Expression of BSN314 lysozyme genes in Escherichia coli BL21: a study to demonstrate microbicidal and disintegarting potential of the cloned lysozyme

Abstract

This study is an extension of our previous studies in which the lysozyme was isolated and purified from Bacillus subtilis BSN314 (Naveed et al., 2022; Naveed et al., 2023). In this study, the lysozyme genes were cloned into the E. coli BL21. For the expression of lysozyme in E. coli BL21, two target genes, Lyz-1 and Lyz-2, were ligated into the modified vector pET28a to generate pET28a-Lyz1 and pET28a-Lyz2, respectively. To increase the production rate of the enzyme, 0.5-mM concentration of IPTG was added to the culture media and incubated at 37 °C and 220 rpm for 24 h. Lyz1 was identified as N-acetylmuramoyl-L-alanine amidase and Lyz2 as D-alanyl-D-alanine carboxypeptidase. They were purified by multi-step methodology (ammonium sulfate, precipitation, dialysis, and ultrafiltration), and antimicrobial activity was determined. For Lyz1, the lowest MIC/MBC (0.25 μg/mL; with highest ZOI = 22 mm) were recorded against Micrococcus luteus, whereas the highest MIC/MBC with lowest ZOI were measured against Salmonella typhimurium (2.50 μg /mL; with ZOI = 10 mm). As compared with Aspergillus oryzae (MIC/MFC; 3.00 μg/mL), a higher concentration of lysozyme was required to control the growth of Saccharomyces cerevisiae (MIC/MFC; 50 μg/mL). Atomic force microscopy (AFM) was used to analyze the disintegrating effect of Lyz1 on the cells of selected Gram-positive bacteria, Gram-negative bacteria, and yeast. The AFM results showed that, as compared to Gram-negative bacteria, a lower concentration of lysozyme (Lyz1) was required to disintegrate the cell of Gram-positive bacteria.

Supplementary Information

The online version contains supplementary material available at 10.1007/s42770-023-01219-4.

Highlights

• To achieve the highest lysozyme production, the genes were expressed in E. coli BL21.

• Genes, Lyz-1 (N-acetylmuramoyl-L-alanine amidase) and Lyz-2 (D-alanyl-D-alanine carboxypeptidase), were introduced.

• Lyz1 showed the highest antimicrobial activity, whereas Lyz2 had the lowest.

• The disintegrating effect of bacteria and yeast has been indicated by AFM analysis.

• Lyz1 can cleave amide bond between glycan and peptide components of the peptidoglycan.

Graphical abstract

Supplementary Information

The online version contains supplementary material available at 10.1007/s42770-023-01219-4.

Introduction

Lysozyme is a naturally occurring enzyme found abundantly in bodily secretions such as milk, saliva, tears of mammals, and avian albumen. Its occurrence is broad, ranging from microorganisms (such as bacteria and fungi) to plants, animals, and human body secretions and tissues. Depending on its source, lysozyme is categorized into six subgroups: chicken-type lysozyme (c-type), goose-type lysozyme (g-type), T4 phage lysozyme (phage-type), invertebrate lysozyme (i-type), bacterial lysozyme, and plant lysozyme [10, 11, 46, 48, 62, 81, 117]. Lysozyme is a molecule of innate immunity that plays an important role in the host’s protective immune system against invasive microbial infections [38]. Its role against bacterial pathogens can promote lysis of bacterial cell walls by catalyzing β-(1,4)-glycosidic binding between N-acetylmuramic acid and N-acetylglucosamine in the peptidoglycan layer [10, 38, 76, 95]. Lysozyme hydrolyzes the cell wall of bacteria and leads to the bursting of both Gram-positive and Gram-negative bacterial cells. However, the bactericidal effect of lysozyme is higher in Gram-positive bacteria than in Gram-negative bacteria because the cell wall of Gram-positive bacteria consists of 90% peptidoglycan and is therefore easily damaged, whereas the outer membrane of Gram-negative bacteria restricts the enzyme’s access to the peptidoglycan layer due to the outer lipid layer. Some examples of bactericidal potential against Gram-positive pathogens are B. subtilis, B. cereus, S. aureus, M. luteus, and L. innocua. Against Gram-negative pathogens are E. coli, P. aeruginosa, S. typhi, etc. [4, 9, 25, 59, 77]. Due to its significant role as an antimicrobial agent, lysozyme has gained importance in pharmaceutical and food industries [76, 77, 115].

Lysozyme is isolated via genetically modified animals, plants, and some other natural resources such as papaya juice, avian eggs, human tears, human, and cow milk [33, 50, 58]. Although lysozyme obtained from natural sources is simple, the quality and production rate of lysozyme obtained from natural resources are poor (Naidu, 2000). Recent research has shown that the application of various methods such as fermentation can improve the quality of lysozyme and the production rate. This not only overcomes the problem of raw material limitation but also enables continuous industrial production at low cost (Naidu, 2000,[69]. Isolation of lysozyme from microorganisms is widely used nowadays, and it is a simple method to obtain a natural enzyme. There are some species of bacteria from which lysozyme has been isolated: Streptomyces griseus, Enterococcus hirae, and Arthrobacter crystallopoietes. Among all bacterial species, the genus Bacillus is considered the champion for the highest enzyme production. Literature indicates that Bacillus subtilis, Bacillus licheniformis and Bacillus amyloliquefaciens have excellent fermentation properties and can produce high yields (20 to 25 g/L) which are completely free of toxic byproducts [43, 76, 101, 102]. B. subtilis has been studied extensively over many years and is considered safe for human use. B. subtilis strains are able to secrete (produce) the enzymes in high yields, so researchers are increasingly interested in the secretome, which includes both the secreted proteins and the protein secretion machinery of the microorganisms. The protein/lysozyme isolated from B. subtilis has also significant activity against pathogenic microbes [22, 32, 76, 82, 98].

Since lysozyme acts as a non-specific molecule of innate immunity against the invasion of bacterial pathogens and catalyzes the degradation of bacterial cell walls, therefore, its demand in the pharmaceutical industry is increasing. However, the fermentation method is not sufficient to produce the enzyme in large quantities. Therefore, new methods/systems for mass production of lysozyme need to be introduced to meet the industry demand. Researchers have introduced a new tool in biotechnology, the biological expression system, which is more suitable for the mass production of proteins to meet industrial demand [37, 87]. Lysozyme production can be enhanced by various biological expression systems, including bacterial, yeast, and mold expression systems [7, 56, 95, 107, 114]. However, the yeast and mold expression systems have some disadvantages, i.e., they contain a large number of proteases to degrade proteins and their conversion efficiency is low. With these systems, it is not easy to produce lysozyme in high yield and with significant biological activity [49, 51, 79]. Therefore, the bacterial expression system, especially the E. coli expression system, is preferred for gene cloning because it introduces DNA molecules into cells with high efficiency, has well-characterized genetics, grows rapidly on low-cost substrates, and can express proteins at very high levels [19, 115].

However, the E. coli expression system also has some disadvantages; e.g., it is a pathogenic bacterium and contains endotoxins [3, 84]. By adapting some purification techniques, pathogenicity can be eliminated by removing toxins,e.g., bacteriophage T4 lysozyme was purified from overexpressing recombinant E. coli strains using Ni chelate affinity chromatography technique [5, 12, 31]. Therefore, the E. coli expression system is widely used in genetic engineering because it has short culture cycles, low cost, and ease of use. The recombinant proteins isolated and purified from E. coli expression system also show significant antimicrobial activity against various pathogens. Therefore, the use of this expression system can be very beneficial for the production of enzymes/proteins on an industrial scale [60, 89, 116].

This work is part of our previous studies in which the lysozyme was isolated and purified from Bacillus subtilis BSN314 [76],Naveed 2023). In this study, the lysozyme genes (isolated from Bacillus subtilis BSN314) were cloned in an E. coli strain. To achieve the highest lysozyme production, the E. coli expression system was used. Unfortunately, the use of E. coli for lysozyme cloning has some limitations; e.g., the expression of soluble lysozyme in E. coli leads to rapid cell lysis and low product yield. The enzyme can be produced as an insoluble and inactive inclusion body. To increase the yield and solubility of the protein/lysozyme and overcome these limitations, some strategies were applied in the present study, such as using a modified vector (pET28a), using a modified host strain (E. coli BL21), and addition of the inducer, isopropyl-β-D-thiogalactopyranoside (IPTG), to induce expression of the cloned genes. The main focus of this study is to apply different strategies for gene expression in E. coli with maximum production of potential lysozyme. After optimized production, the final product of these cloned genes (enzymes) was obtained and was purified by multi-step methodology (ammonium sulfate, precipitation, dialysis, and ultrafiltration). The antimicrobial and enzymatic activities of the purified lysozymes were determined. Atomic force microscopy (AFM) was also used to analyze the disintegrating effect of the cloned lysozyme on the microbial cells. For the confirmation of protein size gel electrophoresis and for molecular weight SDS-PAGE techniques were applied in the present study.

Materials and methods

Experimental reagents and chemicals

Analytical-grade sodium chloride (≥ 99.5%), ammonium sulfate (≥ 99.0%), sodium dihydrogen phosphate dodecahydrate (≥ 99.0%), disodium phosphate (≥ 99.0%), sodium hydroxide (≥ 98.0%), ethanol, 5 × protein loading buffer, and glacial acetic acid were purchased from Beijing Chemical Plant, and agar (biological grade) was provided by CHEMBASE company. While yeast extract PL0021 (biological grade) and soy peptone (biological grade) were purchased from Beijing Boxing Biotechnology Co., Ltd. Kanamycin, isopropyl β-D-1-thiogalactopyranoside (IPTG), and agarose gel electrophoresis were purchased from Biotop company. Loading buffer, DNA Marker DL 2000, and DL 5000 were purchased from Beijing Zhuangmeng International Biogenomics Division Technology Co., Ltd.

The protein marker was purchased from Thermo Fisher Scientific, while nucleic acid dye T4 was from Takara company. DNA ligase, BamHI (restriction enzyme), XhoI (restriction enzyme), and DNA agarose gel recovery kit were purchased from OMEGA company. TIANamp Bacteria DNA Kit (DP302) was purchased from Tiangen Biotech (Beijing) Co., Ltd., while analytical-grade agarose was from Biowest, and an SDS-PAGE kit was purchased from Beijing Zhuangmeng International Biogenomics Division Technology Co.

Equipments used

Analytical balance (model no. BSA 224S), which was used in this present research, was manufactured by Sartorius Scientific Instruments (Beijing) Co., Ltd. Ultra-clean worktable (SW-CJ-1FD) was made by Sujing Group Suzhou Antai Airtech Co., Ltd. High-pressure steam autoclave (model no. HVA-110) was made by Hirayama, Japan, while pH meter (model no. FE20) equipped with Lab Pure Pro-ISM probe was made by Mettler-Toledo Instruments Shanghai Co., Ltd., and the visible spectrophotometer (model no. 722) was made by Shanghai Jinghua Science and Technology Instruments Co., Ltd. The mini spin centrifuge (model Eppendorf AG 2231) was made by Germany.

Nucleic acid electrophoresis apparatus (model no. DYY-6C) was produced by the Beijing Liuyi instrument factory, and gel imaging system (model no. UVP BioSpectrum 510) was provided by Ultra-Violet Products Ltd., Cambridge, UK. Bench shaking incubator (model no. IFORS AG CH-4103) was made in Bottmingen, Switzerland, and the thermal cycler type PCR (model no. S1000) instrument was made by Bio-Rad. Microwave digestion system (model no.910980) was provided by Hirayama, and the protein electrophoresis system was made by Bio-Rad.

Ice maker (model no. FM40) was manufactured by snow ice–making company, while ultrasonic disruptor was manufactured by Galanz. Benchtop refrigerated centrifuge (model no. CT15RE) was made by Hitachi, while the biochemical incubator (model Bluepard) was manufactured by Shanghai Yiheng Scientific Instruments Co., Ltd. Magnetic stirrer (Model RCTBS025 IKA) was manufactured by Beijing Boya Red Star Biotechnology Co., Ltd. Decoloring shaker was made by Beijing Liuyi instrument factory. Atomic force microscopy Nanoscope IIIa with J-scanner (Zetasizer Nano Series Malvern Pananalytical Ltd, UK).

Preparation of solutions

Kanamycin solution was prepared by weighing the kanamycin powder to obtain a mother liquor of 50 mg/mL. For the addition of kanamycin solution into the growth culture, by dilution, the final 50 µL/mL kanamycin solution was prepared from the mother solution. One percent agarose gel (without dye) was prepared by adding 1 g of agarose powder to 100 mL of 1 × TAE (Tris–acetate-EDTA) solution and dissolved by heating in a microwave. The agarose gel electrophoresis buffer was prepared by adding 24.2 g Tris, 5.7 mL glacial acetic acid, 10 mL 0.5 mol EDTA, and finally adding deionized water to a volume of 100 mL.

A 5 × Tris–glycine buffer solution was prepared by adding the 15.1 g Tris, 94 g glycine, and 5 g of SDS into 1 L of ionized water mixed well and stored at room temperature. PB (phosphate buffer) was made by adding of 4.370 g of disodium hydrogen phosphate dodecahydrate, 1.217 g of sodium dihydrogen phosphate dihydrate, into 1 L of deionized water (H₂O); to set the pH 7.0, the 20 mM phosphoric acid was used. While the phosphate-buffered saline (PBS) was made by mixing of 2.185 g disodium hydrogen phosphate dodecahydrate, 0.609 g sodium dihydrogen phosphate dihydrate, and 29.220 g sodium chloride, into 0.5L deionized water (H₂O). The pH was set on 7.0. by using 20 mM phosphoric acid.

The blue staining solution (Coomassie brilliant) was formulated by mixing well 25 mL of isopropanol, 0.1 g Coomassie brilliant blue R-250, and 10 mL of glacial acetic acid and make a constant volume of 100 mL. While the decolorizing solution (Coomassie brilliant blue) staining was prepared with 50 mL ethanol, 100 mL acetic acid and, 850 mL deionized water (H₂O) was added mixed well, stored at room temperature. Agarose gel electrophoresis buffer was prepared by mixing 10 mL of 0.5 mol EDTA, 24.2 g Tris, and 5.7 mL glacial acetic acid; to make a volume of 100 mL, the deionized water was added.

Media preparation

Luria–Bertani (LB) medium was prepared by adding 1 g of peptone, 0.5 g of yeast extract, and 1 g of sodium chloride in 100 mL of deionized water containing the appropriate antibiotic. The cultures were incubated in 250-mL conical flasks containing 50 mL of culture broth on a rotary shaker at 220 rpm and 37 °C for 12 h. Luria agar (LA) solid medium (100 mL) was prepared by mixing 0.5 g yeast extract, 2 g agar, 1 g peptone, and 1 g sodium chloride in 100 mL deionized water and adjusting the pH to 7.0 with 1.2 M HCl solution [77].

Normal liquid (LB) and solid (LA) media were used for Micrococcus lysodeikticus (Micrococcus luteus). Liquid medium was prepared by mixing 1 g peptone, 0.4 g beef extract, and 0.5 g sodium chloride in 100 mL deionized water, while solid medium was prepared by adding 1 g peptone, 0.4 g beef extract, 0.5 g sodium chloride, and 1.5 g agar in 100 mL deionized water. After media preparation, all the media were autoclaved at 15 psi, from 121 to 124 °C for 15 min [66, 76].

Bacterial strains

Bacillus subtilis BSN314 (a previously isolated lysozyme-based strain) and Micrococcus lysodeikticus (Micrococcus luteus) were stored in our laboratory at − 80 °C. E. coli Top10 strain served as the host for the genes isolated from Bacillus subtilis BSN314. The main purpose of E. coli Top10 is the subsequent propagation of the gene for cloning and transfection. After cloning, both were transformed into the desired strain E. coli BL21. This strain served as the host, and the genes isolated in our previous study [76] were transformed to it. E. coli Top10, preserved in our laboratory, and E. coli BL21 (DE3) competent cells were purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd, respectively. Plasmid pET28a was purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd.

Vector construction and polymerase chain reaction (PCR)

In our previous study [77], the protein sequencing of Lyz1 and Lyz2 was determined. In the present study, the same protein sequences were used. Therefore, the primers (Lyz1F, Lyz1R and Lyz2F, Lyz2R) were designed (Table 1) to obtain the corresponding nucleic acid sequence. Polymerase chain reaction (PCR) was used to amplify the lysozyme gene from the chromosomal DNA of B. subtilis BSN314 using gene-specific primers. The primers and plasmids used in this study are summarized in Table 1. PCR in vitro amplification involves several steps, the conditions of which are listed in Table 2. The lysozyme genes were amplified, purified, and inserted into the pET28a vector. In the present study, pET28a vector was used to transform and express the lysozyme-based gene. pET28a vector was purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd. The restriction enzymes BamHI and XhoI were introduced into the primers Lyz1F, Lyz1R and Lyz2F, Lyz2R for ligation into the pET28a vector to form pET28a-Lyz1 and pET28a-Lyz2, respectively (given in supplementary material; Fig S1). After amplification, for the determination of gene size, the resulting PCR products were analyzed by gel electrophoresis (supplementary material; Fig S2).

Table 1.

Primers sequences with restriction sites (underlined sequences; BamHI and XhoI) of both recombinant vectors/plasmids (pET28a-Lyz1 and pET28a-Lyz2)

Primer	Sequences	Restriction sites	Plasmids
Lyz1-F	5′ ATGGGGGGATCCATGGTGAACATTATTCAAGAC3′	BamHI	pET28a-Lyz1
Lyz1-R	5′ ATACTCGAGTCAGCTTAATTGCGCTGCAATCTT3 ′	XhoI
Lyz2-F	5′ GCGGGATCCTTGAACATCAAGAAATGTAA3 ′	BamHI	pET28a-Lyz2
Lyz2-R	5′ ATACTCGAGTTAAAACCAGCCGGTTACTG3′	XhoI

Table 2.

Steps and conditions with time duration for the thermocycler of polymerase chain reaction (PCR)

Steps	Temperature (°C)	Time (min)	Number of cycle
Pre-denaturation	94	5	1
Denaturation	94	1	30
Primer annealing	57	0.5	30
Extension	72	1	30
Final extension	72	10	1

Identification of amplified genes by the Basic Local Alignment Search Tool (BLAST)

The Basic Local Alignment Search Tool (BLAST) is the most commonly used tool for determining gene sequencing [67]. To confirm that these genes (amplified by PCR) have the same sequencing, which was confirmed in our previous study [77], the gene sequence obtained by PCR was compared with the NCBI database using the Basic Local Alignment Search Tool (BLAST). The BLAST technique confirmed the similarity of the gene sequences amplified by PCR (Lyz1 and Lyz2) with the corresponding protein sequences determined in our previous study [77].

Gel electrophoresis

The nucleic acid electrophoresis instrument (model no. DYY-6C) was used for sequence-specific separation of PCR products. Agarose gel electrophoresis is used for separation (by size), quantification, and purification of nucleic acid fragments using DNA ladders. To prepare a 1% agarose gel, add 1 g of agarose to 100 mL of Tris–acetate-EDTA buffer (TAE), mix well, and heat the solution in a microwave to dissolve the agarose and obtain a homogeneous mixture. After cooling at 500 C, add 4 µL of ethidium bromide to the dissolved agarose.

The mixed agarose solution was poured into the gel tray; an appropriate comb was inserted and allowed to solidify at room temperature. The gel tray was placed in the electrophoresis chamber and filled with sufficient electrophoresis buffer (1X TAE) to cover the gel and prevent overheating during the experiment. The DNA ladder DL 5000 and samples were loaded onto the gel and allowed to run at 115 V for approximately 25 min. The gel imaging system (model no. UVP BioSpectrum 510) was used for gel imaging, comparison, and analysis with DNA markers. All images were analyzed using Gel-Pro Analyzer 3.1 (v.3.1; Exon–Intron) [26]. The construction of the two vectors pET281-Lyz1 and pET28a-Lyz2 and their products after PCR amplification as well as the recombinant plasmids (pET28a-Lyz1 and pET28a-Lyz2) were confirmed using the same method.

Multiplication and confirmation of plasmids

E. coli Top10 is ideal for highly efficient cloning and plasmid propagation/multiplication because it allows stable replication of high-copy number plasmids. After the plasmids (pET28a-Lyz1 and pET28a-Lyz2) were constructed, they were introduced into E. coli Top10. The prokaryotic expression vector pET28a contained kanamycin as a resistance gene. The concentration of 50 µL/mL kanamycin solution was also added to the culture medium. Only the E. coli Top10 cells containing recombinant plasmids (pET28a-Lyz1 and pET28a-Lyz2) were survived. To confirm that the surviving plasmids were the same as those transformed in E. coli Top10, the size of the surviving recombinant plasmids (pET28a-Lyz1 and pET28a-Lyz2) was analyzed by gel electrophoresis. Once the size of the plasmids (Lyz1 and Lyz2) was confirmed, they were transformed into the desired strain E. coli BL21 for cloning and final fermentation to achieve the desired lysozyme yield.

Expression of lysozyme genes in E. coli BL21

After confirmation of the size of the recombinant plasmids (pET28a-Lyz1 and pET28a-Lyz2) by gel electrophoresis, they were transformed into the E. coli BL21, and it was incubated for 12 h at 37 °C and 220 rpm. After 12 h, the separated colonies of the E. coli BL21 strain (pET28a-Lyz1 and pET28a-Lyz2) were collected and transferred to another LB medium (100 mL), which was incubated at 37 °C until the optical density (OD) reached approximately 0.6. At this stage, isopropyl-β-D-1-thiogalactopyranoside (IPTG) was added at a final concentration of 0.5 mM to induce expression. The E. coli BL21 culture was then incubated for 12 h at 37 °C and at the shaking speed of 220 rpm.

Isolation and purification of the cloned lysozymes

After fermentation, the broth culture of E. coli BL21 (with recombinant plasmids; Lyz1 and Lyz2) was centrifuged at 8000 rpm for 20 min. The supernatant was discarded, and the pellets were re-suspended in 10 mL of PBS containing 20 mM pH 7.0 and washed two to three times with PBS. Now these pellets (cells) were crushed with an ultrasonic grinder for about 30 min until they were clear, and centrifuged again at 8000 rpm min at 4 °C, and the supernatant was collected. The supernatant was further processed using the following methods: ammonium sulfate precipitation, dialysis, ultrafiltration, and gel column chromatography. These methods were developed for this study to obtain a maximum and a highly potential content of cloned lysozyme.

Ammonium sulfate precipitation method

The isolation of lysozyme was performed as described in our previous study [77]. This method started with the slow addition of solid powdered ammonium sulfate to the fermented supernatant of E. coli BL21 (at 4 °C). A magnetic stirrer was used to increase the saturation of the ammonium sulfate. As it was observed in our previous study [77] that 70% ammonium sulfate solution gave the maximum lysozyme product, in this study, we used the same ammonium sulfate concentration (70%) to obtain the maximum product (lysozyme). Subsequently, the protein solution (70% ammonium sulfate and supernatant of E. coli BL21) was centrifuged at 1000 rpm for 30 min under refrigerated conditions, and the mixture solution was carefully collected and dissolved in phosphate buffer (PB) solution.

Desalination by dialysis

The protein solution contained ammonium sulfate, which was removed by the dialysis bag method [77]. A 15-cm dialysis bag was taken, boiled with 2% sodium bicarbonate and 1 mmol/L EDTA solution for 10 min, and then rinsed with deionized water. The dialysis bag was closed with a clip, and the precipitation solution obtained in the previous step was poured into the dialysis bag while the air clip was sealed at the other end. The bag was immersed in 2 L of deionized water, stirred slowly with a magnetic stirrer, and dialyzed for 24 h at 4 °C. The dialysis bag was changed every 6 h to improve and accelerate the dialysis rate. The dialysate was used as crude extract for further purification.

Ultrafiltration (UF) tube (10 kDa)

In this method, the lysozyme product was concentrated using an ultrafiltration (UF) 10 kDa tube (Ultra-15; Millipore Amicon, Bedford, MA, USA) [77]. The UF 10 kDa tube was first soaked with 0.2 mol/L sodium hydroxide for 20 min and then with deionized water for 6 h. Following the pretreatment, a small amount of deionized water was added to the UF 10 kDa tube and centrifuged at 4000 rpm and 4 °C for 10 min. The supernatant was used for further experiment. The centrifugation was repeated until the solubilization of the protein reached a maximum. When the supernatant reached approximately 3 mL, this step was terminated. This ultra-purified product was used for a further antimicrobial assay and atomic force microscopy (AFM) analysis. For the determination of peptides and their chemical composition, the ultra-purified product was further processed by gel column chromatography.

Gel column chromatography

For further purification, an AKTA Purifier 25 system (Amersham Bioscience, Piscataway, NJ, USA) was used to isolate lysozyme. The sample (10 kDa) collected from the ultrafiltration (UF) tube was loaded into a HiTrapTM Desalting (GE Healthcare) gel column chromatography. The column was fully equilibrated with PB solution pH 7.0 to purify the lysozyme [77]. The flow rate was 0.1 mL/min for elution with the equilibrium solution, detection was performed at 280 nm, and the activity peaks were collected, while the active frictions were collected in sterilized 10-mL tubes. The active fractions containing lysozyme were again concentrated by using an ultracentrifuge tube (Ultra-15,Millipore Amicon, Bedford, MA, USA) centrifuge at 4000 r/min at 4 °C for 10 min. The extra-purified sample obtained in this step was used for further analysis in SDS-PAGE technique.

Quantification of the total protein

The total protein content from the purification was measured using the modified colorimetric method [76, 77] using a bicinchoninic acid (BCA) protein assay kit (Thermo Scientific™ Pierce™ Catalog number: 23225). Briefly described, the protein standards were prepared by completely dissolving the protein standard, taking a 10-µL standard, and diluting it in 100 µL PBS to reach the final concentration of 0.5 mg/mL. The diluted 0.5 mg/mL protein standard was stored at − 20 °C. The BCA working solution was prepared at a ratio of 50:1, i.e., 50 volumes of BCA reagent A plus 1 volume of BCA reagent B (50:1), mixed thoroughly, and the BCA working solution was stable for 24 h at room temperature. Then, 0, 0.1, 0.25, 0.5, and 0.75 mg/mL standard solutions were added in 96-well plates, 20 µL of each sample was added, and then 200 µL of the BCA working solution was added to each well and stored at 37 °C for 30 min. Absorbance was measured at 562 nm using a microplate reader. The protein concentration was calculated using the standard curve.

SDS-PAGE (sodium dodecyl-sulfate polyacrylamide gel electrophoresis)

The ultra-purified products (recombinant plasmids; Lyz1 and Lyz2) obtained by gel column chromatography were then used for SDS-PAGE analysis. SDS-PAGE is a technique for separating proteins based on their different mass ratios. SDS-PAGE was performed on an electrophoresis instrument (Bio-Rad Laboratories, Hercules, CA, USA) using a 12% (w/v) acrylamide separation gel and a 5% (w/v) Stacking Quick SDS-PAGE Gel Preparation Kit according to the method of Laemmli (Laemmli et al., 1970). As a negative control, vector pET28a was used. SDS-PAGE was performed according to the instructions of the rapid SDS-PAGE gel preparation kit (Beijing Zhuangmeng International Biogenomics Division Technology Co., Ltd). The resulting gel was stained with 0.1% Coomassie brilliant blue R-250 in 45% methanol and 10% glacial acetic acid for 3 h and then distilled with 45% methanol and 10% glacial acetic acid [29, 47]. After completion of gel staining, the resulting image was taken by using the Gel Imaging System, model no. UVP BioSpectrum 510, brand: Ultra-Violet Products Ltd (Cambridge, UK).

Antimicrobial assay

The ultra-purified products of the two recombinant plasmids (Lyz1 and Lyz2) obtained after the ultrafiltration procedure were used to study the antimicrobial activity. Prior to antimicrobial activity, the freeze-drying method was used to change these ultra-purified recombinant plasmids in powder form. Antimicrobial activity was determined by the well diffusion method [13–15]. Bacterial and fungal cultures, indigenously obtained from clinical and environmental sources, were stored at 4 °C. Six Gram-positive bacteria, including Micrococcus luteus, Bacillus subtilis 168, Staphylococcus aureus, Streptococcus pneumonia, Clostridium sporogenes, and Bacillus cereus, and two Gram-negative species, including Salmonella typhimurium and Pseudomonas aeruginosa, while one yeast, Saccharomyces cerevisiae, and a fungal species Aspergillus oryzae were used in this study.

For susceptibility tests (both bacteria and fungi), standard solution of ciprofloxacin (10 μg/mL) and miconazole (10 μg/mL) were used. Both of these drugs were used as positive control; for negative control, deionized water was used. The zone of inhibition (ZOI), produced by the supernatants, was compared with ZOI (mm) of the standard drugs (positive control). The bacterial and yeast cultures were grown overnight in Mueller–Hinton agar (MHA) and Sabouraud dextrose broth (Oxoid, UK), centrifuged at 9000 × g, and the supernatant was removed. A cell suspension, equivalent to 0.5 McFarland standard (1.5 × 108 CFU/mL), was prepared in 5.0-mL sterile physiological saline solution. Confluent lawns were made on fresh MHA and Sabouraud dextrose agar (SDA) plates and allowed to diffuse for 5–10 min. The wells were dug (6 mm), stock solutions of 10-μL supernatants dispensed into them, and allowed to diffuse into media for 15–20 min. The plates were incubated at 37 °C for 24–48 h. The fungal spore suspension (5 × 105 spores/mL) was prepared from 5-day-old cultures. On SDA plates, the lawns of fungal culture were prepared, the supernatants were inoculated and allowed to diffuse into the media for 15–20 min, and finally plates were incubated at 25 °C for 5 days [13, 14]. For the reproducibility of the results, all the experiments were repeated six times.

Minimum inhibitory concentration (MIC) and minimum bactericidal/fungicidal concentration (MBC/MFC) assays

A modified dilution method was used for the determination of MIC and MBC. The resultant lysozyme was diluted at different concentrations in sterile nutrient broth in test tubes. Using a sterile wire loop, a culture of each bacterial, fungal, and yeast strains was inoculated into test tubes containing 1 mL of the various concentrations of lysozyme in the nutrient broth. The tubes containing bacteria were incubated at 37 °C for 24 h, and those containing fungi were incubated at 25 °C for 5 days, and then growth was observed by turbidity. At the concentration where no growth/turbidity occurred, now, a sterile culture swab stick was dipped into the broth from each test tube and was loaned at agar culture plates. Equal volumes of sterile nutrient broth were added to the test tubes containing broth media and incubated at 37 °C for 24 h; for bacteria and for fungi, the media were incubated at 25 °C for 5 days. The tubes and agar plates were examined for growth or turbidity. These experiments were repeated three times [18, 77].

Antimicrobial index (AMI)

$$\mathrm{AMI}=\frac{\mathrm{ZOI}\mathrm{of}\mathrm{Purified}\mathrm{Lysozyme}}{\mathrm{ZOI}\mathrm{of}\mathrm{Antibiotic}}$$

AMI values > 1 indicate recombinant lysozyme is more active than the standard drug (antibiotic), while the AMI < 1 indicates recombinant lysozyme is less active than the standard drug [14, 15].

Percentage activity index (PAI)

It is the ratio between zone of inhibition by lysozyme to the zone of inhibition of antibiotic and multiplied by 100.

$$\mathrm{PAI}=\frac{\mathrm{ZOI}\mathrm{of}\mathrm{Lysozyme}}{\mathrm{ZOI}\mathrm{of}\mathrm{Antibiotic}}\times 100$$

Value > 100 shows the lysozyme is more potent than antibiotic, while < 100 shows the lysozyme is less potent than antibiotic [15].

Lysozyme activity assay

Lysozyme assay was determined by the turbidimetric method [6, 76, 110]. Micrococcus luteus used as substrate was cultured in LB liquid medium in a shaker tube, with 220 rpm, and incubated at 37 °C for 24 h. The culture was centrifuged at 8000 rpm for 10 min and the supernatant was discarded. Micrococcus luteus pellets were collected, the pellets were re-suspended into the phosphate buffer (PB) (pH 6.2) and added into the cuvette, and the measured the optical density (OD) was set at 0.8 (OD₄₅₀). Of the selected bacterial strains from the fermentation broth after culturing, 0.5 mL was added to the cuvette which already contained 2 mL of Micrococcus luteus PB suspension.

The optical density (OD) values were noted at 450 nm after 15–75-s intervals, respectively. The difference between the two OD₄₅₀ values was calculated as △A450. The lytic activity of lysozyme was calculated under the conditions of 25 °C, pH 6.2, and at a wavelength of 450 nm. The calculation was done by the unit of activity corresponding to the amount of enzyme required to decrease absorbance by 0.001 per minute. Enzyme activity was calculated according to the following formula, and all samples were repeated at least five times.

$$\text{I}=\frac{\text{A}1-\text{A}2}{0.001\times \text{Ew}}$$

where I = enzyme activity, A1 = absorbance at 450 nm, A2 = absorbance after 1 min, A1‐A2 = the change in absorbance per minute at 450 nm, and 0.001 = the decrease of the absorbance value at 450 nm by 0.001 per minute as an activity unit. Ew = 0.5 mL detection enzyme solution contains the mass (mg) or volume (mL) of the original enzyme solution.

Atomic force microscopy (AFM) analysis

In the present research work, two Gram-positive (Micrococcus luteus and Streptococcus pneumoniae), one Gram-negative (Pseudomonas aeruginosa), and one yeast (Saccharomyces cerevisiae) were used for atomic force microscopy (AFM) analysis. Selected bacterial cells were collected from each of the activated stock cultures in an Eppendorf (1.5 mL), centrifugation at 8000 rpm for 5 min, the bacterial residues were collected, and the supernatant discarded. Centrifugation process was repeated three times to obtain sufficient cells. The effective concentrations of purified lysozyme was prepared (same as used for MIC/MBC) in the deionized water, added to the isolated cells of each strain, and allowed to stand in a shaking incubator (100 rpm) for 3 h.

Atomic force microscopy (AFM) analysis was performed according to the method described in our previous studies [77, 100]. The method was started by placing the treated cells on a clean glass slide, and a thin smear was made with the help of a wire loop. The slides were air-dried under sterile conditions at 25% relative humidity. AFM images were acquired using Nanoscope IIIA with J-scanner in tapping mode. Silicon nitride cantilevers (Olympus AC240TS) with a radius of curvature of 20 nm, resonance frequency of 70–100 kHz, scan rate of 1 Hz, and stiffness of 5 N/m were used to examine the samples.

Statistical analysis

All the resulting data was repeated in triplicate; analysis, data analysis, and graphical plots were generated using Origin Pro 9.1 (software from OriginLab Corporation, USA). Data obtained from the experiment was expressed as mean ± SD. The obtained analytical data were tested by one-way analysis of variance (ANOVA). The values of Lyz1 and Lyz2 were compared by Tukey’s HSD test using SPSS ver. 23.0 (Chicago, IL, USA). A p value < 0.05 was considered statistically significant.

Results

Amplification of the target genes

In this study, the genes used for cloning purpose were isolated from B. subtilis BSN314 (in our previous studies) [76, 77]. Based on previous gene sequencing [77], the primers (Lyz1F, Lyz1R and Lyz2F, Lyz2R) were designed (Table 1) to obtain the corresponding nucleic acid sequence with the same lysozyme properties. They were amplified by polymerase chain reaction (PCR). The steps and conditions of the polymerase chain reaction (PCR) are listed in Table 2. The resulting PCR products were detected by 1% agarose gel electrophoresis (supplementary material; Fig S2). The results from gel electrophoresis indicated that the Lyz1 gene had a size of approximately 900 base pairs (bp). The Lyz2 gene had a size of about 1300 bp (Fig S2). The genes of the purified lysozyme were inserted into the pET28a vector and used for further study.

Identification of PCR product

The gene sequence obtained by PCR was compared with the NCBI database using the Basic Local Alignment Search Tool (BLAST). The results for the two genes obtained, Lyz1 and Lyz2, are shown in Figs S3 and S4, respectively. The Lyz1 gene was N-acetylmuramoyl-L-alanine amidase (Bacillus subtilis subsp. natto BEST195), which was a 99% match to N-acetylmuramoyl-L-alanine amidase after comparison with the database (Fig S3). Similarly, the Lyz2 gene was D-alanyl-D-alanine carboxypeptidase (Bacillales), which matched 99% with D-alanyl-D-alanine carboxypeptidase when compared with the database (Fig S4).

Construction and identification of recombinant expression vector

After inserting the genes into the pET28a vector, the plasmids (pET28a-Lyz1 and pET28a-Lyz2) were constructed and introduced into E. coli Top10. The main purpose of E. coli Top10 is to subsequently propagate the gene for cloning and transfection. When the final vector was confirmed, it was transferred into the desired strain E. coli BL21. Confirmation of the vector was done by gel electrophoresis. Gel electrophoresis revealed that pET28a had approximately 5500 bp (Fig S5 D) and Lyz1 had 900 bp (Fig S5 B), whereas pET28a had approximately 5500 bp (Fig S5 C) and Lyz2 had 1300 bp (Fig S5 A), indicating that the recombinant expression vectors/plasmids (pET28a-Lyz1 and pET28a-Lyz2) were successfully constructed.

Expression of lysozyme gene in E. coli BL21

Both confirmed vectors (pET28a-Lyz1 and pET28a-Lyz2) were transformed into E. coli BL21. E. coli BL21 with pET28a-Lyz1 and pET28a-Lyz2 were cultured separately, and lysozyme expression was induced by adding IPTG to the culture.

Enzymatic activity of unpurified lysozyme

The turbidimetric method was used to determine enzyme activity of the fermented lysozyme (unpurified). The vitality was found to be about 59 U/mL for the Lyz1 gene, whereas the Lyz2 gene had a lower enzymatic activity (21 U/mL) (Table 3).

Table 3.

Enzyme activity (U/mL) of recombinant vector products (pET28a-Lyz1 and pET28a-Lyz2) measured by turbidimetric method

E. coli BL21 recombinant product	Enzyme activity (U/mL)
pET28a-Lyz1 fermentation supernatant	59 ± 2.3
pET28a-Lyz2 fermentation supernatant	21 ± 1.1
Control	0

Purification of isolated protein

The induced E. coli BL2 cells with pET28a-Lyz1 and pET28a-Lyz2 were isolated. The enzymatic activity of the total fermented product of Lyz1 (59 U/mL) and Lyz2 (21 U/mL) was determined (Table 3). For further purification, a multi-step methodology was applied for the cloned lysozymes (Lyz1 and Lyz2). The first step is precipitation, in which 70% ammonium sulfate solution was used. The concentration was based on our previous study [77]. It was found that the highest yield of lysozyme was obtained at 70% ammonium sulfate concentration. The highest lysozyme yield was 1.85 mg/mL for Lyz1 and 1.81 mg/mL for Lyz2, while the total enzymatic activity was 341 U for Lyz1 and 199 U for Lyz2. Now other methods such as dialysis, ultrafiltration, and gel column chromatography were used to purify the lysozyme. The percentage yield of purified lysozyme, total enzymatic activity, and specific activity are shown in Table 4. The quantification of the lysozyme was determined using the bicinchoninic acid (BCA) method. The corresponding linear regression curve and correlation coefficient (R) are shown in Fig S6. Ultrafiltration gave a yield of 68% for Lyz1 and a total enzymatic activity of 211 U, while the yield for Lyz2 was 67% and the total enzymatic activity was 113 U. The specific activity for Lyz1 was 701 U/mg, while for Lyz2 it was 389 U/mg. Extra-pure lysozyme was obtained by gel column chromatography with a yield of 11% for Lyz1 and 10% for Lyz2, with a specific activity of 324 U/mg for Lyz1 and 79 U/mg for Lyz2.

Table 4.

The results of the total activity, protein concentration, specific activity, and yield% data of each step in the separation and purification processes (ammonium sulfate precipitation, dialysis ultrafiltration, and gel column chromatography) of the cloned lysozymes (Lyz1 and Lyz2) are shown

Steps	Vol. mL	Total enzyme activity U		Protein conc. mg/mL		Specific activity U/mg		Yield %
		Lyz1	Lyz2	Lyz1	Lyz2	Lyz1	Lyz2	Lyz1	Lyz2
(NH4)2SO4 precipitation	20	341 ± 11.9a	199 ± 9.41b	1.85 ± 0.13a	1.81 ± 0.19b	701 ± 15.7a	389 ± 11.8b	100 ± 0.09a	100 ± 0.09a
Dialysis	6	269 ± 9.73a	159 ± 6.03b	0.91 ± 0.07a	0.78 ± 0.08b	541 ± 13.9a	237 ± 10.4b	81 ± 0.15a	80 ± 0.43b
Ultrafiltration	3	211 ± 9.22a	113 ± 3.01b	0.89 ± 0.09a	0.55 ± 0.05b	455 ± 13.2a	196 ± 8.15b	68 ± 0.49a	67 ± 0.78b
Gel column chromatography	2	106 ± 2.94a	37 ± 1.2b	0.39 ± 0.03a	0.31 ± 0.03b	324 ± 9.73a	79 ± 2.17b	11 ± 0.96a	10 ± 0.89b

Data (means ± SD, n = 6) followed by different letters (superscripts) indicate significant differences among variables (a = P < 0.05; b = P < 0.01)

SDS-PAGE analysis for Lyz1 and Lyz2

The extra-purified lysozymes (Lyz1 and Lyz2) obtained after gel column chromatography were further subjected to SDS-PAGE technique. The results from the SDS-PAGE analytical technique showed that the extra-purified Lyz1 had a prominent band at 36 KDa, while the Lyz2 had a comparatively smaller band at 36 KDa (Fig. 1).

Fig. 1.

Sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) image, where channel M indicates the protein marker, channel 1 indicates the control, channel 2 indicates the ultra-purified lysozyme (Lyz1), and channel 3 indicates the ultra-purified lysozyme (Lyz2)

Antimicrobial and enzymatic activities of lysozyme

After ultrafiltration, the resultant products (Lyz1 and Lyz2) were further used for the antimicrobial activity. Prior to the determination of antimicrobial activity, these extra-purified products were freeze-dried, and the metabolites were obtained in powder form. Ten microbes were used for antimicrobial activity assessment, including Micrococcus luteus, Bacillus subtilis 168, Staphylococcus aureus, Streptococcus pneumonia, Clostridium sporogenes, Bacillus cereus, Salmonella typhimurium, Pseudomonas aeruginosa, Saccharomyces cerevisiae, and Aspergillus oryzae.

The results show that the purified product of Lyz1 (shown in supplementary material; S1A to S1J) had stronger antimicrobial activity than that of Lyz2 (shown in supplementary material; S2A to S2J). The results of ZOI, MIC, and minimum bactericidal/fungicidal concentration (MBC/MFC) for the recombinant lysozymes (Lyz1 and Lyz2) against bacteria, fungi, and yeast species are shown in Table 5. For Lyz1, the strongest antimicrobial activity against Micrococcus luteus (with 22 mm ZOI) and the lowest activity against Salmonella typhimurium (with 10 mm ZOI) were observed. The minimum MIC/MBC was found to be 0.25 μg/mL against Micrococcus luteus, while the maximum MIC/MBC was measured against Salmonella typhimurium (2.50 μg/mL). The results showed that Lyz1 exhibited higher bactericidal activity against Gram-positive than Gram-negative bacteria. To determine the antifungal/yeast activity of Lyz1 in yeast and fungi, Saccharomyces cerevisiae and Aspergillus oryzae were used. Compared with Aspergillus oryzae (MIC/MFC; 3.00 μg/mL), a higher concentration of lysozyme was required to control the growth of Saccharomyces cerevisiae (MIC/MFC; 50 μg/mL). The Lyz2 showed the highest antimicrobial activity against Micrococcus luteus (14 mm ZOI) and the lowest antimicrobial activity against Salmonella typhimurium (7 mm ZOI). The minimum MIC/MBC was detected against Micrococcus luteus (0.85 μg /mL), while the maximum MIC/MBC was measured against Salmonella typhimurium (6.00 μg/mL). For fungi and yeasts, the highest concentration of Lyz2 was required to kill yeast (Saccharomyces cerevisiae) rather than fungi (Aspergillus oryzae). The MIC/MFC measured against Saccharomyces cerevisiae was 95 μg/mL, whereas for Aspergillus oryzae it was 6.75 μg/mL. The results showed that the Lyz1 had higher bactericidal/fungicidal activity than that of Lyz2.

Table 5.

Antimicrobial activity indicating zone of inhibition (ZOI mm), minimum inhibitory and bactericidal/fungicidal concentrations (MICs and MBCs/MFCs) of lysozyme (produced through the cloning by E. coli BL21) against Gram-positive/negative and fungal/yeast pathogens

Microorganisms		Ultra-purified cloned lysozyme (Lyz1)					Ultra-purified cloned lysozyme (Lyz2)
	Antibiotic (10 μg/mL)	ZOI	MIC	MBC/MFC	AMI	PAI	ZOI	MIC	MBC/MFC	AMI	PAI
	ZOI (mm)	(mm) ± SD	(μg/mL) ± SD	(μg/mL) ± SD			(mm) ± SD	(μg /mL) ± SD	(μg/mL) ± SD
Micrococcus luteus	17.3	22 ± 1.50a	0.25 ± 0.02a	0.25 ± 0.02a	1.27	127	14 ± 0.75b	0.85 ± 0.09b	0.85 ± 0.09b	0.81	81
Bacillus subtilis 168	14.5	13 ± 0.85a	1.00 ± 0.07a	1.0 ± 0.07a	0.9	90	11 ± 0.53b	2.25 ± 0.15b	2.25 ± 0.15b	0.76	76
Staphylococcus aureus	12	12.5 ± 0.85a	1.50 ± 0.09a	1.50 ± 0.09a	1.04	104	9 ± 0.67b	4.50 ± 0.10b	4.50 ± 0.10b	0.75	75
Streptococcus pneumoniae	13	14 ± 1.10a	0.65 ± 0.04a	0.65 ± 0.04a	1.08	108	11 ± 0.83b	1.25 ± 0.08b	1.25 ± 0.08b	0.85	85
Clostridium sporogenes	12	13 ± 0.53a	0.75 ± 0.04a	0.75 ± 0.04a	1.08	108	10 ± 0.71b	1.10 ± 0.09b	1.10 ± 0.09b	0.83	83
Bacillus cereus	13.8	12 ± 0.55a	1.25 ± 0.07a	1.25 ± 0.07a	0.87	87	10 ± 0.55b	2.75 ± 0.20b	2.75 ± 0.20b	0.73	73
Salmonella typhimurium	12	10 ± 0.55a	2.50 ± 0.20a	2.50 ± 0.20a	0.83	83	7 ± 0.55b	6.00 ± 0.81b	6.00 ± 0.81b	0.58	58
Pseudomonas aeruginosa	13	11 ± 1.10a	2.00 ± 0.08a	2.00 ± 0.08a	0.85	85	8 ± 0.51b	5.50 ± 0.35b	5.50 ± 0.35b	0.62	62
Saccharomyces cerevisiae	15	17 ± 0.55a	50.0 ± 0.11a	50.0 ± 0.11a	1.13	113	12 ± 0.62b	95.0 ± 0.60b	95.0 ± 0.60b	0.80	80
Aspergillus oryzae	13	14 ± 0.55a	3.00 ± 0.15a	3.00 ± 0.15a	1.08	108	10 ± 0.68b	6.75 ± 0.47b	6.75 ± 0.47b	0.77	77

Data (means ± SD, n = 6) followed by different letters (superscripts) indicate significant differences among variables (a = P < 0.05; b = P < 0.01)

Since Lyz1 exhibited higher antimicrobial activity as compared to Lyz2, that is why only the effect of Lyz1 on the bacterial and fungal/yeast strains was investigated by atomic force microscopy (AFM). Two Gram-positive strains (Micrococcus luteus and Streptococcus pneumoniae), one Gram-negative strain (Pseudomonas aeruginosa), and one yeast strain (Saccharomyces cerevisiae) were selected for AFM analysis. The same lysozyme concentration used for MIC and MBC was also used for AFM analysis and showed the disintegrating effect on the bacterial/yeast cells (Figs. 2, 3, 4, and 5).

Fig. 2.

A The structure of Micrococcus luteus, before the treatment of cloned lysozyme (Lyz-1). B The structure of Micrococcus luteus, after the treatment of cloned lysozyme (Lyz-1), representing the disintegrating effect of lysozyme on the bacterial cell

Fig. 3.

A The structure of Streptococcus pneumoniae, before the treatment of cloned lysozyme (Lyz-1). B The structure of Streptococcus pneumoniae, after the treatment of cloned lysozyme (Lyz-1), representing the disintegrating effect of lysozyme on the bacterial cell

Fig. 4.

A The structure of Pseudomonas aeruginosa, before the treatment of cloned lysozyme (Lyz-1). B The structure of Pseudomonas aeruginosa, after the treatment of cloned lysozyme (Lyz-1), representing the disintegrating effect of lysozyme on the bacterial cell

Fig. 5.

A The structure of Saccharomyces cerevisiae, before the treatment of cloned lysozyme (Lyz-1). B The structure of Saccharomyces cerevisiae, after the treatment of cloned lysozyme (Lyz-1), representing the disintegrating effect of lysozyme on the bacterial cell

Discussion

Lysozyme is a natural and potential antimicrobial agent mainly found in various tissues and secretions of the organisms and also in a variety of bacteria [10, 112]. In the present decade, synthetic antimicrobial agents are being replaced by natural antimicrobial agents in the food and pharmaceutical industries because most synthetic antimicrobial agents have numerous side effects [80, 86, 92, 118]. In the present study, we cloned (expressed) a natural antimicrobial enzyme (lysozyme) in E. coli BL21 to produce a stable antimicrobial enzyme (lysozyme) on an industrial scale. The lysozyme used in the present study was isolated from Bacillus subtilis BSN314, which was obtained from our previous work [76, 77]. The strain Bacillus subtilis BSN314 used to isolate the enzyme is considered more suitable due to its excellent fermentation capabilities and its enormous potential to secrete proteins directly into the culture medium. Literature indicates that Bacillus subtilis strains are commonly used for the production and isolation of potentially stable enzymes [113],Van and Hecker, 2013; [30, 77].

Bacillus subtilis has significant importance because Bacillus subtilis has a higher fermentation rate and therefore can produce lysozyme in large quantities [76, 77]. The lysozyme produced by B. subtilis is highly stable. Even after the isolation of lysozyme from bacteria, it was found that it does not lose stability, but retains its stable structure and has significant potential to combat many pathogenic microbial strains. It maintains its stability at 40 to 60 °C and remains active in the pH range between 3 and 9, thus playing an important role in the pharmaceutical and food industries. In industries, these stable enzymes can be used as natural preservatives instead of synthetic ones [20, 24, 38, 78, 81]. Since synthetic preservatives have many side effects, biopreservation has gained much attention among alternative food preservation technologies nowadays to increase the shelf life and hygienic quality of food. Biopreservatives have antibacterial properties against microbes and have no side effects. To protect food from various pathogenic and food spoilage microbes, the use of lysozyme is becoming increasingly important in the food industry. Therefore, to meet industry needs, researchers are attempting to catalyze lysozyme production [53, 105, 109].

The present study also aims to increase lysozyme production to meet the needs of the industries. By using recombinant DNA technology, the gene expression system has been introduced, as the gene expression system is becoming popular as a tool for high-yield protein production in recent years [28, 35, 93]. Based on our previous studies [76, 77], two genes were isolated from Bacillus subtilis BSN314, amplified by PCR, and translated from the NCBI database using the Basic Local Alignment Search Tool (BLAST). Lyz1 was identified as N-acetylmuramoyl-L-alanine amidase and Lyz2 as D-alanyl-D-alanine carboxypeptidase. The BLAST results showed that the gene sequencing of Lyz1 and Lyz2 was consistent with that determined in our previous study [77]. The result of our previous study showed that these compounds had significant antibacterial and enzymatic activities [77]. In order to produce the cost-effective and stable lysozyme in large quantities, cloning of these two genes was the main objective of the present study. Thus, primers Lyz1-F, Lyz1-R, Lyz2-F, and Lyz2-R were designed to obtain the desired lysozyme, and these genes were transferred to potential lysozyme production in E. coli BL21, because E. coli strains are one of the most commonly used and cost-effective expression hosts for the production of functional recombinant lysozyme [8, 56, 88, 99]. But the use of E. coli for lysozyme cloning has some limitations; e.g., expression of soluble lysozyme in E. coli leads to rapid cell lysis and low product yield. To increase the yield, the enzyme can be produced as an insoluble and inactive inclusion so that cell lysis (of the host) cannot occur. To overcome these limitations, some strategies were used in the present study, i.e., the use of a modified vector, a modified host strain, and the addition of an inducer [42, 56, 85]. The vector is used to express the gene in the host. A vector is designed to transcribe and/or translate a cloned gene. It contains all the components for foreign gene expression. Plasmid vectors are used for cloning and expression of foreign genes in prokaryotic systems. The most popular E. coli expression system is the pET expression system, which is based on the T7 bacteriophage promoter that promotes high-level transcription and translation; therefore, it is used in the production of recombinant proteins at the commercial level [42, 52]. The choice of the appropriate E. coli BL21 host strain is mandatory for expression of recombinant proteins and depends on the expression vector used. For gene expression in vectors containing T7 promoters, an E. coli BL21 strain is preferred because it produces the RNA polymerase for this promoter. Another application of E. coli BL21 is that it can grow vigorously in minimal media and has a higher production rate [16, 68, 85]. The addition of inducer plays a very important role in the production of recombinant proteins, and it must be optimized to increase the rate of protein production. Low inducer concentration may lead to inefficient induction, while too high inducer concentration may lead to toxic effects such as reduced cell growth or lower concentration of recombinant proteins [52, 99]. Therefore, inducer concentration should be optimized for efficient recombinant protein production [42]. In the present study, IPTG was added at a final concentration of 0.5 mM to increase the production of the recombinant enzyme. The literature shows that the same IPTG concentration was also used to increase the growth rate of the E. coli BL21 strain (containing recombinant protein; Lyz1 and Lyz2) so that maximum production of lysozyme could be achieved [28, 40, 45, 68].

Ammonium sulfate precipitation is the most commonly used method for isolating proteins. When ammonium sulfate is added, it competes with the proteins to bind to the water molecules. This removes the water molecules from the protein and reduces its solubility, resulting in precipitation. This can be explained by the mechanism of salting-in and salting-out. The solubility of proteins usually increases slightly in the presence of salt, which is called salting-in. At high salt concentrations, the solubility of proteins decreases sharply and proteins may precipitate, which is called salting-out. Ammonium sulfate acts by pulling water molecules away from the nonpolar units of proteins. The decrease in available water molecules increases surface tension and enhances hydrophobic interactions, allowing the protein to precipitate out of solution [77]. It has been suggested that the recovery rate of protein can be improved by optimizing the concentration of ammonium sulfate [83]. As in our previous study [77], the maximum percentage yield was obtained at an ammonium sulfate concentration of 70%, so in this study, to obtain maximum yield of cloned protein (Lyz1 and Lyz2), 70% ammonium sulfate was used.

Bacterial lysozyme has significant antimicrobial activity [44, 53, 91]. The antimicrobial activity of lysozyme depends on its enzymatic activity [57, 72, 97]. Therefore, the enzymatic activity of the cloned Lyz1 and Lyz2 genes (N-acetylmuramoyl-L-alanine amidase and D-alanyl-D-alanine carboxypeptidase) was determined before evaluating their antimicrobial activity. Previous literature also showed that N-acetylmuramoyl-L-alanine amidase and D-alanyl-D-alanine carboxypeptidase have enzymatic and antibacterial activities [1, 54, 96],Lopez-Arvizu et al., 2021a; Lopez-Arvizu et al., 2021b; [74]. The mechanism of antimicrobial activity is directly related to the hydrolysis of the peptidoglycan in the bacterial cell wall, which ultimately causes the death of the cell (Vollmer et al., 2008; [27, 39].

In the present study, the cloned lysozyme showed higher antimicrobial activity against Gram-positive than Gram-negative bacteria. In our previous study, the same kind of results were recorded for the bactericidal activity of lysozyme [77]. Gram-positive bacteria were more susceptible to lysozyme because Gram-positive bacteria have a thick peptidoglycan layer and no outer lipid layer, whereas Gram-negative bacteria have a thin peptidoglycan layer and an outer lipid layer. This outer lipid layer provides maximum protection to Gram-negative bacteria; therefore, lysozyme has a lower bactericidal effect on Gram-negative bacteria, while Gram-positive bacteria are readily killed by lysozyme [90, 94, 108]. The morphological study of bacteria is considered important to investigate the bactericidal activity of an antimicrobial agent. Atomic force microscopy (AFM) was used to study the morphological changes of bacteria before and after treatment of bacterial cells with lysozyme. After treatment with lysozyme, the stiffness of the cell wall was reduced, resulting in the death of the cell [77]. In the present study, Lyz1 was found to have higher antimicrobial activity than Lyz2, so the AFM study was performed for Lyz1. The Lyz1 concentration used for disruption of bacterial cells was the same as that used for MIC/MBC. The final AFM images showed the condition of the bacterial cells, some damaged and others somewhat blurred. The same type of observation was made in our previous study [77]. Once cells are exposed to Lyz1, leakage and polarization of the cytoplasmic contents may occur, leading to cell disintegration. This disintegrative effect leads to the interruption of various vital functions of the cell and eventually to the death of the bacterial cells. The bacteriostatic effect of lysozyme is due to its ability to hydrolyze the β-l,4-glycosidic bond of peptidoglycans, resulting in the degradation of the murein (peptidoglycan) layer. As a result, the mechanical strength of the bacterial cell wall decreases, leading to the death of the bacterium [2, 104, 106].

To determine the difference in antimicrobial activity of cloned lysozyme against yeast and fungi, two microorganisms were used in this study: S. cerevisiae and A. oryzae. It was found that lysozyme (Lyz1) required a higher concentration (50 μg /mL) to kill S. cerevisiae than A. oryzae (2. 25 μg /mL). The antimicrobial activity of the lysozyme is affected by the external structure of the microorganism. Chitin constitutes a much larger proportion of the cell wall in fungi than in yeasts, and this chitin structure gives the strength to the fungal cell. While mannoprotein and filamentous β-(1,3)-glucans are the main components of the yeast cell wall. The lysozyme cannot easily attack this type of cell structure. Therefore, a higher concentration of lysozyme was required to kill the yeast than the fungal cell [21, 23, 36, 41, 53, 63]. Stiffness/rigidity is an important biomechanical property of the bacterial cell that enables the bacteria to perform all functions for survival and also provides protection from the external environment. Among widely used antimicrobial drugs, lysozyme is considered as a natural substance that exhibits the antimicrobial activities by affecting the different substructures of the bacterial cell wall and cause to decrease its stiffness as a result bacterial cell is killed [61]. The results of the AFM images show that the cell wall of Gram-positive bacteria was strongly affected by a lower concentration of lysozyme, while for Gram-negative and yeast cells a higher concentration of lysozyme was required to reduce the stiffness of the cell wall.

The sequence of the cloned lysozyme was determined using the Basic Local Alignment Search Tool (BLAST). The expression product of the Lyz1 gene was N-acetylmuramoyl-L-alanine amidase, whereas the expression product of the Lyz2 gene was D-alanyl-D-alanine carboxypeptidase. After expression of both plasmids in the E. coli BL21 strain, SDS-PAGE was performed to separate the major protein based on molecular mass [17, 111]. A prominent band for Lyz1 and a smaller band for Lyz2 were obtained at 36 kDa. Similar bands pattern was also analyzed in our previous study, on the isolation and purification of lysozyme from Bacillus subtilis BSN314 by SDS-PAGE and LC–MS techniques [77].

In the present work, the enzymatic and antimicrobial activities of Lyz1 (N-acetylmuramoyl-L-alanine amidase) were found to be higher than those of Lyz2 (D-alanyl-D-alanine carboxypeptidase). This is because N-acetylmuramoyl-L-alanine amidase can cleave the amide bond between the glycan component (N-acetylmuramic acid) and the peptide component (L-alanine) of the peptidoglycan, which subsequently leads to the death of the bacterial cell [34, 70, 71, 73]. Therefore, Lyz1 (N-acetylmuramoyl-L-alanine amidase) can be used as a potent antimicrobial agent against many pathogens.

Conclusion

The application of biotechnology has increased the production rate of recombinant proteins. To use these proteins on an industrial scale, researchers are applying various strategies to successfully obtain low-cost and potential proteins. In the present study, some strategies were also applied to obtain low-cost and stable enzyme/lysozyme with high potential against microbial pathogens. Two genes, Lyz1 (N-acetylmuramoyl-L-alanine amidase) and Lyz2 (D-alanyl-D-alanine carboxypeptidase), were introduced into a common modified strain, E. coli BL21, using a modified vector (pET28a). The resulting recombinant enzyme Lyz1 had higher enzymatic and antimicrobial activities. Future studies could be used to improve the production rate and purification of the enzyme. The purified product of recombinant lysozyme can be used in the pharmaceutical industry, and it can also be used in a variety of food processing industries, where it can play an important role as a natural preservative for food products.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

MN: Conceptualization and writing—original draft. SW: Formal analysis. MWHC: Supervision, conceptualization, project administration, and writing the original draft. FW: Funding acquisition, supervision, and project administration. SA: Visualization and data curation. XY: Investigation. BX: Methodology. AU: Writing—review and editing.

Funding

This research was funded by the National Key R & D Program of China (grant number 2021YFC2102800), the National Natural Science Foundation (grant number 22178006), and the Support Project of High-level Teachers in Beijing Municipal Universities in the Period of 13th Five-year Plan (grant number CIT & TCD201904040).

Data availability

The authors confirm that the data supporting the findings of this study are available within the article.

Declarations

Conflicts of interest

The authors declare no competing interests.