Abstract
This study aimed to evaluate in vivo the use of the extract from the leaves of Melia azedarach in the ethyl acetate fraction at a concentration of 150 µg/mL as an antiretroviral treatment against small ruminant lentiviruses (SRLV) in goat colostrum, and milk with a 90-min action. Two groups of six kids were treated with the extract. One group received three supplies of colostrum from does naturally positive for SRLV, treated with the ethyl acetate fraction of M. azedarach (EAF-MA) for three days, while the other group consumed milk from does also carrying the virus with the respective extract twice a day for five days. After undergoing treatment, all animals began to receive thermized milk until weaning (60 days) and were monitored for six months using nested polymerase chain reaction (nPCR) and western blot (WB) tests. The study revealed cumulative percentages of positive animals in WB or nPCR in the milk group of 66.66% on the seventh day, 83.33% in the following week, and 100% at 120 days, while the colostrum group showed values of 66.66% at 14 days, 83.33% at 90 days, and 100% at 120 days. Variation and intermittency were observed in viral detection, but all animals tested positive in WB or nPCR at some point. A potential delay in infection was observed, which was more significant in the colostrum group. The need for the combination of serological and molecular tests for a more efficient detection of the disease is also emphasized.
Keywords: Antiviral action, Natural products, Goat lentivirus, Meliaceae, Lactogenic transmission
Introduction
The maedi-visna virus (MVV) and caprine arthritis-encephalitis virus (CAEV) constitute the group of small ruminant lentiviruses (SRLV) within the Lentivirus genus and Retroviridae family. These non-oncogenic agents exhibit high variability and are composed of two single strands of positive RNA, resulting in a protracted incubation period [1, 2]. These retroviruses are categorized into five groups (A–E), with groups A and B containing the highest number of subtypes, namely, 27 (A1–A27) and five (B1–B5), respectively [3, 4]. The genomic structure includes structural genes (gag, pol, and env) and accessory genes (VPR-like, vif, and rev) [5]. Reverse transcriptase (RT) is responsible for encoding viral RNA into complementary DNA, which subsequently integrates with the host cell DNA [6]. Notably, surface glycoprotein (gp135) in the envelope and p28 in the capsid play pivotal roles in inducing the formation of antibodies when an animal becomes infected with SRLV [7].
The disease caused by SRLV is more prevalent in dairy herds, resulting in significant economic losses due to decreased milk production and devaluation of herds [8]. Clinically, these lentiviruses are associated with interstitial pneumonia, encephalitis, arthritis, mastitis, progressive weight loss, and neurological issues [9–12]. While the agar gel immunodiffusion (AGID) and the indirect enzyme-linked immunoadsorption assay (ELISA) are recommended by the OIE for diagnosis (OIE, 2004), advanced control programs have adopted western blotting (WB) due to its superior sensitivity and specificity [13]. This technique is often complemented by molecular methods like nested polymerase chain reaction (nPCR) to enhance diagnostic efficiency, a necessity stemming from viral compartmentalization [14].
Animals are exposed to infection through the gastrointestinal tract or ingestion of infected colostrum, involving both the free virus and provirus present within monocytes/macrophages [12, 15]. Thus, SRLV transmission via the lactogenic route ensures viral spread across generations and its persistence in herds, playing a pivotal role in SRLV biology as one of the primary transmission routes [9, 10]. This is due to a substantial number of infected cells present in milk and colostrum contaminated with these retroviruses [11, 16].
Thermization is the most frequently employed virus-blocking technique through the lactogenic route and is applied to colostrum, transitional milk, or regular milk [17]. While this method has demonstrated efficacy, it is not a cure or treatment for infected animals. Various studies have sought treatment protocols or cures, including strategies involving inactivated whole viruses, subunit vaccines, DNA-encoding viral proteins with or without plasmids encoding immune adjuvants, and naturally or artificially attenuated viruses [17–19]. However, efforts to develop treatments and vaccines that prevent retrovirus contamination in goat and sheep herds have proven ineffective [20].
Consequently, there is a pressing need to explore alternatives that can serve as the foundation for future antiviral developments, potentially forming part of a treatment protocol against these etiological agents.
Numerous in vitro and in vivo studies have been conducted using plant extracts, where their phytochemical constituents, known as secondary metabolites, have displayed a promising range of antiviral activities. These secondary metabolites are capable of inhibiting viral entry and replication, offering enhanced safety margins, quality, lower resistance rates, and fewer side effects [21–31]. Metabolites such as alkaloids, terpenoids, saponins, and polyphenols have exhibited antiviral activity against various viruses, including influenza-A, dengue virus (DENV), severe acute respiratory syndrome coronavirus (SARS-CoV), human immunodeficiency virus (HIV), herpes simplex virus type 1 (HSV-1), hepatitis C virus (HCV), Epstein-Barr virus (EBV), ebola virus (EVD), chikungunya virus (CHIKV), and japanese encephalitis virus (JEV) [32–37].
Flavonoids, characterized by diverse mechanisms to inhibit and interact with viruses, represent an important class, often surpassing the antiviral activity of certain standard antivirals [38]. Compounds like kaempferol, fisetin, chalcone, rutin, and quercetin, found in various plant extracts, have demonstrated antiviral activity against CHIKV, HIV-1, HPV, HIV-2, influenza, cytomegalovirus (CMV), SARS-CoV, DENV, feline calicivirus (FCV), murine norovirus (MNV), and EVD. These compounds have the potential to interfere with different stages of the replicative cycle [37–42].
Reports have also emerged regarding the antiviral activity of extracts from M. azedarach, commonly known as cinamomo. These extracts have shown effectiveness against herpes simplex virus type 2 (HSV-2) [25], DENV-2 [29], various strains of the influenza virus [26], and even SRLV. in vitro experiments have demonstrated that a concentration of 150 µg/mL inhibited CLV viral activity by up to a thousandfold in colostrum and up to 800 times in milk [28].
Given the promising results observed in in vitro studies, this research endeavors to assess the in vivo antiretroviral action of the organic fraction of ethyl acetate from M. azedarach leaf extracts against SRLV in goat colostrum and milk.
Materials and methods
Bioethical considerations
This research was conducted following ethical principles and received approval from the Ethics Committee for the Use of Animals (CEUA) at Embrapa Goats & Sheep under protocol number 002/2018. The study adhered to the guidelines set forth by the National Council for the Control of Animal Experimentation (CONCEA) as per Law No. 11.794, dated October 8, 2008, and subsequent regulatory resolutions.
Study site and experimental animals
Saanen and Anglo-Nubian goat kids from the dairy goat herd located in Sobral, Ceará, Brazil, at Embrapa Goats & Sheep were used in this study. These neonates were separated from their mothers immediately after birth, ensuring no contact with the does, as described in a previous publication [9]. All 35 births were monitored to guarantee the early separation of kids from does, as outlined in a prior study [17]. A total of 16 neonatal animals were selected and divided into three groups for the study based on the results of nPCR and WB tests, and the experimental design is illustrated in Fig. 1.
Fig. 1.
Diagram depicting the experimental design employed in the in vivo assessment of the antiretroviral efficacy of Melia azedarach against small ruminant lentiviruses in goat colostrum and milk. n PCR, nested polymerase chain reaction; EAF-MA, ethyl acetate fraction of Melia azedarach ; WB, western blot; G1, control group; G2, colostrum group; G3, milk group.
Collection and processing of ethanolic extract from Melia azedarach
Melia azedarach leaves were collected in Sobral, Ceará, totaling three kg of material. Exsiccates were prepared from these leaves and archived in the Herbarium Professor Francisco José Abreu de Matos at the State University of Vale do Acaraú (UVA), Sobral, CE, Brazil, where Voucher 18897 was obtained.
Following identification, the M. azedarach leaves were dehydrated and dried at room temperature. Subsequently, 1.26 kg of these leaves were immersed in 13 L of 96% ethyl alcohol and maintained for seven days in a sealed container. The resulting solutions were then subjected to roto-evaporation (Quimis-Q344M1) to eliminate 80 to 90% of the solvent. The concentrate was subjected to a water bath (Unique USC-1450) to remove the remaining solvent, resulting in a paste-like crude plant extract. The organic fraction of ethyl acetate (Sigma-Aldrich®, USA) was obtained through polarized chromatography. To achieve this, 25 g of each crude Meliaceae extract was mixed with 50 g of silica gel (at a 1:2 concentration; NEON). Using a Buchner funnel, the mixtures were vacuum-filtered and eluted with the organic solvent ethyl acetate, yielding the respective fraction. The fraction was then subjected to roto-evaporation and water bath for maximum evaporation, and then stored at 4 °C until used in goat colostrum or milk [43, 44].
Collection and processing of goat colostrum and milk
Initially, colostrum and milk were collected daily from 35 goats (Saanen and Anglo-Nubian) over six months. During collection, approximately 100 mL of colostrum and milk from each animal were directly collected in sterile containers. These samples underwent DNA extraction [17], followed by nPCR [45] for the diagnosis of SRLV and to obtain colostrum and naturally infected milk for feeding the kids during the treatments. Primers (Table 1) were designed based on the published sequence of CAEV-Co (M33677.1) [46].
Table 1.
Sequences of the primers used in nPCR reaction with amplified fragment sizes
| Gene Gag | Primer | Sequence 5′ 3′ | Fragment (bp) |
|---|---|---|---|
| 1st round | Gag 1 | CAAGCAGCAGGAGGGAGAAGCTG | 297 |
| Gag 2 | TCCTACCCCCATAATTTGATCCAC | ||
| 2nd round | Gag 3 | GTTCCAGCAACTGCAAACAGTAGCAATG | 185 |
| Gag 4 | ACCTTTCTGCTTCTTCATTTAATTTCCC |
In addition to the tested samples, a negative control (with no DNA) and a positive control CAEV-Co (standard viral sample kindly provided by the Federal Rural University of Pernambuco, from the Laboratoire Associé de Recherches sur les Petits Ruminants – INRA-ENVL-FRANCE) were used for each amplification cycle.
The nPCR reactions were conducted in a thermocycler (BIO-RAD, T100TM Thermal Cycler) in a total volume of 50 µL. The reaction mixture contained buffer (10 mM Tris–HCl, 50 mM KCl, and 1.5 mM MgCl2 – Sigma-Aldrich®, USA), 100 µM of each dNTP (Sigma-Aldrich®, USA), 20 pmol of each primer, 2U of Taq Platinum DNA polymerase (Thermo Fisher®, USA), 3 µL of sample in the first round, and 1 µL of the product from the first round in the second round.
The nPCR amplification consisted of an initial denaturation step at 94 °C for five minutes, followed by 35 cycles of denaturation at 94 °C for one minute, annealing at 56 °C for one minute, and extension at 72 °C for 45 s. The amplification process concluded with a final extension at 72 °C for seven minutes. The amplified samples, along with positive and negative controls, were subjected to electrophoresis using a 2% agarose gel (Sigma-Aldrich®, USA), stained with ethidium bromide (Sigma-Aldrich®, USA), and visualized under an ultraviolet transilluminator (UVP, Benchtop UV Transilluminator M-26).
Treatment of goat colostrum and milk with Melia azedarach extract
The ethyl acetate fraction of M. azedarach leaf extract (EAF-MA) was diluted with 0.5% dimethylsulfoxide (DMSO; Sigma-Aldrich®, USA) [28]. Subsequently, 150 µg/mL of the extract was added individually to colostrum and milk, which were naturally infected and tested positive by the nPCR test. The mixtures were stirred for 90 min and then fed to the kids. A group received colostrum and milk without extract addition to serve as a positive control.
Experimental groups and monitoring
At birth, before any contact with the mother and without ingesting colostrum, blood samples (10 mL per animal) were collected from all kids born to the 35 does in the herd through jugular venipuncture using a vacuum system, with tubes with anticoagulant (ethylenediaminetetraacetic acid – EDTA). After collection, the tubes with the blood samples were centrifuged at 1500 g for 10 min. Blood plasma was used for the western blot test [47], while leukocytes were collected for DNA extraction, following standard methodology [17], and subsequently subjected to nPCR [45].
Three groups were formed based on the nPCR and WB results at 0 h: Group 01 (G1) consisting of four kids; Group 02 (G2) and Group 03 (G3), each comprised of six animals. Out of the 16 kids in G2 and G3, twelve were definitively negative for SRLV according to the nPCR and WB results.
The animals were reared in an intensive system throughout the entire experimental period, receiving all feed in troughs up to 180 days of age. Initially, they were housed in covered pens with partitions from birth to weaning at 60 days, preventing contact between animals from different groups. After weaning, they were moved to pens measuring 8.75 m2 (3.5 × 2.5 m). The liquid diet of animals in G1 consisted of goat colostrum and milk contaminated with SRLV. Approximately 750 mL of colostrum was distributed to each animal three times a day (0 h, 8 h, and 24 h) for three days, followed by the supply of milk (1 L) twice a day (morning and afternoon) until weaning. In G2, the same amount of colostrum was provided to each animal three times a day (0 h, 8 h, and 24 h) for the first three days but was treated with EAF-MA at a concentration of 150 µg/mL for 90 min. Subsequently, 1 L of thermized milk was supplied (morning and afternoon) until weaning. The animals in G3 received thermized colostrum (750 mL/animal) three times a day for three days (0 h, 8 h, and 24 h), followed by 1 L of SRLV-positive goat milk treated with EAF-MA at a concentration of 150 µg/mL for 90 min, offered twice a day for five days. After this period, they were given only thermized milk (1 L divided into two 500 mL portions in the morning and afternoon) (Table 2).
Table 2.
Artificial feeding system of the liquid diet provided to the experimental animals
| Experimental group | Age (days) | Type of feeding | Amount/animal/day (L) |
|---|---|---|---|
| Group 1 | 0–3 | Colostrum positive for SRLV | 750 mL in 3x |
| 4 – weaning | Milk positive for SRLV | 1 L in 2x | |
| Group 2 | 0–3 | Colostrum positive for SRLV treated with EAF-MA at a concentration of 150 µg/mL | 750 mL in 3x |
| 4 – weaning | Thermized milk | 1 L in 2x | |
| Group 3 | 0–3 | Thermized colostrum | 750 mL in 3x |
| 4–8 | Milk positive for SRLV treated with EAF-MA at a concentration of 150 µg/mL | 1 L in 2x | |
| 9 – weaning | Thermized milk | 1 L in 2x |
SRLV, small ruminant lentivirus; EAF-MA, ethyl acetate fraction of Melia azedarach leaves; Weaning, 60 days
The entire liquid diet was artificially administered through individual feeding bottles. The animals had daily access to a total diet with a roughage-to-concentrate ratio of 50:50 starting from the second week of life until 180 days. The administered concentrate was initially limited to 400 g/animal/day but was adjusted to approximately 800 g/animal/day after weaning. The roughage component consisted of Tifton 85 grass hay (Cynodon ssp.). Water was made available ad libitum in plastic containers and refreshed twice daily. Mineral salt was also provided.
Blood samples were collected from the experimental animals on days 0, 7, 14, 21, and 28, and subsequently on a monthly basis for up to 180 days. Blood was consistently collected via jugular vein venipuncture. Blood plasma and leukocytes obtained through centrifugation were stored in mL microtubes (Eppendorf®, USA) and frozen at -20 °C until subjected to WB [47] and nPCR [45].
Antigen production
The WB antigen was generated at the Virology Laboratory of Embrapa Goats & Sheep. The CAEV-Co standard viral sample was inoculated into semi-confluent monolayers of the caprine nictitating membrane (13th passage) using A150 plastic vials containing a viral suspension of 200 doses/mL of supernatant obtained from cells displaying characteristic syncytium cytopathic effects. The supernatant was clarified through centrifugation at 3,300 g at 4 °C and treated by protein precipitation using 40% polyethylene glycol 8000 (PEG-8000) for 18 h at 4 °C, reaching a final concentration of 8%. Subsequently, the suspension was centrifuged at 4 °C at 12,000 g for 60 min, and the pellet was resuspended in TNE buffer (10.0 mM Tris–HCl, pH 7.4; 10.0 mM NaCl; 1.0 mM acid ethylenediamine tetraacetic (EDTA), 1/10 of the original volume of viral suspension). The precipitate was subjected to ultracentrifugation in a sucrose cushion (25%) at 42,000 g at 4 °C for 120 min. The pellet was suspended in phosphate-buffered saline solution (PBS) (0.05 M; 0.15 M NaCl; pH 7.4) and stored at -80 °C until laboratory tests were performed [48].
Statistical analysis
The results of nPCR and WB were expressed as percentages (%) by calculating the number of positive samples divided by the total number of samples, multiplied by 100. The kappa (k) index, based on the number of concordant responses, was employed to describe the level of agreement between the nPCR and WB tests for all analyzed days. Diagnostic performance parameters for WB and PCR (agreement) for serum and blood samples were assessed using WinEpiscope 2.0 (http://clive.ed.ac.uk/winepiscope/) at a 95% confidence level.
Results
Potential of in vivo antiretroviral activity of the ethyl acetate fraction of Melia azedarach
The nPCR tests (Table 3 and Fig. 2a) showed that 50% (3/6: G, H, I) of the animals in the group subjected to colostrum (G2) presented positive results in the first week of life (7 d), while only 16.66% (1/6: L) of the animals subjected to treated milk (G3) showed proviral DNA detection by nPCR in the same period. The other animals that received treated colostrum and were not detected in the first week only had positive samples on specific occasions: kid E only once (at 120 days) during the six months of monitoring; animal J showed detection of proviral DNA only at 120 and 180 days; and animal F showed positivity in the second week (14 d) and at 60 days (Table 3). The nPCR showed increasing detection in the G3 group until the peak at 120 days, followed by a sharp drop at 150 days. The G2 group had a similar behavior but also presented 50% detection at seven days (Fig. 2a).
Table 3.
Individual monitoring by nested polymerase chain reaction (nPCR) and western blot (WB) of experimental animals fed goat colostrum or milk naturally positive for small ruminant lentivirus (SRLV) treated with the ethyl acetate fraction of Melia azedarach (EAF-MA) at a concentration of 150 µg/mL for 90 min
| Treatment | Kid | Test | 0 h | 7d | 14d | 21d | 28d | 60d | 90d | 120d | 150d | 180d |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Positive control (G1) | A | nPCR | − | + | − | − | + | − | ls | ls | ls | ls |
| WB | − | − | − | − | − | − | ls | ls | ls | ls | ||
| B | nPCR | − | − | − | − | − | − | − | + | + | + | |
| WB | − | + | + | + | + | + | + | + | + | + | ||
| C | nPCR | + | − | − | − | − | − | − | − | + | − | |
| WB | − | + | + | + | + | − | + | + | + | + | ||
| D | nPCR | + | − | − | − | − | + | + | + | − | − | |
| WB | − | + | + | + | + | + | + | + | + | + | ||
| Colostrum with 150 ug/mL of the ethyl acetate fraction of Melia azedarach (G2) | E | nPCR | − | − | − | − | − | − | − | + | − | − |
| WB | − | − | − | − | − | − | − | − | − | − | ||
| F | nPCR | − | − | + | − | − | + | − | − | − | − | |
| WB | − | − | − | − | − | − | − | − | − | − | ||
| G | nPCR | − | + | − | − | − | − | + | + | − | + | |
| WB | − | − | − | − | − | − | + | − | + | + | ||
| H | nPCR | − | + | − | − | + | − | + | − | + | + | |
| WB | − | − | − | − | − | + | + | + | + | + | ||
| I | nPCR | − | + | − | + | − | + | − | − | − | − | |
| WB | − | + | + | + | − | + | + | + | + | + | ||
| J | nPCR | − | − | − | − | − | − | − | + | − | + | |
| WB | − | − | − | − | − | − | + | − | − | − | ||
| Milk with 150 ug/mL of the ethyl acetate fraction of Melia azedarach (G3) | K | nPCR | − | − | − | − | − | + | + | + | − | + |
| WB | − | + | − | + | + | + | + | + | + | + | ||
| L | nPCR | − | + | − | + | + | − | + | − | − | − | |
| WB | − | − | − | − | − | − | − | − | − | − | ||
| M | nPCR | − | ls | + | + | + | + | + | ls | ls | + | |
| WB | − | − | − | − | + | + | + | + | + | + | ||
| N | nPCR | − | − | + | − | − | + | − | + | + | + | |
| WB | − | + | − | − | + | + | + | + | + | + | ||
| O | nPCR | − | ls | ls | − | − | − | ls | + | ls | − | |
| WB | − | − | − | − | − | − | − | − | − | − | ||
| P | nPCR | − | − | − | + | + | + | + | + | − | − | |
| WB | − | + | − | − | + | + | + | + | + | + |
− , negative sample; + , positive sample; ls, lost sample; d, days; h, hours
Fig. 2.
Percentage results (%) of positive animals by diagnostic tests in the six-month monitoring period. Percentage (%) of positive animals for small ruminant lentivirus (SRLV) by the nested polymerase chain reaction (nPCR) test in the different experimental groups (a). Percentage (%) of animals positive for small ruminant lentivirus (SRLV) by the western blot (WB) test (b). Percentage of kids positive for small ruminant lentivirus (SRLV) via nested polymerase chain reaction (nPCR) or western blot (WB) in different experimental groups (c)
Regarding antibody detection, 16.6% (1/6) of the animals that had access to colostrum treated with EAF-MA showed seroconversion on the seventh day of life, 33.3% (2/6: G, J) seroconverted at 90 days, and 66.67% (4/6) of the animals were detected with anti-SRLV at 180 days, as 33.3% (2/6: E, F) showed negative results throughout the entire experimental period (Fig. 2b). It is a different situation from kids treated with milk added with EAF-MA, as 50% (3/6: K, N, P) of the animals presented anti-SRLV in the first week of life (7 d), reaching 66.67% (4/6) at 28 days, which remained until the end, as 33.3% (2/6: L, O) showed negative results over the 180 days (Table 3 and Fig. 2b). The comparison between G2 and G1 showed that serum-reactive animals in G2 remained below the values of G1 during the 180 days of life, and the values were higher than those of G3 only on day 14. Importantly, even animals that did not have antibodies detected gave positive results by nPCR at some point over the 180 days.
Groups G2 and G3 behaved similarly by WB or nPCR (Fig. 2c), with intermittent detections and with a peak of positive detections at 90 days, when 100% of the animals in G3 were positive by at least one of the two methods.
A high detection instability was noticeable both in general and only via nPCR or WB (Fig. 2a, b), with the agreement of positivity for both tests occurring seven, eight, and 16 times in the positive (G1), colostrum (G2), and treated milk (G3) groups, respectively (Table 3). In some instances, there was detection only via nPCR (G1: four times; G2 and G3: nine times each); on other occasions, detections occurred only via WB (G: 19 times; G2 and G3: 10 times each), and some animals (G1: A; G2: E and F; G3: I and O) showed no detection of anti-SRLV over the 180 days although they showed proviral DNA. Also, animals E and J in G2 drew attention, as they were positive by nPCR in late periods (at 120 days); animal J was first positive by WB (a single time), and animal E showed no detection of anti-SRLV.
Animals C and D were not included in the percentages, as they were positive for the virus at 0 h. In the control group, animals A and B showed positive results (nPCR or WB) on the seventh day, but there were variations in the next four measurements. The group remained 100% positive from day 90 to the end of the study (Fig. 2c).
The kappa coefficient was used to measure the agreement between the two tests in detecting positive animals. The agreement rate between the two tests during the six months of the experiment was 60%, with a kappa (k) of 0.19 (ci: 0.034, 0.343; 0.124, 0.253) for a maximum kappa of 0.37.
Figure 3 shows the cumulative percentages of positive animals by WB or nPCR over six months of monitoring after treatment with EAF-MA. All animals in G3 were positive, starting with 66.67% on the seventh day of life, going to 83.33% in the following week, and reaching 100% at 120 days. Also, the same percentage of positive animals of G3 (66.67%) is reached in G2 only at 14 days of life, remaining up to 60 days. The infected number at 90 days of life for G2 rises to 83.33%, reaching 100% of positive kids at least once by WB or nPCR, also at 120 days of age. The comparison of G2 and G3 with G1 shows a slower pace in the percentage increase, mainly in G2 (Fig. 3).
Fig. 3.
Cumulative percentage (%) results of positive animals by western blot (WB) or nested polymerase chain reaction (nPCR) in each group treated with 150 µg/µL of the ethanolic fraction of ethyl acetate of Melia azedarach (EAF-MA) over 180 days
Discussion
Antivirals are drugs that interfere with the phases of viral replication. Antiretrovirals are among them and target retroviruses, aiming to eliminate or decrease the level of retroviral particles in the plasma [49]. The plant M. azedarach, which belongs to the family Meliaceae, has phytochemical compounds such as fatty acids and polyphenols, which confer antiviral and antiretroviral activity [50–52].
This in vivo study was based on promising studies [28, 29] with natural products based on Meliaceae plants, which showed antiviral effects against dengue virus type 2 and caprine lentivirus (CLV) at concentrations close to those used in the present study. Particularly, the ethyl acetate fraction of M. azedarach showed promising potential against CLV in vitro, with no toxicity by testing with Artemia salina Leach cysts [28]. The same extract, dose, and time were used in the present study.
in vitro studies [28, 29] did not demonstrate cytotoxic effects at concentrations around 150 µg/mL, and there was no inhibition of cell proliferation. DMSO was chosen as a solvent due to its high solubility and lack of interference in botanical extracts, not affecting the phytochemical components, as reported in the literature [53, 54] and in a previous in vitro study [28].
The animals maintained good receptivity to colostrum/milk with M. azedarach extracts throughout this experiment, not showing any adverse reactions associated with the extract. Clinical symptoms of SRLV are rare in young animals [55], and the most common is the encephalic form up to four months of age [6, 56]. In this study, the animals showed no manifestations of clinical symptoms typical of SRLV throughout the experiment.
Some animals showed positivity to nPCR at 0 h even without contact with the mother after delivery, an indication of intrauterine transmission, as all deliveries were monitored, with immediate separation of the neonates. Some studies have already indicated that SRLV transmission can occur through this route, as viral strains of SRLV have been found in blood samples from kids immediately after birth, with no contact between mother and kid [57]. SRLV has also been detected in the amniotic fluid of naturally infected does, indicating this route of transmission [58]. Syncytia and lysis have been observed in cell monolayers derived from goat umbilical cord infected by CAEV-Co and MVV-K1514, showing that the cells are permissive to in vitro infection by SRLV [59]. Other research on the subject, with a review of several studies, pointed out that the extent and relevance of intrauterine and transplacental infection by SRLV are controversial, and that transmission rates can range from 5 to 10% [60]. Thus, although there may be intrauterine transmission, it is sporadic [61].
Viral infection was not prevented in the present research, but a slower rate of infection was noticed in animals that drank treated milk and colostrum during the six months when compared to the control group (Fig. 3). This effect may suggest an antiretroviral activity of EAF-MA, as the extract may have delayed the infection in treated animals by inhibiting or reducing viral multiplication of SRLV. Previous in vitro studies showed that ethanolic extracts of M. azedarach at different concentrations have antiviral activities against several types of viruses (HSV-1, HSV-2, Influenza, and VSV), with a reduction in viral load and inhibition of viral multiplication, generally affecting the viral replication or adsorption cycle. The main possible active components of M. azedarach correlated to the antiviral effect include limonoids, meliacins, and flavonoids [22–26, 62].
An animal (E) from G2 was positive only once in the nPCR test, not being detected in the following months and showing no seroconversion throughout the entire research. It may indicate the possibility of antiretroviral activity of the treatment with EAF-MA. The result of the nPCR test at 120 days may have been a false positive since there was no detection of proviral DNA in the other evaluated months, and the WB test did not detect anti-SRLV antibodies. However, a false-positive nPCR test in this study is unlikely, as the sensitivity and specificity of PCR for detecting SRLV are high, reaching 100% in some studies [63]. nPCR tests with samples of peripheral blood leukocytes also showed high specificity, ranging from 86.0 to 100% [64]. A study pointed out that positive animals by nPCR did not become seropositive, possibly because they were unable to generate anti-SRLV antibodies [65]. Another explanation for the non-detection of positive animals, as in the case of animal E in G2, is the low viral load that can affect the PCR efficiency, resulting in lower sensitivity [64].
A previous study by this research group carried out with EAF-MA in co-culture with the ovine nictitating membrane (ONM) and the same time of action of the present research in colostrum and milk contaminated with SRLV demonstrated antiretroviral activity. The analysis indicated that the extract was most effective in colostrum, possibly inhibiting the activity of CLV by up to a thousand times, while a probable inhibition of 800 times was observed in milk. However, the complete elimination of CLV was not achieved in these samples [28]. The results obtained in this in vivo study suggest a possible correlation with the in vitro study [28], indicating a delay in the infection of some animals treated with EAF-MA and higher efficacy observed in colostrum compared to milk.
A higher amount of proviral DNA may have been observed in milk compared to colostrum. Studies have indicated that the proportion of macrophages in the milk is high in the early lactation of goats, which may increase CAEV replication [66]. In addition to monocytes and macrophages, CAEV-infected milk epithelial cells may be targets of SRLV replication and sources of proviral DNA, suggesting a possible efficient transmission of the virus to newborns [67]. However, studies have indicated that colostrum is the main route of SRLV transmission. A study with 18 lambs revealed that the cumulative proportion of lambs with 100% positive nPCR occurred up to 15 days after ingestion of colostrum from infected goats, while the group that received milk only reached 100% at 150 days [68]. Other studies have reached similar conclusions, indicating that colostrum is not just one but the main route of transmission, as the increased intestinal permeability of newborns can facilitate the entry of both free virus and those present inside infected macrophages and monocytes [9, 68, 69]. Thus, EAF-MA may have interacted more effectively with colostrum.
Colostrum is known to have cytokines (IL-1β, IL-6, TNF-α, and INF-γ) involved in the development of the newborn immune system, in addition to antimicrobial factors that prevent the development of pathogenic enteric bacterial flora in the neonate, such as lysozyme, lactoperoxidase, and lactoferrin, a serine protease [69–71]. Some of these factors may have favored the integrated action of secondary metabolites of the plant, such as the interaction between lactoferrin and flavonoids, which were present in the chemical composition of EAF-MA [28, 72]. Studies have indicated that colostrum has many more whey proteins of serine protease and innate immunity categories than goat milk [73]. Isolated serine proteases have already interacted with and inactivated human respiratory syncytial virus (hRSV) [74].
Many studies have indicated that secondary metabolites from different botanical species can exhibit immunomodulatory activities [21, 75]. Terpenoids, flavonoids, saponins, and anthraquinones can cause significant increases in phagocytic index, leukocyte count, and affect cytokine production [75–80]. Polyphenols and monoterpenes present in human breast milk, for example, can modulate immunological aspects by interacting with cytokines and having functional activities similar to human milk oligosaccharides (HMOs), thus providing immunological protection [81]. Other phytochemicals have been shown to be immunomodulators at the intestinal level. Monoterpenes and curcumin have modulated secretory immunoglobulin A (sIgA) levels, protecting the gastrointestinal epithelial surface against pathogens [81]. In kids, anthraquinone improved the innate immune homeostasis of the small intestinal mucosa during the early life of the animal [82].
in vitro and in vivo studies have pointed out the immunomodulatory properties of several phytochemicals from the Meliaceae family [83, 84]. Meliacins and limonoids from M. azedarach elevated the levels of IFN-y and TNF-α, reducing the quantity of HSV virus in rats [83, 85]. EAF-MA has even more representative triterpenoids than flavonoid classes [28]. These phytoconstituents are targets of investigation in the search for bioactive components with antiviral pharmacological properties [38, 86, 87]. There are reports of antiviral activity attributed to triterpenoids present in plants against DENV [88, 89], HIV, H1N1, H5N1, HSV, and human cytomegalovirus (HCMV) [90–92]. The antiviral action of triterpenes mainly involves blocking enzymes involved in the replicative process [89, 93].
Discordant results were observed in this study between WB and nPCR for the same blood sample (kappa = 0.19), as well as variations in detection over time in some animals. Studies have shown variations in the sensitivity of both PCR and serological tests over time [94–96]. In general, molecular tests such as PCR allow earlier detection of SRLV compared to serological assays such as WB, as the production of anti-SRLV can take weeks to years to be detected [57, 61, 64, 97, 98]. A study showed a low agreement between serological and molecular tests in young animals in a period from 0 to 180 days [96].
The use of natural products in the area of animal health has been increasingly studied and can be a viable and affordable alternative for controlling diseases in herds. In this study, EAF-MA at the concentration used in colostrum and milk did not prevent the animals from being infected with SRLV. However, a delay in infection was observed in the treated groups compared to the control. In line with the in vitro study [28], the colostrum group showed better results than the milk group, emphasizing the effect of EAF-MA in this group, given that studies have shown that colostrum is a more efficient route than milk for SRLV transmission [9, 68, 69]. In addition, this study reinforces the need for a combined approach for the efficient control of SRLV infection, with the association of serological and molecular tests to increase detection efficiency at different stages of the virus and animal life cycle.
Future perspectives
Based on these results, further studies are needed to investigate the antiviral activity of the extract at this concentration, especially with an expanded sampling, aiming for a better understanding of its action and potential use in controlling SRLV infection in goat herds. Moreover, as this concentration did not prevent the animals from becoming infected, new research can be carried out with the extract at higher concentrations associated with other substances that may reduce the toxicological effects, as verified in vitro [28]. These studies should seek to understand the phytochemical components responsible for the antiviral activity and/or immunomodulatory action in the treatment and why they yield better results in colostrum.
Acknowledgements
This study was financed by the National Council of Scientific and Technological Development (CNPq; Brazil) under code 312900/2019-8, Embrapa Goats & Sheep under code 40.19.00.150.00.00, and Ceará State Foundation Support for Scientific and Technological Development (FUNCAP) under codes DC8-0145-00042.01.00/18 and 9751533/2018.
Data Availability
Not applicable.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Pisoni G, Quasso A, Moroni P. Phylogenetic analysis of small-ruminant lentivirus subtype B1 in mixed flocks: evidence for natural transmission from goats to sheep. Virology. 2005;339:147–152. doi: 10.1016/j.virol.2005.06.013. [DOI] [PubMed] [Google Scholar]
- 2.Minardi da Cruz JC, Singh DK, Lamara A, Chebloune Y. Small ruminant lentiviruses (SRLVs) break the species barrier to acquire new host range. Viruses. 2013;5:1867–1884. doi: 10.3390/v5071867. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Azevedo DAA, Monteiro JP, Pinheiro RR, de Alvarenga MM, Andrioli A, Araújo JF, de Sousa ALM, Sider LH, Peixoto RM, da Silva Teixeira MF. Molecular characterization of circulating strains of small ruminant lentiviruses in Brazil based on complete gag and pol genes. Small Rumin Res. 2019;177:160–166. doi: 10.1016/j.smallrumres.2019.06.011. [DOI] [Google Scholar]
- 4.Olech M, Kuźmak J. Genetic diversity of the ltr region of polish srlvs and its impact on the transcriptional activity of viral promoters. Viruses. 2023;15:302. doi: 10.3390/v15020302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Olech M, Bomba A, Kuźmak J. Quasispecies Composition of Small Ruminant Lentiviruses Found in Blood Leukocytes and Milk Epithelial Cells. Viruses. 2021;13:2497. doi: 10.3390/v13122497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Minguijón E, Reina R, Pérez M, Polledo L, Villoria M, Ramírez H, Leginagoikoa I, Badiola JJ, García-Marín JF, de Andrés D, Luján L, Amorena B, Juste RA. Small ruminant lentivirus infections and diseases. Vet Microbiol. 2015;181:75–89. doi: 10.1016/j.vetmic.2015.08.007. [DOI] [PubMed] [Google Scholar]
- 7.Souza TS de, Pinheiro RR, Lima CCV de, Costa JN (2012) Transmissão interespécie dos lentivírus de pequenos ruminantes: revisão e desafios. Acta Veterinaria Brasilica 6:23–34. 10.21708/avb.2012.6.1.2810
- 8.Pinheiro RR, Gouveia AMG, Alves FSF. Prevalência da infecção pelo vírus da artrite encefalite caprina no estado do Ceará, Brasil. Cienc Rural. 2001;31:449–454. doi: 10.1590/S0103-84782001000300014. [DOI] [Google Scholar]
- 9.Pisoni G, Bertoni G, Manarolla G, Vogt H-R, Scaccabarozzi L, Locatelli C, Moroni P. Genetic analysis of small ruminant lentiviruses following lactogenic transmission. Virology. 2010;407:91–99. doi: 10.1016/j.virol.2010.08.004. [DOI] [PubMed] [Google Scholar]
- 10.Pépin M, Vitu C, Russo P, Mornex JF, Peterhans E. Maedi-visna virus infection in sheep: a review. Vet Res. 1998;29:341–367. [PubMed] [Google Scholar]
- 11.Rowe JD, East NE, Thurmond MC, Franti CE, Pedersen NC. Cohort study of natural transmission and two methods for control of caprine arthritis-encephalitis virus infection in goats on a California dairy. Am J Vet Res. 1992;53:2386–2395. doi: 10.2460/ajvr.1992.53.12.2386. [DOI] [PubMed] [Google Scholar]
- 12.Herrmann-Hoesing LM, Palmer GH, Knowles DP. Evidence of proviral clearance following postpartum transmission of an ovine lentivirus. Virology. 2007;362:226–234. doi: 10.1016/j.virol.2006.12.021. [DOI] [PubMed] [Google Scholar]
- 13.Peixoto RM, Andrioli A, Pinheiro RR, de Souza KC, Araújo JF, de Sousa ALM, Lopes AKC, Souza SCR. Immune response dynamics of recent and chronic small ruminant lentivirus infection in the male reproductive system. Semin: Ciên Agrárias. 2023;44:185–202 . doi: 10.5433/1679-0359.2023v44n1p185. [DOI] [Google Scholar]
- 14.Ramírez H, Reina R, Amorena B, de Andrés D, Martínez HA. Small ruminant lentiviruses: genetic variability, tropism and diagnosis. Viruses. 2013;5:1175–1207. doi: 10.3390/v5041175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Gomez-Lucia E, Barquero N, Domenech A. Maedi-Visna virus: current perspectives. Vet Med (Auckl) 2018;9:11–21. doi: 10.2147/VMRR.S136705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Arcangeli C, Torricelli M, Sebastiani C, Lucarelli D, Ciullo M, Passamonti F, Giammarioli M, Biagetti M. Genetic Characterization of Small Ruminant Lentiviruses (SRLVs) Circulating in Naturally Infected Sheep in Central Italy. Viruses. 2022;14:686. doi: 10.3390/v14040686. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Sousa ALM, Pinheiro RR, Araújo JF, Santos VWS, Azevedo DAA, Peixoto RM, Souza V, Andrioli A, Damasceno EM, Dantas TVM, Teixeira MFS. In vitro and in vivo evaluation of sodium dodecyl sulfate (SDS) as an inactivator of caprine lentivirus (CLV) in colostrum and milk. Arq Bras Med Vet Zootec. 2018;70:1459–1467. doi: 10.1590/1678-4162-9556. [DOI] [Google Scholar]
- 18.Reina R, Andrés D, Amorena B. Immunization against Small Ruminant Lentiviruses. Viruses. 2013;5:1948. doi: 10.3390/v5081948. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Reina R, Berriatua E, Luján L, Juste R, Sánchez A, de Andrés D, Amorena B. Prevention strategies against small ruminant lentiviruses: An update. Vet J. 2009;182:31–37. doi: 10.1016/j.tvjl.2008.05.008. [DOI] [PubMed] [Google Scholar]
- 20.de Araújo SAC, Teixeira MFS, Dantas TVM, Melo VSP, Lima FES, Ricarte ARF, Costa EC, Miranda AM. Usos potenciais de melia azedarach l. (meliaceae): um levantamento. Arq Inst Biol. 2009;76:141–148. doi: 10.1590/1808-1657v76p1412009. [DOI] [Google Scholar]
- 21.Behl T, Rocchetti G, Chadha S, Zengin G, Bungau S, Kumar A, Mehta V, Uddin MS, Khullar G, Setia D, Arora S, Sinan KI, Ak G, Putnik P, Gallo M, Montesano D. Phytochemicals from plant foods as potential source of antiviral agents: An overview. Pharmaceuticals. 2021;14:381. doi: 10.3390/ph14040381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Bueno CA, Lombardi MG, Sales ME, Alché LE. A natural antiviral and immunomodulatory compound with antiangiogenic properties. Microvasc Res. 2012;84:235–241. doi: 10.1016/j.mvr.2012.09.003. [DOI] [PubMed] [Google Scholar]
- 23.Alché LE, Ferek GA, Meo M, Coto CE, Maier MS. An antiviral meliacarpin from leaves of Melia azedarach L. Zeitschrift für Naturforschung C. 2003;58:215–219. doi: 10.1515/znc-2003-3-413. [DOI] [PubMed] [Google Scholar]
- 24.Wachsman MB, Damonte EB, Coto CE, de Torres RA. Antiviral effects of Melia azedarach L. leaves extracts on Sindbis virus-infected cells. Antiviral Res. 1987;8:1–12. doi: 10.1016/0166-3542(87)90083-0. [DOI] [PubMed] [Google Scholar]
- 25.Petrera E, Coto CE. Effect of the potent antiviral 1-cinnamoyl-3,11-dihydroxymeliacarpin on cytokine production by murine macrophages stimulated with HSV-2. Phytother Res. 2013;28:104–109. doi: 10.1002/ptr.4974. [DOI] [PubMed] [Google Scholar]
- 26.Nerome K, Shimizu K, Zukeran S, Igarashi Y, Kuroda K, Sugita S, Shibata T, Ito Y, Nerome R. Functional growth inhibition of influenza A and B viruses by liquid and powder components of leaves from the subtropical plant Melia azedarach L. Arch Virol. 2018;163:2099–2109. doi: 10.1007/s00705-018-3830-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Dinda B, Dinda S, Dinda M. Therapeutic potential of green tea catechin, (-)-epigallocatechin-3-O-gallate (EGCG) in SARS-CoV-2 infection: Major interactions with host/virus proteases. Phytomed Plus. 2023;3:100402. doi: 10.1016/j.phyplu.2022.100402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Sousa ALM, Rizaldo Pinheiro R, Furtado Araujo J, Mesquita Peixoto R, de Azevedo DAA, Cesar Lima AM, Marques Canuto K, Vasconcelos Ribeiro PR, de Queiroz Souza AS, Rocha Souza SC, de Amorim SL, Paula Amaral G, de Souza V, de Morais SM, Andrioli A, da Silva Teixeira MF. In vitro antiviral effect of ethanolic extracts from Azadirachta indica and Melia azedarach against goat lentivirus in colostrum and milk. Sci Rep. 2023;13:4677. doi: 10.1038/s41598-023-31455-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Parida MM, Upadhyay C, Pandya G, Jana AM. Inhibitory potential of neem (Azadirachta indica Juss) leaves on Dengue virus type-2 replication. J Ethnopharmacol. 2002;79:273–278. doi: 10.1016/S0378-8741(01)00395-6. [DOI] [PubMed] [Google Scholar]
- 30.Mohammadi Pour P, Fakhri S, Asgary S, Farzaei MH, Echeverría J (2019) The signaling pathways, and therapeutic targets of antiviral agents: focusing on the antiviral approaches and clinical perspectives of anthocyanins in the management of viral diseases. Front Pharmacol 10:1–23. 10.3389/fphar.2019.01207 [DOI] [PMC free article] [PubMed]
- 31.Younus I, Ashraf M, Fatima A, Altaf I, Javeed A. Evaluation of cytotoxic and antiviral activities of aqueous leaves extracts of different plants against foot and mouth disease virus infection in farming animals. Pak J Pharm Sci. 2017;30:2165–2172. [PubMed] [Google Scholar]
- 32.Moradi M-T, Karimi A, Rafieian-Kopaei M, Fotouhi F. In vitro antiviral effects of Peganum harmala seed extract and its total alkaloids against Influenza virus. Microb Pathog. 2017;110:42–49. doi: 10.1016/j.micpath.2017.06.014. [DOI] [PubMed] [Google Scholar]
- 33.Chang F-R, Yen C-T, Ei-Shazly M, Lin W-H, Yen M-H, Lin K-H, Wu Y-C. Anti-human coronavirus (anti-HCoV) triterpenoids from the leaves of Euphorbia neriifolia. Nat Prod Commun. 2012;7:1415–1417. [PubMed] [Google Scholar]
- 34.Diniz LRL, Perez-Castillo Y, Elshabrawy HA, Filho CDSMB, de Sousa DP. Bioactive terpenes and their derivatives as potential sars-cov-2 proteases inhibitors from molecular modeling studies. Biomolecules. 2021;11:74. doi: 10.3390/biom11010074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Sharma P, Tyagi A, Bhansali P, Pareek S, Singh V, Ilyas A, Mishra R, Poddar NK. Saponins: Extraction, bio-medicinal properties and way forward to anti-viral representatives. Food Chem Toxicol. 2021;150:112075. doi: 10.1016/j.fct.2021.112075. [DOI] [PubMed] [Google Scholar]
- 36.Xu J, Xu Z, Zheng W. A review of the antiviral role of green tea catechins. Molecules. 2017;22:1337. doi: 10.3390/molecules22081337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Zakaryan H, Arabyan E, Oo A, Zandi K. Flavonoids: promising natural compounds against viral infections. Arch Virol. 2017;162:2539–2551. doi: 10.1007/s00705-017-3417-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Badshah SL, Faisal S, Muhammad A, Poulson BG, Emwas AH, Jaremko M. Antiviral activities of flavonoids. Biomed Pharmacother. 2021;140:111596. doi: 10.1016/j.biopha.2021.111596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Schwarz S, Sauter D, Wang K, Zhang R, Sun B, Karioti A, Bilia AR, Efferth T, Schwarz W. Kaempferol derivatives as antiviral drugs against the 3a channel protein of coronavirus. Planta Med. 2014;80:177–182. doi: 10.1055/s-0033-1360277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Di Petrillo A, Orrù G, Fais A, Fantini MC. Quercetin and its derivates as antiviral potentials: A comprehensive review. Phytother Res. 2022;36:266–278. doi: 10.1002/ptr.7309. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Seo DJ, Jeon SB, Oh H, Lee B-H, Lee S-Y, Oh SH, Jung JY, Choi C. Comparison of the antiviral activity of flavonoids against murine norovirus and feline calicivirus. Food Control. 2016;60:25–30. doi: 10.1016/j.foodcont.2015.07.023. [DOI] [Google Scholar]
- 42.Zandi K, Teoh B-T, Sam S-S, Wong P-F, Mustafa MR, Abubakar S. Antiviral activity of four types of bioflavonoid against dengue virus type-2. Virol J. 2011;8:560. doi: 10.1186/1743-422X-8-560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Pizzolatti MG, Cunha A, Jr, Szpoganicz B, de Sousa E, Braz-Filho R, Schripsema J. Flavonóides glicosilados das folhas e flores de Bauhinia forficata (Leguminosae) Quím Nova. 2003;26:466–469. doi: 10.1590/S0100-40422003000400003. [DOI] [Google Scholar]
- 44.Paredes PFM, de Morais SM, Brito FCR, Moura LFWG, Rodrigues PDA, Benjamin SR, Magalhães FEA, Florean EOPT, Guedes MIF. Characterization of Cnidoscolus quercifolius Pohl bark root extract and evaluation of cytotoxic effect on human tumor cell lines. Asian Pac J Trop Biomed. 2018;8:345. doi: 10.4103/2221-1691.237077. [DOI] [Google Scholar]
- 45.Marinho RC, Martins GR, Souza KC, Sousa ALM, Silva STC, Nobre JA, Teixeira MFS. Duplex nested-PCR for detection of small ruminant lentiviruses. Braz J Microbiol. 2018;49:83–92. doi: 10.1016/j.bjm.2018.04.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Saltarelli M, Querat G, Konings DAM, Vigne R, Clements JE. Nucleotide sequence and transcriptional analysis of molecular clones of CAEV which generate infectious virus. Virology. 1990;179:347–364. doi: 10.1016/0042-6822(90)90303-9. [DOI] [PubMed] [Google Scholar]
- 47.Rodrigues AS, Brito RLL, Pinheiro RR, Dias RP, Alves SM, Souza TS, Souza KC, Azevedo DAA, Andrioli A, Magalhães DCT, Teixeira MFS. Padronização do Elisa indireto e Western Blot para diagnóstico da artrite-encefalite caprina. Arq Bras Med Vet Zootec. 2014;66:417–424. doi: 10.1590/1678-41626303. [DOI] [Google Scholar]
- 48.Dantas TVM. Desenvolvimento e padronização de um ELISA indireto para Diagnóstico de Maedi Visna em ovinos. Ciênc Anim Bras. 2008;9:181–187. [Google Scholar]
- 49.Hartmann K, Wooding A, Bergmann M. Efficacy of antiviral drugs against feline immunodeficiency virus. Vet Sci. 2015;2:456–476. doi: 10.3390/vetsci2040456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Rana AC, Rana AC, Rana AC. Melia azedarach: a phytopharmacological review. Pharmacogn Rev. 2008;2:173–179. [Google Scholar]
- 51.Cornelio VE, Forim MR, Perlatti B, Fernandes JB, Vieira PC, Napolitano MP, Yost RA, da Silva MFGF. Identification of Meliatoxins in Melia azedarach Extracts Using Mass Spectrometry for Quality Control. Planta Med. 2017;83:312–317. doi: 10.1055/s-0042-115773. [DOI] [PubMed] [Google Scholar]
- 52.Peixoto RM, Teixeira MF da S, Andrioli A, Pinheiro RR, Silva AA de S, Aguiar TD de F, Azevedo DAA de, Sousa ALM de (2018) Perspectivas do uso de fitoterápicos no tratamento do sêmen caprino infectado pelo vírus da Artrite Encefalite Caprina Medicina Veterinária (UFRPE) 12:193–201. 10.26605/medvet-v12n3-2395
- 53.de Oliveira FP, Fernandes HJ, Rial AALDS, de Soutello RVG. Atividade do dimetilsulfóxido (DMSO) e de dois extratos de magonia pubescens sobre rhipicephalus (BOOPHILUS) microplus/ Dimethylulphoxide (DMSO) and two activity pubescens extracts on rhipicephalus (BOOPHILUS) microplus. Braz J Dev. 2019;5:23724–23736 . doi: 10.34117/bjdv5n11-075. [DOI] [Google Scholar]
- 54.Bona EAMD, Pinto FGDS, Fruet TK, Jorge TCM, de Moura AC. Comparação de métodos para avaliação da atividade antimicrobiana e determinação da concentração inibitória mínima (cim) de extratos vegetais aquosos e etanólicos. Arq Inst Biol. 2014;81:218–225. doi: 10.1590/1808-1657001192012. [DOI] [Google Scholar]
- 55.Urbańska DM, Jarczak J, Czopowicz M, Kaba J, Horbańczuk K, Bagnicka E. miRNA expression patterns in blood leukocytes and milk somatic cells of goats infected with small ruminant lentivirus (SRLV) Sci Rep. 2022;12:13239. doi: 10.1038/s41598-022-17276-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Kalogianni AI, Bossis I, Ekateriniadou LV, Gelasakis AI. Etiology, epizootiology and control of maedi-visna in dairy sheep: a review. Animals. 2020;10:616. doi: 10.3390/ani10040616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Araújo JF, Andrioli A, Pinheiro RR, Sider LH, de Sousa ALM, de Azevedo DAA, Peixoto RM, Lima AMC, Damasceno EM, Souza SCR, Teixeira MFDS. Vertical transmissibility of small ruminant lentivirus. PLoS One. 2020;15:e0239916. doi: 10.1371/journal.pone.0239916. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Furtado Araújo J, Andrioli A, Pinheiro RR, Peixoto RM, de Sousa ALM, de Azevedo DAA, Lima AMC, Nobre JA, Amaral GP, Brandão IS, da Silva Teixeira MF. Detection and isolation of small ruminant lentivirus in the amniotic fluid of goats. Comp Immunol Microbiol Infect Dis. 2021;78:101693. doi: 10.1016/j.cimid.2021.101693. [DOI] [PubMed] [Google Scholar]
- 59.Martins GR, Marinho RC, Junior RQB, Alves ADO, Câmara LMC, Albuquerque-Pinto LC, Teixeira MFDS. Goat umbilical cord cells are permissive to small ruminant lentivirus infection in vitro. Braz J Microbiol. 2017;48:125–131. doi: 10.1016/j.bjm.2016.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Blacklaws BA, Berriatua E, Torsteinsdottir S, Watt NJ, de Andres D, Klein D, Harkiss GD. Transmission of small ruminant lentiviruses. Vet Microbiol. 2004;101:199–208. doi: 10.1016/j.vetmic.2004.04.006. [DOI] [PubMed] [Google Scholar]
- 61.Kaba J, Czopowicz M, Witkowski L, Szaluś-Jordanow O, Mickiewicz M, Markowska-Daniel I, Puchała R, Bagnicka E. Longitudinal study on seroreactivity of goats exposed to colostrum and milk of small ruminant lentivirus–infected dams. Journal of Veterinary Research. 2022;66:511–521. doi: 10.2478/jvetres-2022-0071. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Alché LE, Berra A, Veloso MJ, Coto CE. Treatment with meliacine, a plant derived antiviral, prevents the development of herpetic stromal keratitis in mice. J Med Virol. 2000;61:474–480. doi: 10.1002/1096-9071(200008)61:4<474:AID-JMV10>3.0.CO;2-K. [DOI] [PubMed] [Google Scholar]
- 63.Schaer J, Cvetnic Z, Sukalic T, Dörig S, Grisiger M, Iscaro C, Feliziani F, Pfeifer F, Origgi F, Zanoni RG, Abril CE. evaluation of serological methods and a new real-time nested pcr for small ruminant lentiviruses. Pathogens. 2022;11:129. doi: 10.3390/pathogens11020129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Kalogianni AI, Stavropoulos I, Chaintoutis SC, Bossis I, Gelasakis AI. Serological, molecular and culture-based diagnosis of lentiviral infections in small ruminants. Viruses. 2021;13:1711. doi: 10.3390/v13091711. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Peterson K, Brinkhof J, Houwers DJ, Colenbrander B, Gadella BM. Presence of pro-lentiviral DNA in male sexual organs and ejaculates of small ruminants. Theriogenology. 2008;69:433–442. doi: 10.1016/j.theriogenology.2007.10.013. [DOI] [PubMed] [Google Scholar]
- 66.Adjadj NR, Vicca J, Michiels R, De Regge N. (Non-)Sense of Milk Testing in small ruminant lentivirus control programs in goats. comparative analysis of antibody detection and molecular diagnosis in blood and milk. Viruses. 2019;12:3. doi: 10.3390/v12010003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Mselli-Lakhal L, Guiguen F, Fornazero C, Favier C, Durand J, Grezel D, Moussa A, Mornex JF, Chebloune Y. Immortalized goat milk epithelial cell lines replicate CAEV at high level. Vet Res. 2001;32:429–440. doi: 10.1051/vetres:2001135. [DOI] [PubMed] [Google Scholar]
- 68.de Souza TS, Pinheiro RR, Costa JN, de Lima CCV, Andrioli A, de Azevedo DAA, dos Santos VWS, Araújo JF, de Sousa ALM, Pinheiro DNS, Fernandes FMC, Costa Neto AO. Interspecific transmission of small ruminant lentiviruses from goats to sheep. Braz J Microbiol. 2015;46:867–874. doi: 10.1590/S1517-838246320140402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Nascimento VS de O, Pinheiro G de O, Lima E da S (2020) The Importance of Artificial Breastfeeding in Goat Breeding – Literature Review. Revista Electronica de Veterinaria 21:62–71. https://www.veterinaria.org/index.php/REDVET/article/view/43
- 70.Di Cera E. Serine proteases. IUBMB Life. 2009;61:510–515. doi: 10.1002/iub.186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Guzmán-Mejía F, Godínez-Victoria M, Molotla-Torres DE, Drago-Serrano ME. lactoferrin as a component of pharmaceutical preparations: An experimental focus. Pharmaceuticals. 2023;16:214. doi: 10.3390/ph16020214. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Nunes NM, Coelho YL, Castro JS, Vidigal MCTR, Mendes TAO, da Silva LHM, Pires ACS. Naringenin-lactoferrin binding: Impact on naringenin bitterness and thermodynamic characterization of the complex. Food Chem. 2020;331:127337. doi: 10.1016/j.foodchem.2020.127337. [DOI] [PubMed] [Google Scholar]
- 73.Sun Y, Wang C, Sun X, Guo M. Proteomic analysis of whey proteins in the colostrum and mature milk of Xinong Saanen goats. J Dairy Sci. 2020;103:1164–1174. doi: 10.3168/jds.2019-17159. [DOI] [PubMed] [Google Scholar]
- 74.Lopes BRP, da Silva GS, de Lima MG, de Oliveira J, Watanabe ASA, Porto BN, da Silva RA, Toledo KA. Serine proteases in neutrophil extracellular traps exhibit anti-Respiratory Syncytial Virus activity. Int Immunopharmacol. 2022;106:108573. doi: 10.1016/j.intimp.2022.108573. [DOI] [PubMed] [Google Scholar]
- 75.Awad E, Awaad AS, Esteban MA. Effects of dihydroquercetin obtained from deodar (Cedrus deodara) on immune status of gilthead seabream (Sparus aurata L.) Fish Shellfish Immunol. 2015;43:43–50. doi: 10.1016/j.fsi.2014.12.009. [DOI] [PubMed] [Google Scholar]
- 76.Biradar SK, Tyagi CK (2021) Phytochemical screening and immunomodulatory activities of methanolic extract of eclipta alba and centella asiatica. Research Journal of Pharmacology and Pharmacodynamics 13:5–8. 10.5958/2321-5836.2021.00002.1
- 77.Kamboh AA, Hang S-Q, Khan MA, Zhu W-Y. In vivo immunomodulatory effects of plant flavonoids in lipopolysaccharide-challenged broilers. Animal. 2016;10:1619–1625. doi: 10.1017/S1751731116000562. [DOI] [PubMed] [Google Scholar]
- 78.Indrati R, Ihsan N, Sofjan O, Suyadi S (2019) Ethanol extraction of Sambiloto leaves (Andrographis paniculata Nees) and evaluation of its immunomodulatory activity towards gastrointestinal nematode infestation in Ettawah Crossbred goats. Livest Res Rural Dev 31. http://www.lrrd.org/lrrd31/12/rosit31191.html
- 79.Yuandani Jantan I, Rohani AS, Sumantri IB. Immunomodulatory Effects and Mechanisms of Curcuma Species and Their Bioactive Compounds: A Review. Front Pharmacol. 2021;12:643119. doi: 10.3389/fphar.2021.643119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Yuliasmi S, Satria D, Dongoran RF, Sinaga MS, Marpaung NHA. Correlation between the phytochemical constituents of curcuma mangga and its immunomodulatory effect. RJC. 2019;12:01–06 . doi: 10.31788/RJC.2019.1215050. [DOI] [Google Scholar]
- 81.Sibeko L, Johns T, Cordeiro LS. Traditional plant use during lactation and postpartum recovery: Infant development and maternal health roles. J Ethnopharmacol. 2021;279:114377. doi: 10.1016/j.jep.2021.114377. [DOI] [PubMed] [Google Scholar]
- 82.Jiao J, Wu J, Wang M, Zhou C, Zhong R, Tan Z (2018) Rhubarb Supplementation Promotes Intestinal Mucosal Innate Immune Homeostasis through Modulating Intestinal Epithelial Microbiota in Goat Kids J. Agric Food Chem 66:1047–1057 10.1021/acs.jafc.7b05297. [DOI] [PubMed]
- 83.Petrera E. Antiviral and immunomodulatory properties of meliaceae family. J Biol Act Prod Nat. 2015;5:241–254. doi: 10.1080/22311866.2015.1081569. [DOI] [Google Scholar]
- 84.Lee JS, Sun KH, Park Y. Evaluation of Melia azedarach extract-loaded poly (vinyl alcohol)/pectin hydrogel for burn wound healing. PLoS ONE. 2022;17:e0270281. doi: 10.1371/journal.pone.0270281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Nethmini NAN, Kim MS, Chathuranga K, Ma JY, Kim H, Lee J-S. Melia azedarach extract exhibits a broad spectrum of antiviral effect in vitro and in vivo. J Biomed Transl Res. 2020;21:125–136 . doi: 10.12729/jbtr.2020.21.3.125. [DOI] [Google Scholar]
- 86.Darshani P, Sen Sarma S, Srivastava AK, Baishya R, Kumar D. Anti-viral triterpenes: a review. Phytochem Rev. 2022;21:1761–1842. doi: 10.1007/s11101-022-09808-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Ninfali P, Antonelli A, Magnani M, Scarpa ES. Antiviral properties of flavonoids and delivery strategies. Nutrients. 2020;12:2534. doi: 10.3390/nu12092534. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Silva FC, Rodrigues VG, Duarte LP, Lula IS, Sinisterra RD, Vieira-Filho SA, Rodrigues RAL, Kroon EG, Oliveira PL, Farias LM, Magalhães PP, Silva GDF. Antidiarrheal activity of extracts from Maytenus gonoclada and inhibition of Dengue virus by lupeol. An Acad Bras Ciênc. 2017;89:1555–1564. doi: 10.1590/0001-3765201720160046. [DOI] [PubMed] [Google Scholar]
- 89.Dwivedi VD, Tripathi IP, Mishra SK. In silico evaluation of inhibitory potential of triterpenoids from Azadirachta indica against therapeutic target of dengue virus, NS2B-NS3 protease. J Vector Borne Dis. 2016;53:156–161. [PubMed] [Google Scholar]
- 90.Si L, Meng K, Tian Z, Sun J, Li H, Zhang Z, Soloveva V, Li H, Fu G, Xia Q, Xiao S, Zhang L, Zhou D. Triterpenoids manipulate a broad range of virus-host fusion via wrapping the HR2 domain prevalent in viral envelopes. Sci Adv. 2018;4:eaau8408. doi: 10.1126/sciadv.aau8408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Dargan DJ, Subak-Sharpe JH. The effect of triterpenoid compounds on uninfected and herpes simplex virus-infected cells in culture. I. Effect on cell growth, virus particles and virus replication. J Gen Virol. 1985;66(Pt 8):1771–1784. doi: 10.1099/0022-1317-66-8-1771. [DOI] [PubMed] [Google Scholar]
- 92.Kazakova O, Tret’yakova E, Baev D. Evaluation of A-azepano-triterpenoids and related derivatives as antimicrobial and antiviral agents. J Antibiot. 2021;74:559–573. doi: 10.1038/s41429-021-00448-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Dinda B, Debnath S, Mohanta BC, Harigaya Y. Naturally Occurring Triterpenoid Saponins. Chem Biodivers. 2010;7:2327–2580. doi: 10.1002/cbdv.200800070. [DOI] [PubMed] [Google Scholar]
- 94.Souza TS de, Costa JN, Pinheiro RR, Melo FCC de, Lima CCV de, Andrioli A, Azevedo DAA de, Santos VWS dos, Oliveira EL de, Costa Neto A de O (2014) Duration of passive immunity to small ruminant lentiviruses in lambs. Semina Ci agr 49:845–856. 10.22456/1679-9216.109822
- 95.Cavalcante FRA, Andrioli A, Pinheiro RR, de Souza KC, Veras AKA, Lopes TA, Sousa SD, da Silva PAF. Detecção do vírus da Artrite Encefalite Caprina por nested PCR e nested RT-PCR em ovócitos e fluido uterino. Arq Inst Biol. 2013;80:381–386. doi: 10.1590/S1808-16572013000400002. [DOI] [Google Scholar]
- 96.Álvarez V, Daltabuit-Test M, Arranz J, Leginagoikoa I, Juste RA, Amorena B, de Andrés D, Luján LL, Badiola JJ, Berriatua E. PCR detection of colostrum-associated Maedi-Visna virus (MVV) infection and relationship with ELISA-antibody status in lambs. Res Vet Sci. 2006;80:226–234. doi: 10.1016/j.rvsc.2005.05.008. [DOI] [PubMed] [Google Scholar]
- 97.Barquero N, Gomez-Lucia E, Arjona A, Toural C, las-Heras A, Fernández-Garayzabal JF, Domenech A. Evolution of specific antibodies and proviral DNA in milk of small ruminants infected by small ruminant lentivirus. Viruses. 2013;5:2614–2623. doi: 10.3390/v5102614. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.de Andrés D, Klein D, Watt NJ, Berriatua E, Torsteinsdottir S, Blacklaws BA, Harkiss GD. Diagnostic tests for small ruminant lentiviruses. Vet Microbiol. 2005;107:49–62. doi: 10.1016/j.vetmic.2005.01.012. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Not applicable.



