10 s. The PCR products were cloned into pGEM®-T Easy Vector Systems (Promega Corp, Madison, WI, USA). Positive clones with the expected inserts were sequenced using T7 and SP6 primers. After receiving the partial cathepsin L sequence, the full-length cDNA sequence of the open reading frame in cathepsin L was obtained through the RACE technique (GeneRacer™ Kit, Invitrogen). Primers were designed based on the obtained partial sequence, and the process was performed following the manufacturer’s instructions. After RACE, the full-length open reading frame of the BSFL cathepsin L gene was obtained, and the sequence was analyzed by Mission Biotech (Taipei, Taiwan).
Table 1. Primers for RACE and quantitative real-time PCR used in this study.
| Primer name | Primer sequence (5’-3’) |
|---|---|
| Degenerate primers | |
| CTSL-1F | AGAACAAGCACAARATYGCCAAG |
| CTSL-1R | YTANACYARBGGRTARCTGG |
| CTSL-2F | ABGAYYWVGKDYMYTGCKGC |
| CTSL-2R | CCANGAGTTVBYMAYYARCC |
| RT-PCR primers | |
| qCTSL-F | GGGTGCTGTGACCCCAATAA |
| qCTSL-R | CCATAAGACCGCCATTGCAT |
| Actin-F | ACGTTGCAATCCAGGCTGTT |
| Actin-R | CACGAACGATTTCCCTTTCG |
Phylogenic analysis of CTSL amino acid sequence
The obtained BSFL cathepsin L sequence was translated via EXPASY (https://web.expasy.org/translate) to deduce its amino acid sequence. Signal peptides were predicted by SignalP-6.0 (https://services.healthtech.dtu.dk/service.php?SignalP). The deduced amino acid sequence was aligned via Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo). Percent identity and a phylogenetic tree were calculated using MEGA11 software (https://www.megasoftware.net) adopting the neighbor-joining algorithm with available insect, arthropod, fish, and mammal CTSL amino acid sequences obtained from GenBank with the following accession numbers: Drosophila bipectinata (XP_017106640.1), Drosophila eugracilis (XP_017068923.1), Drosophila serrata (XP_020800944.1), Anopheles gambiae (XP_001689282.1), Aedes aegypti (XP_001655999.2), Culex quinquefasciatus (XP_001848344.1), Penaeus monodon (AME17651.1), Macrobrachium rosenbergii (AJP62583.2), Danio rerio (CAA69623.1), and Homo sapiens (NP_001244901.1). Phylogenetic trees were produced by bootstrapping this matrix with 1,000 replicates.
Morphological organization of BSFL and anti-CTSL serum preparation for IHC analysis
For H&E and IHC staining, fresh tissues from the fifth instar were fixed in Davidson’s alcohol formalin acetic acid fixative and stored at room temperature for 24 h. Fixed tissues were dehydrated using increasing concentrations of ethanol (70%, 80%, 90%, 95%, and 100%), cleared twice in xylene, and then embedded in melted paraffin. Sections (4 μm) cut using a microtome (Accu-Cut SRM 200 Rotary Microtome, Sakura Finetek, CA, USA) were mounted on glass slides, deparaffinized in xylene, rehydrated in decreasing concentrations of ethanol (100%, 95%, 90%, 80%, and 70%), and washed in ddH2O. H&E staining was performed by immersing the slides in Mayer’s hematoxylin (Sigma-Aldrich) with agitation for 30 s, followed by a 2 min rinse under running tap water. The slides were then stained with a 1% eosin solution for 30 s. Subsequently, the sections underwent two rounds of dehydration in 95% alcohol and two rounds in 100% alcohol (each for 30 s) before being cleared in xylene. Finally, the slides were treated with mounting medium and covered with coverslips. Recombinant CTSL protein was produced and purified from E. coli BL21 (DE3) for IHC staining following the methods outlined in our previous study [57]. SDS-PAGE was used to identify recombinant CTSL, presumed at a molecular weight of 32 kDa. Purified recombinant CTSL protein was used as an antigen for CTSL antiserum production in BALB/c mice (S1 Fig). Equal volumes of an antigen solution (CTSL 0.5 mg/ml in phosphate-buffered saline, PBS) were mixed with Freund’s complete adjuvant (1:1, v/v) for the primary injection. The mice were subcutaneously injected with 0.5 ml of the antigen mixture, followed by a booster injection with the same antigen mixture in the fourth week. Serum was collected from the hearts of the experimental mice, clotting at 25°C for 2 h, and centrifuged at 3,000 × g at 4°C for 10 min. Purified mice anti-CTSL polyclonal antibodies were then isolated. An enzyme-linked immunosorbent assay was used to determine antibody titers for the anti-CTSL antibodies (S2 Fig). For IHC analysis, BSFL tissue sections were incubated with anti-CTSL primary antibodies (1:500, v/v) in PBS at room temperature for 30 min. The sections were washed twice using PBS and incubated with One-Step enzymes horseradish peroxidase polymer for 20 min, then stained in a chromogen substrate diaminobenzidine for 10 min. Sections were subsequently counterstained in Mayer’s hematoxylin (Sigma-Aldrich) for 2 min, dehydrated using ethanol, cleared in xylene, and mounted.
Analysis of BSFL CTSL mRNA expression in different instars
BSFL were freshly collected in triplicate at different instar phases, specifically the second to sixth instars, and homogenized for RNA extraction. Gene expression was analyzed via RT-qPCR using SYBR Green qPCR MasterMix (Promega Corp, Madison, WI, USA). Primer sequences are listed in Table 1. The Mx3005P qPCR system (Agilent Technologies, CA, USA) performed amplification, detection, and analysis. The amplification program consisted of pre-incubation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 10 s and annealing at 60°C for 60 s. Expression levels of β-actin (β-actin-F/R) mRNA served as an internal control. The relative mRNA levels are presented as 2 -ΔΔct [58].
Dynamic expression of CTSL mRNA in response to E. coli challenge
To assess dynamic CTSL expression under challenge, samples ranging from the second to sixth instar were evaluated. The CTSL profile under E. coli-stimulated conditions was determined in triplicate, and the E. coli bacterial strain K12 (Sigma-Aldrich, USA) was used for all experiments. Each BSFL was pricked with a fine needle, and then dipped into a suspension of E. coli (OD600 nm = 1.6, approximately 2 X 109 CFU/ ml) for 15 min. After E. coli exposure, the larvae were transferred into Petri dishes and incubated for 1.5, 3, 6, 9, and 12 h before being collected, homogenized, and frozen by mortar and pestle. The resulting homogenates were used for RNA extraction, cDNA synthesis, and RT-qPCR detection. The control groups were not subjected to any form of treatment.
Measurement of proteolytic activity from the BSFL extract after E. coli challenge
Needles wounded the fifth instars and then immersed in a suspension of E. coli (OD600 nm = 1.6, approximately 2 X 109 CFU/ ml) for 15 min. As previously described, samples were collected after 1.5, 3, 6, 9, and 12 h. Each time course was repeated five times. Samples were homogenized in a PBS solution (0.01 M, 1 ml) in a grinder on ice. CTSL enzyme activity was quantified according to Werle’s report [59] with slight modifications outlined in our previous report [57]. BSFL were added to PBS, homogenized, and centrifuged at 4°C at 14,000 g for 30 min. A 50 μl aliquot of the supernatant was mixed with 100 μl of 0.1 M sodium acetate buffer (NaOAc/acetic acid buffer, pH 5.0) and 50 μl of 10 μM Z-Phe-Arg-amido-4-methyl coumarin hydrochloride (Z-Phe-Arg-AMC; Sigma-Aldrich, Saint Louis, USA), which is a cysteine protease-specific synthetic fluorometric substrate [60, 61]. Cysteine protease can cleave the substrate by attacking the peptide bond between arginine and AMC. After the release of AMC, we detected its fluorescence using a microplate fluorometer at an excitation wavelength of 380 nm and an emission wavelength of 450 nm (Synergy HT, BioTek Instruments, Winooski, VT). L-trans-Epoxysuccinyl-leucylamido (4-guanidino) butane (E-64, 10 μM), an inhibitor of cysteine proteinases, was a negative control. The relative activity was calculated using the following formula: Relative activity = fluorescence in the treatment group / the highest fluorescence in the trial.
Statistical analysis
Statistical analysis in this study was conducted by one-way analysis of variance (ANOVA) and Dunnett’s test using Graph-Pad Prism 8.4 for Mac (GraphPad Software, CA, USA), where p < 0.05 was considered statistically significant between treatment and control groups.
Results
Nucleotide and deduced amino acid sequence of BSFL CTSL
The full-length of the CTSL open reading frame was 1,020 bp and encoded a polypeptide of 339 amino acids (a.a.) with a predicted molecular weight of 32 kDa (Fig 1). The deduced amino acids included a pre-domain of CTSL from 1–16 a.a., a pro-domain from 17–121 a.a., and a catalytic domain from 122–337 a.a. The putative signal peptide was 16 a.a. from Met1 to Ala16. The putative mature domain was from Pro122 to Pro337. The catalytic triad was formed from Cys146, His285, and Asn306. Five S2 subsites were defined by the conserved residues Leu190, Met191, Ala257, Leu283, and Gly286, and three conserved disulfide bridges were formed between Cys143 to Cys186, Cys177 to Cys219, and Cys278 to Cys328. The pro-domain contained three CTSL-specific motifs, including an ERFNIN motif from 44–62 a.a., a GNYD motif from 74–81 a.a., and a GCNGG motif from 67–80 a.a. (Fig 2). Based on the above, it was inferred that the sequence obtained in this study was indeed encoded for CTSL.
Fig 1. Nucleotide and deduced amino acid sequence of BSFL CTSL.
The dotted line indicates the putative signal peptide sequence (Met1-Ala16), and the putative mature domain is underlined (Pro175-Pro337). The triad of conserved catalytic active sites (Cys146, His285, and Asn306) is in circled frames, and Gln140 of the oxyanion hole is in the diamond frame. Five S2 subsites are defined by residues Leu190, Met191, Ala257, Leu283, and Gly286 and indicated by the square frames. The asterisk marks the stop codon at the end of the open reading frame.
Fig 2. Alignment of amino acid sequences of CTSL from representative arthropods and vertebrates.
Asterisks (*) indicate amino acids identical in all species. Dashes (–) denote gaps. The CTSL family signatures, including ERFNIN, GNYD, and GCNGG are shaded.
Phylogenetic analysis of CTSL
A multiple sequence alignment showed that the deduced amino acid sequence of CTSL from BSFL was highly homologous to its counterpart Diptera species (Fig 3). Phylogenetic analysis indicated that the deduced amino acid sequence of BSFL CTSL shared 74.22–72.99% homology with Diptera flies. Overall homologies with other Diptera flies were as follows: the highest identity of 74.22% with D. serrata, 72.99% with D. bipectinate, 73.15% with D. eugracilis, 72.57% with A. aegypti, 71.14% with A. gambiae, 71.76% with C. quinquefasciatus, 63.80% with M. rosenbergii, 66.77% with P. monodon, 51.02% with zebrafish D. rerio, and 50.29% with human H. sapiens. It was also found that BSFL CTSL was grouped with the CTSL from arthropods and was closer to the family Drosophilidae than to Culicidae.
Fig 3. Unrooted phylogenetic tree of CTSL and other homologs.
The neighbor-joining algorithm constructed the tree using the Mega11 program based on the multiple sequence alignments by Clustal Omega. The branches indicate bootstrap values of 1,000 replicates (%). The scale bar corresponds to 0.05 estimated amino acid substitutions per site. The amino acid sequences of all species were obtained from the NCBI database. GenBank accession numbers are as follows: Drosophila bipectinata (XP017106640.1), Drosophila eugracilis (XP017068923.1), Drosophila serrata (XP020800944.1), Anopheles gambiae (XP001689282.1), Aedes aegypti (XP001655999.2), Culex quinquefasciatus (XP001848344.1), Macrobrachium rosenbergii (AJP62583.2), Penaeus monodon (AME17651.1), Danio rerio (CAA69623.1), and Homo sapiens (NP001244901.1).
Morphological organization of BSFL and localization of CTSL in BSFL
In the microstructure observation of BSFL, H&E staining revealed the main structure of the fifth instar in the longitudinal and cross sections. Our results showed that the gut was the major structure in the body cavity, surrounded by a muscular layer and covered by a chitin outer skin. The major section is the midgut (Fig 4A and 4D). To obtain a more precise profile of CTSL localization in BSFL, IHC was used to analyze the distribution of CTSL proteins in BSFL organs. Positive signals were detected as a brownish color following the addition of a chromogenic agent. This agent reacted with the enzyme carried by antiserum against BSFL CTSL in the antiserum group (Fig 4C and 4F). The entire midgut was positive for the BSFL CTSL antiserum, indicating the presence of CTSL in the gut of BSFL. Contrastingly, there was no signal detected in the body cavity, muscle, or outer skin positions. Likewise, no signal was observed for the naïve serum employed as a negative control (Fig 4B and 4E).
Fig 4. Morphological organization and immunohistochemical localization of CTSL in BSFL.
The histology of BSFL is presented in longitudinal sections (A, B, C) and cross sections (D, E, F). H&E staining revealed the main structure of the fifth instar of BSFL(A, D). BSFL were stained with naïve mouse serum as a negative control (B, E). BSFL were stained by chromogenic IHC methods following injection of mice anti-BSFL CTSL serum (C, F). Positive signals were revealed in brown, while hematoxylin was used as a counterstain. H, head. (Bar = 500 μm).
Profile of CTSL mRNA expression in different instars of BSFL
To quantify the expression of CTSL in various BSFL instars, we determined the expression profiles of the CTSL gene. The mRNA expression of CTSL in the second instar served as a relative control of 1.00. CTSL mRNA expression was as follows: the third instar was 0.95, the fourth instar was 1.30, the fifth instar was 6.86, and the sixth instar was 1.64. Thus, the highest level of CTSL was expressed in the fifth instar (Fig 5).
Fig 5. Relative expression levels of CTSL mRNA in the different larval stages.
Relative mRNA expression (2 -ΔΔct) levels of CTSL were detected using SRBR green assay and normalized to β-actin. The fold-change of CTSL expression was calculated for the 3rd, 4th, 5th, and 6th instars and compared with the 2nd instar. Bars represent mean ± S.E. (n = 3). Letters indicate significant differences (p < 0.05).
Dynamic expression of CTSL mRNA in response to E. coli challenge
A time course of temporal CTSL mRNA expression was performed following E. coli challenge. The results showed that CTSL in all instars gradually increased after 3 h post-stimulation and dramatically increased at 6 h post-stimulation. The expression of CTSL in the second, third, fourth, and sixth instars was 5 times higher than that of the control, whereas the expression in the fifth instar was 13 times higher than that of the control (Fig 6). After 6 h post-stimulation, the expression level of CTSL gradually decreased and returned to control levels.
Fig 6. Dynamic expression of CTSL mRNA in response to E. coli challenge.
Relative mRNA expression (2 -ΔΔct) levels of CTSL were detected using SRBR green assay and normalized to β-actin in the 2nd (A), 3rd (B), 4th (C), 5th (D), and 6th (E) instars. The fold-change of CTSL expression was calculated at 1.5, 3, 6, 9, and 12 h post-stimulation with E. coli and compared with 0 h (negative control was non-treated BSFL). Bars represent mean ± S.E. (n = 3). Statistical significance is indicated with lowercase letters (p < 0.05).
Dynamic proteolytic activity of cysteine cathepsins in response to E. coli challenge
To measure the effect of infection on the activity of cysteine cathepsins from BSFL, a proteolytic assay was conducted on the fifth instar of BSFL at 0, 1.5, 3, 6, 9, and 12 h post-infection (Fig 7). The proteolytic activity of cysteine cathepsins exhibited a gradual increase from 3 to 12 h after the E. coli challenge, reaching its peak at 12 h post-stimulation. In the negative control, the relative activity of cysteine cathepsins decreased by only 20% in 12 h in samples incubated with the cysteine proteinase inhibitor E-64.
Fig 7. Dynamic proteolytic activity of CTSL in response to E. coli challenge.
Percentage of CTSL activity in the fifth instar under E. coli challenge compared to negative control (cysteine proteinase inhibitor E-64). Error bars represent mean ± S.E. (n = 5). Statistical significance is indicated with different lowercase letters (p < 0.05).
Discussion
This study marks pioneering work in identifying, sequencing, and characterizing the BSFL CTSL. The length of CTSL in organisms from vertebrates to arthropods typically ranges from 335 to 345 a.a. The BSFL CTSL generated in our study at 339 a.a. was consistent with that of other organisms. These similarities in sequence length emphasize the conservation of CTSL among different species. Note that variations in CTSL sequences exist between species and that CTSL recognition relies on unique protein motifs. The characteristic motifs ERFNIN, GNYD, and GCNGG are conserved features of CTSL in these species, representing the catalytic domain of cysteine proteases within the peptide C1A domain, which are also known as papain-like enzymes [46].
Characterized by the “R” residue, the uniqueness of the ERFNIN motif is a distinct feature found in Brachycera BSFL. In contrast, the EYFNIN and EWFNIN motifs are commonly found in nematodes and vertebrates, respectively. These changes in characteristic patterns may be attributed to evolutionary differences between species. Phylogenetic analysis further showed that CTSL in BSFL is closely related to Brachycera in Diptera, suggesting a potential functional homology with Brachycera.
The tissue distribution of CTSL in organisms often corresponds to their specific functions. In our study, we have provided insights into the localization of CTSL in BSFL. Our results revealed that CTSL was predominantly expressed in the intestine, with a strong IHC positive signal observed in the midgut. As the main site for nutrient digestion and absorption, the midgut in BSFL has unique luminal pH changes and specific morpho-functional characteristics [62, 63]. It also possesses a strongly acidic pH region with high enzymatic activity, suggesting a crucial role in defense by effectively eliminating pathogens ingested with the feeding substrate [51, 62, 64–66]. This is consistent with the presence of CTSL in the midgut, as observed in some other insects, such as Acyrthosiphon pisum, where CTSL plays a crucial role in food digestion and regulating immune responses during infection [67]. Moreover, CTSL purified from the midgut of Riptortus pedestris has potent antibacterial activity against Burkholderia [54].
Our study also revealed dynamic changes in CTSL expression at different stages of BSFL, with the highest expression levels observed in the fifth instar. This pattern is consistent with that in Bombyx mori, where CTSL exhibits different expression levels across larval instars, peaking at the fourth instar [68]. In Helicoverpa armigera, CTSL proteolytic activity is significantly higher during the fifth to sixth instar molt [43], and injections of CTSL inhibitors resulted in delayed molting from the fifth instar to the sixth instar. Interestingly, the fifth instar BSFL possesses an efficient defense system against infection [28]. This may explain the increased expression of CTSL in the fifth instar, suggesting a crucial role in defense mechanisms and molting at this developmental stage [28, 43]. The exact function of CTSL in BSFL requires further investigation.
In this study, we simulated pathogen invasion and examined the expression of CTSL under various conditions. Our observations indicate the rapid appearance of melanized spots on the cuticle after challenge with E. coli, coupled with a significant increase in CTSL mRNA expression levels after stimulation in all larval stages. This profile parallels the observed proteolytic activity assay. The Z-Phe-Arg-AMC was gradually cleaved by the BSFL extract after 3 h of E. coli stimulation. Although it was challenging to prove that Z-Phe-Arg-AMC is exclusively cleaved by CTSL, our observations suggest that CTSL abundant expression in the body. Therefore, CTSL might play a crucial role in the trial involving the cleavage of Z-Phe-Arg-AMC. However, further investigation is required to substantiate this perspective. This dynamic response suggests that CTSL levels fluctuate in response to environmental stimuli and help BSFL to better adapt to microbial-rich environments. CTSL not only passively degrades microorganisms in food but may also contribute to the regulation of the innate immune response. In addition to antibacterial activity [54, 57], CTSL also can modulate various immune pathways in insects. In citrus psyllids, knockdown experiments targeting CTSL led to substantial modifications within innate immune pathways, encompassing Toll, MyD88, IMD, Relish, Dorsal, Cactus, and FADD [55]. CTSL has been shown to play a crucial role in regulating innate immune responses through pathways involving Toll, MyD88, Tube, and Pelle.
Conclusion
We investigated the characteristics of CTSL in BSFL by cloning the CTSL gene using degenerate primers. CTSL emerged as a predominant molecule within the gut, primarily expressed in the midgut. Its presence was noticeable throughout different instars, with the highest mRNA expression observed during the fifth instar. Following E. coli stimulation, CTSL expression could be induced at the mRNA level, and the Z-Phe-Arg-AMC was cleaved by the BSFL extract. These results suggest that treating BSFL with CTSL may effectively manage diseases, boost BSFL immunity, and contribute to sustainability in circular agriculture.
Supporting information
M: Protein molecular weight marker; lane 1, total protein extracted from E. coli BL21 (DE3); lane 2: E. coli containing pET-24a-CTSL without IPTG induction; lane 3: E. coli containing pET-24a-CTSL with IPTG induction; lane 4: soluble protein; lane 5: inclusion bodies; lane 6: purified recombinant CTSL protein.
(TIF)
After the final immunization, antiserum was serially diluted, and the absorbance values were measured.
(TIF)
Data Availability
All relevant data are within the paper.
Funding Statement
The author(s) received no specific funding for this work.
References
- 1.Diener S, Studt Solano NM, Roa Gutiérrez F, Zurbrügg C, Tockner K. Biological Treatment of Municipal Organic Waste using Black Soldier Fly Larvae. Waste and Biomass Valorization. 2011;2(4):357–63. [Google Scholar]
- 2.Caruso D, Devic E, Subamia IW, Talamond P, Baras E. Technical handbook of domestication and production of diptera Black Soldier Fly (BSF) Hermetia illucens, Stratiomyidae: IRD editions; 2014. [Google Scholar]
- 3.Dortmans B, Diener S, Bart V, Zurbrügg C. Black soldier fly biowaste processing. 2nd, editor: Eawag: Swiss Federal Institute of Aquatic Science and Technology; 2017. [Google Scholar]
- 4.Oliveira F, Doelle K, List R, O’Reilly JR. Assessment of Diptera: Stratiomyidae, genus Hermetia illucens (L., 1758) using electron microscopy. Journal of Entomology and Zoology Studies. 2015;3(5):147–52. [Google Scholar]
- 5.Alvarez L. The Role of Black Soldier Fly, Hermetia illucens (L.) (Diptera: Stratiomyidae) in Sustainable Waste Management in Northern Climates 2012.
- 6.Dortmans B. Effect of the feeding regime on process parameters in a continuous black soldier fly larvae composting system: Environmental Science; 2015. [Google Scholar]
- 7.De Smet J, Wynants E, Cos P, Van Campenhout L. Microbial community dynamics during rearing of black soldier fly larvae (Hermetia illucens) and impact on exploitation potential. Applied and Environmental Microbiology. 2018;84(9):e02722–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Barros LM, Gutjahr ALN, Ferreira-Keppler RL, Martins RT. Morphological description of the immature stages of Hermetia illucens (Linnaeus, 1758)(Diptera: Stratiomyidae). Microscopy Research and Technique. 2019;82(3):178–89. [DOI] [PubMed] [Google Scholar]
- 9.Scieuzo C, Franco A, Salvia R, Triunfo M, Addeo NF, Vozzo S, et al. Enhancement of fruit byproducts through bioconversion by Hermetia illucens (Diptera: Stratiomyidae). Insect Science. 2023;30(4):991–1010. [DOI] [PubMed] [Google Scholar]
- 10.Surendra K, Tomberlin JK, van Huis A, Cammack JA, Heckmann L-HL, Khanal SK. Rethinking organic wastes bioconversion: Evaluating the potential of the black soldier fly (Hermetia illucens (L.))(Diptera: Stratiomyidae)(BSF). Waste Management. 2020;117:58–80. [DOI] [PubMed] [Google Scholar]
- 11.Gao Z, Wang W, Lu X, Zhu F, Liu W, Wang X, et al. Bioconversion performance and life table of black soldier fly (Hermetia illucens) on fermented maize straw. Journal of cleaner production. 2019;230:974–80. [Google Scholar]
- 12.Salomone R, Saija G, Mondello G, Giannetto A, Fasulo S, Savastano D. Environmental impact of food waste bioconversion by insects: Application of Life Cycle Assessment to process using Hermetia illucens. Journal of Cleaner Production. 2017;140:890–905. [Google Scholar]
- 13.Manurung R, Supriatna A, Esyanthi RR, Putra RE. Bioconversion of rice straw waste by black soldier fly larvae (Hermetia illucens L.): optimal feed rate for biomass production. J Entomol Zool Stud. 2016;4(4):1036–41. [Google Scholar]
- 14.Parra Paz AS, Carrejo NS, Gómez Rodríguez CH. Effects of larval density and feeding rates on the bioconversion of vegetable waste using black soldier fly larvae Hermetia illucens (L.),(Diptera: Stratiomyidae). Waste and biomass valorization. 2015;6:1059–65. [Google Scholar]
- 15.Fadhillah N, Bagastyo A. Utilization of Hermetia illucens larvae as a bioconversion agent to reduce organic waste. IOP Conference Series: Earth and Environmental Science 2020. [Google Scholar]
- 16.Guo H, Jiang C, Zhang Z, Lu W, Wang H. Material flow analysis and life cycle assessment of food waste bioconversion by black soldier fly larvae (Hermetia illucens L.). Science of The Total Environment. 2021;750:141656. [DOI] [PubMed] [Google Scholar]
- 17.Surendra K, Olivier R, Tomberlin JK, Jha R, Khanal SK. Bioconversion of organic wastes into biodiesel and animal feed via insect farming. Renewable energy. 2016;98:197–202. [Google Scholar]
- 18.Wang YS, Shelomi M. Review of black soldier fly (Hermetia illucens) as animal feed and human food. Foods. 2017;6(10):91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Barragan-Fonseca KB, Dicke M, van Loon JJA. Nutritional value of the black soldier fly (Hermetia illucens L.) and its suitability as animal feed—a review. Journal of Insects as Food and Feed. 2017;3(2):105–20. [Google Scholar]
- 20.Li Q, Zheng L, Cai H, Garza E, Yu Z, Zhou S. From organic waste to biodiesel: Black soldier fly, Hermetia illucens, makes it feasible. Fuel. 2011;90(4):1545–8. [Google Scholar]
- 21.Lee J, Kim YM, Park YK, Yang YC, Jung BG, Lee BJ. Black soldier fly (Hermetia illucens) larvae enhances immune activities and increases survivability of broiler chicks against experimental infection of Salmonella Gallinarum. Journal of Veterinary Medical Science. 2018;80(5):736–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Katya K, Borsra M, Ganesan D, Kuppusamy G, Herriman M, Salter A, et al. Efficacy of insect larval meal to replace fish meal in juvenile barramundi, Lates calcarifer reared in freshwater. International Aquatic Research. 2017;9(4):303–12. [Google Scholar]
- 23.Liu T, Klammsteiner T, Dregulo AM, Kumar V, Zhou Y, Zhang Z, et al. Black soldier fly larvae for organic manure recycling and its potential for a circular bioeconomy: A review. Science of the Total Environment. 2022:155122. doi: 10.1016/j.scitotenv.2022.155122 [DOI] [PubMed] [Google Scholar]
- 24.Newton G, Sheppard D, Watson D, Burtle G, Dove C, Tomberlin J, et al., editors. The black soldier fly, Hermetia illucens, as a manure management/resource recovery tool. Symposium on the state of the science of Animal Manure and Waste Management; 2005. [Google Scholar]
- 25.Moruzzo R, Mancini S, Guidi A. Edible Insects and Sustainable Development Goals. Insects. 2021;12(6):557. doi: 10.3390/insects12060557 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Joosten L, Lecocq A, Jensen AB, Haenen O, Schmitt E, Eilenberg J. Review of insect pathogen risks for the black soldier fly (Hermetia illucens) and guidelines for reliable production. Entomologia Experimentalis et Applicata. 2020;168(6–7):432–47. [Google Scholar]
- 27.Elhag O, Zhou D, Song Q, Soomro AA, Cai M, Zheng L, et al. Screening, expression, purification and functional characterization of novel antimicrobial peptide genes from Hermetia illucens (L.). PloS one. 2017;12(1):e0169582. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Tourtois J, Ali JG, Grieshop MJ. Susceptibility of wounded and intact black soldier fly Hermetia illucens (L.)(Diptera: Stratiomyidae) to entomopathogenic nematodes. Journal of invertebrate pathology. 2017;150:121–9. [DOI] [PubMed] [Google Scholar]
- 29.von Bredow YM, Müller A, Popp PF, Iliasov D, von Bredow CR. Characterization and mode of action analysis of black soldier fly (Hermetia illucens) larva-derived hemocytes. Insect Science. 2022;29(4):1071–95. [DOI] [PubMed] [Google Scholar]
- 30.Xia J, Ge C, Yao H. Antimicrobial peptides from black soldier fly (Hermetia illucens) as potential antimicrobial factors representing an alternative to antibiotics in livestock farming. Animals. 2021;11(7):1937. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Scieuzo C, Giglio F, Rinaldi R, Lekka ME, Cozzolino F, Monaco V, et al. In Vitro Evaluation of the Antibacterial Activity of the Peptide Fractions Extracted from the Hemolymph of Hermetia illucens (Diptera: Stratiomyidae). Insects. 2023;14(5):464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Park SI, Kim JW, Yoe SM. Purification and characterization of a novel antibacterial peptide from black soldier fly (Hermetia illucens) larvae. Developmental & Comparative Immunology. 2015;52(1):98–106. [DOI] [PubMed] [Google Scholar]
- 33.Di Somma A, Moretta A, Cané C, Scieuzo C, Salvia R, Falabella P, et al. Structural and functional characterization of a novel recombinant antimicrobial peptide from Hermetia illucens. Current Issues in Molecular Biology. 2021;44(1):1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Sultana A, Luo H, Ramakrishna S. Harvesting of antimicrobial peptides from insect (Hermetia illucens) and its applications in the food packaging. Applied Sciences. 2021;11(15):6991. [Google Scholar]
- 35.Choi WH, Yun JH, Chu JP, Chu KB. Antibacterial effect of extracts of Hermetia illucens (Diptera: S tratiomyidae) larvae against Gram-negative bacteria. Entomological research. 2012;42(5):219–26. [Google Scholar]
- 36.Lee KS, Yun EY, Goo TW. Antimicrobial activity of an extract of Hermetia illucens larvae immunized with Lactobacillus casei against Salmonella species. Insects. 2020;11(10):704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Shin HS, Park SI. Novel attacin from Hermetia illucens: cDNA cloning, characterization, and antibacterial properties. Preparative Biochemistry and Biotechnology. 2019;49(3):279–85. [DOI] [PubMed] [Google Scholar]
- 38.Hoffmann JA. The immune response of Drosophila. Nature. 2003;426(6962):33–8. doi: 10.1038/nature02021 [DOI] [PubMed] [Google Scholar]
- 39.Hillyer JF. Insect immunology and hematopoiesis. Developmental & Comparative Immunology. 2016;58:102–18. doi: 10.1016/j.dci.2015.12.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Zdybicka-Barabas A, Bulak P, Polakowski C, Bieganowski A, Waśko A, Cytryńska M. Immune response in the larvae of the black soldier fly Hermetia illucens. Invertebrate Survival Journal. 2017;14(1):9–17. [Google Scholar]
- 41.Jensen A, Lecocq A. Diseases of black soldier flies Hermetia illucens L. a future challenge for production? Journal of Insects as Food and Feed. 2023:1–4. [Google Scholar]
- 42.Saikhedkar N, Summanwar A, Joshi R, Giri A. Cathepsins of lepidopteran insects: Aspects and prospects. Insect biochemistry and molecular biology. 2015;64:51–9. doi: 10.1016/j.ibmb.2015.07.005 [DOI] [PubMed] [Google Scholar]
- 43.Liu J, Shi GP, Zhang W, Zhang G, Xu W. Cathepsin L function in insect moulting: molecular cloning and functional analysis in cotton bollworm, Helicoverpa armigera. Insect Molecular Biology. 2006;15(6):823–34. [DOI] [PubMed] [Google Scholar]
- 44.Yang H, Zhang R, Zhang Y, Liu Q, Li Y, Gong J, et al. Cathepsin-L is involved in degradation of fat body and programmed cell death in Bombyx mori. The Faculty of the Department of Biology: Western Kentucky University; 2020. [DOI] [PubMed] [Google Scholar]
- 45.Dana D, Pathak SK. A review of small molecule inhibitors and functional probes of human cathepsin L. Molecules. 2020;25(3):698. doi: 10.3390/molecules25030698 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Turk V, Stoka V, Vasiljeva O, Renko M, Sun T, Turk B, et al. Cysteine cathepsins: from structure, function and regulation to new frontiers. Biochim Biophys Acta. 2012;1824(1):68–88. doi: 10.1016/j.bbapap.2011.10.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Homma K, Natori S. Identification of substrate proteins for cathepsin L that are selectively hydrolyzed during the differentiation of imaginal discs of Sarcophaga peregrina. European journal of biochemistry. 1996;240(2):443–7. [DOI] [PubMed] [Google Scholar]
- 48.Dong Q. Functional Characterization of a Cathepsin L in Drosophila Melanogaster 2015.
- 49.Wang L, Chai L, He H, Wang Q, Wang J, Zhao X. A cathepsin L-like proteinase is involved in moulting and metamorphosis in Helicoverpa armigera. Insect molecular biology. 2010;19(1):99–111. [DOI] [PubMed] [Google Scholar]
- 50.Sun YX, Tang L, Wang P, Abbas MN, Tian JW, Zhu BJ, et al. Cathepsin L-like protease can regulate the process of metamorphosis and fat body dissociation in Antheraea pernyi. Developmental & Comparative Immunology. 2018;78:114–23. [DOI] [PubMed] [Google Scholar]
- 51.Cristofoletti PT, Ribeiro AF, Deraison C, Rahbé Y, Terra WR. Midgut adaptation and digestive enzyme distribution in a phloem feeding insect, the pea aphid Acyrthosiphon pisum. Journal of Insect Physiology. 2003;49(1):11–24. [DOI] [PubMed] [Google Scholar]
- 52.Kawasaki H, Manickam A, Shahin R, Ote M, Iwanaga M. Expression of matrix metalloproteinase genes during basement membrane degradation in the metamorphosis of Bombyx mori. Gene. 2018;638:26–35. [DOI] [PubMed] [Google Scholar]
- 53.Sun YX, Chen C, Xu WJ, Abbas MN, Mu FF, Ding WJ, et al. Functions of Bombyx mori cathepsin L-like in innate immune response and anti-microbial autophagy. Developmental & Comparative Immunology. 2021;116:103927. [DOI] [PubMed] [Google Scholar]
- 54.Byeon JH, Seo ES, Lee JB, Lee MJ, Kim JK, Yoo JW, et al. A specific cathepsin-L-like protease purified from an insect midgut shows antibacterial activity against gut symbiotic bacteria. Developmental & Comparative Immunology. 2015;53(1):79–84. doi: 10.1016/j.dci.2015.06.003 [DOI] [PubMed] [Google Scholar]
- 55.Yu HZ, Huang YL, Li NY, Xie YX, Zhou CH, Lu ZJ. Potential roles of two Cathepsin genes, DcCath-L and DcCath-O in the innate immune response of Diaphorina citri. Journal of Asia-Pacific Entomology. 2019;22(4):1060–9. [Google Scholar]
- 56.Sheppard D, Tomberlin J, Joyce J, Kiser B, Sumner S. Rearing methods for the black soldier fly (Diptera: Stratiomyidae). Journal of medical entomology. 2002;39(4):695–8. doi: 10.1603/0022-2585-39.4.695 [DOI] [PubMed] [Google Scholar]
- 57.Chiang YR, Wang LC, Lin HT, Lin JHY. Bioactivity of orange-spotted grouper (Epinephelus coioides) cathepsin L: Proteolysis of bacteria and regulation of the innate immune response. Fish & Shellfish Immunology. 2022;122:399–408. [DOI] [PubMed] [Google Scholar]
- 58.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods. 2001;25(4):402–8. [DOI] [PubMed] [Google Scholar]
- 59.Werle B, Staib A, Jülke B, Ebert W, Zladoidsky P, Sekirnik A, et al. Fluorometric microassays for the determination of cathepsin L and cathepsin S activities in tissue extracts. Journal of Biological Chemistry. 1999;380(9):1109–16. doi: 10.1515/BC.1999.138 [DOI] [PubMed] [Google Scholar]
- 60.Pyati PS, Bell HA, Fitches E, Price DR, Gatehouse AM, Gatehouse JA. Cathepsin L-like cysteine proteinase (DcCathL) from Delia coarctata (wheat bulb fly): basis of insecticidal activity. Insect biochemistry and molecular biology. 2009;39(8):535–46. [DOI] [PubMed] [Google Scholar]
- 61.Philip JM, Fitches E, Harrison RL, Bonning B, Gatehouse JA. Characterisation of functional and insecticidal properties of a recombinant cathepsin L-like proteinase from flesh fly (Sarcophaga peregrina), which plays a role in differentiation of imaginal discs. Insect biochemistry and molecular biology. 2007;37(6):589–600. [DOI] [PubMed] [Google Scholar]
- 62.Bonelli M, Bruno D, Caccia S, Sgambetterra G, Cappellozza S, Jucker C, et al. Structural and functional characterization of Hermetia illucens larval midgut. Frontiers in Physiology. 2019;10:204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Kim W, Bae S, Park K, Lee S, Choi Y, Han S, et al. Biochemical characterization of digestive enzymes in the black soldier fly, Hermetia illucens (Diptera: Stratiomyidae). Journal of Asia-Pacific Entomology. 2011;14(1):11–4. [Google Scholar]
- 64.Lemos FJ, Terra WR. Digestion of bacteria and the role of midgut lysozyme in some insect larvae. Comparative Biochemistry and Physiology Part B: Comparative Biochemistry. 1991;100(2):265–8. doi: 10.1016/0305-0491(91)90372-k [DOI] [PubMed] [Google Scholar]
- 65.Lemos FJ, Ribeiro AF, Terra WR. A bacteria-digesting midgut-lysozyme from Musca domestica (Diptera) larvae. Purification, properties and secretory mechanism. Insect biochemistry and molecular biology. 1993;23(4):533–41. [Google Scholar]
- 66.Padilha MH, Pimentel AC, Ribeiro AF, Terra WR. Sequence and function of lysosomal and digestive cathepsin D-like proteinases of Musca domestica midgut. Insect Biochemistry and Molecular Biology. 2009;39(11):782–91. [DOI] [PubMed] [Google Scholar]
- 67.Renoz F, Noël C, Errachid A, Foray V, Hance T. Infection dynamic of symbiotic bacteria in the pea aphid Acyrthosiphon pisum gut and host immune response at the early steps in the infection process. PLoS One. 2015;10(3):e0122099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Pan G, Zhang K, Li C, Hu X, Kausar S, Gu H, et al. A hemocyte-specific cathepsin L-like cysteine protease is involved in response to 20-hydroxyecdysone and microbial pathogens stimulation in silkworm, Bombyx mori. Molecular Immunology. 2021;131:78–88. [DOI] [PubMed] [Google Scholar]







