Abstract
Paracoccidioidomycosis is an infection with the potential for environmental dissemination, especially in regions of hot and humid climate, where human cases have been recorded in the Southwestern Amazon of Brazil, specifically in the state of Acre. Despite studies providing information about the presence of these fungi in soil and animal samples, such as armadillos, further investigations are still needed to determine the epidemiological distribution of the genus Paracoccidioides. The aim of this study was to detect the occurrence of Paracoccidioides fungi in the Southwestern Amazon. To achieve this, 60 soil samples were collected from armadillo burrows on rural properties in the in the municipalities of Acrelândia, Bujari, Plácido de Castro, Rio Branco, Sena Madureira, and Senador Guiomard, located in the state of Acre, Brazil. Fungal DNA was extracted from these samples using the DNEASY® PowerSoil kit—Quiagen, followed by Nested PCR technique with ITS4 and ITS5 as external primers, and PBITS-E and PBITS-R as internal primers. DNA amplification products of about 380 bp compatible with Paracoccidioides spp. were detected in six samples (10%), being sequenced and identified as P. brasiliensis. These findings indicate that the soils of the Acre state could be considered a potential source for Paracoccidioides spp., suggesting that local infections are likely.
Supplementary Information
The online version contains supplementary material available at 10.1007/s42770-024-01256-7.
Keywords: Brazil, Acre, Armadillo, Paracoccidioidomycosis, P.brasiliensis
Introduction
Paracoccidioidomycosis (PCM) is a systemic mycosis caused by the genus Paracoccidioides, which currently comprises seven distinct species: P. brasiliensis (S1a and S1b), P. americana (PS2), P. restrepiensis (PS3), P. venezuelensis (PS4), P. lutzii, P. lobogeorgii, and P. cetii [1, 2]. This fungus is widely distributed in Latin America, with a higher incidence in Brazil, Colombia, and Venezuela [1, 2].
In Brazil, approximately 80% of cases occur in the South, Southeast, and Midwest regions, where the mortality rate is 1.45 cases per million inhabitants [3]. In recent years, PCM has undergone notable changes in its epidemiology and demographics of the affected population [4]. These transformations have been driven by the expansion of agricultural activities as well as the intense migration process, becoming relevant factors for the spread of the disease in the northern region of Brazil [4].
In the Amazon region, the states of Rondônia and Tocantins have reported the presence of the genus Paracoccidioides in environmental areas, suggesting favorable conditions for the growth and survival of this fungus [5, 6]. Furthermore, this same region has been identified as a new hyperendemic area, with cases of the disease reported in Rondônia and along the eastern border of the Amazon region, encompassing the states of Pará and Tocantins [4].
In the state of Acre, PCM still remains an underestimated disease. However, the identification of its presence in the region has gained greater prominence based on recent studies. An epidemiological survey identified 114 cases of the disease [7]. Additionally, molecular investigations conducted on 35 clinical samples from patients initially diagnosed with lobomycosis (Lacazia loboi) revealed notable similarities with the genus Paracoccidioides, leading to the classification of a new cryptic species: P. lobogeorgii [2, 8].
These findings indicate the epidemiological significance of the disease in the state of Acre. However, the presence of this fungus in environmental areas is still undetermined. Consequently, the identification of risk areas will contribute to a better understanding of the biogeography of the genus Paracoccidioides [5]. Thus, this study aimed to perform the molecular detection of Paracoccidioides spp. in environmental samples from the South Western Amazon.
Materials and methods
Selection of the study areas and environmental samples collection
Soil samples from armadillo burrows were collected in the municipalities of Acrelândia, Bujari, Plácido de Castro, Rio Branco, Sena Madureira, and Senador Guiomard, located in the state of Acre, Brazil. In each of the six study municipalities, ten soil samples were collected from different rural properties, totaling sixty samples (Fig. 1 and Table SI1). The collection of approximately 50g of soil was performed using an iron-shafted shovel to scrape the inner part of the burrows. During this process, the shovel was decontaminated with 70% v/v ethanol solutions before each sampling to prevent cross-contamination. Subsequently, the soils were placed in sterile universal containers, labeled, and stored in isothermal boxes at room temperature.
Fig. 1.
Collection areas of soil samples in the Southwestern Amazon. Geographic location of the collection site. Graphics program: QGis 2.18
DNA extraction
The samples underwent total deoxyribonucleic acid (DNA) extraction using the DNeasy PowerSoil kit (QIAGEN, Germany). The total DNA was suspended in nuclease-free water and quantified using a NanoVue spectrophotometer (GE Healthcare®) [5]. Polymerase chain reactions (PCR) were conducted targeting the universal fungal region of the rRNA ITS1-5.8S-ITS2 (Internal Transcribed Spacer) using the external primers ITS-4 and ITS-5 (Table 1) [9].
Table 1.
Primer sequences and PCR conditions used to detect Paracoccidioides spp. DNA in soil samples Southwestern Amazon [9, 10]
| PCR procedure | Primer | Sequence | PCR conditions |
|---|---|---|---|
| PCR | ITS4 | TCCTCCGCTTATTGATATGC | Initial cycle: 95°C/5 min. + 35 cycles: 95°C/50 seg. + 55°C/50 min. + 72°C/ 50 min. + final cycles: 72°C/5 min |
| ITS5 | GGAAGTAAAAGTCGTAACAAGG- | ||
| Nested PCR | PbITS-E | GAGCTTTGACGTCTGAGACC | Initial cycle: 95°C/5 min. + 35 cycles: 95°C/ 45seg. + 55°C/ 50 min + 72°C/ 50 min. + final cycles: 72°C/5 min |
| PbITS-R | AAGGGTGTCGATCGAGAGAG |
Subsequently, the Nested-PCR technique was performed using the product from the first reaction, employing the internal primers PbITS-E (sense) and PbITS-R (antisense), specific to P. brasiliensis (Table 1) [10]. Genomic DNA from P. brasiliensis (T19F33) [11], isolated from a Dasypus novemcinctus and provided by the Department of Microbiology and Immunology, Institute of Biosciences, Botucatu, São Paulo State University (UNESP), served as the positive control, and nuclease-free water was used as the negative control. The samples were considered positive upon identification of the PCR product via agarose gel electrophoresis (1.5%).
Phylogenetic analysis
To confirm the specificity of the amplicons, the PCR products were sequenced using the Sanger sequencing method (ACTGene Molecular Analyses Ltda, Porto Alegre, RS, Brasil), using the automatic sequencer ABI-Prism 3500 Genetic Analyzer (Applied BiosystemsTM, Foster City, CA, EUA). The obtained sequences were identified as P. brasiliensis and stored in the GenBank database (accession number: OQ456013, OQ456014, OQ456015, OQ456016, OQ456017, OQ456018).
The sequences were analyzed and aligned using a Multiple sequence alignment program (MAFFT®) software version 7.0 [12]. The similarity between the strains was determined using the Basic Local Aligment Search Tool (BLAST®) on the website of National Center for Biotechnology Information (NCBI). The ModelFinder [13] in the IQ-TREE 2 software [14] was used to find the best-fit model for each gene according to the Bayesian Information Criterion (BIC).
The sequences generated in this study were subjected to analysis along with other sequences obtained using the BLAST tool (Table SI2). In addition, the organism L. loboi was included as an outgroup for comparative purposes. Subsequently, a phylogenetic tree was constructed using maximum likelihood methods. To assess the reliability of the branches in the phylogenetic tree, branch support values were utilized, measured through ultrafast bootstrap (UFBoot) and approximate likelihood ratio test (SH-aLRT).
Results
An amplicon (approximately 380 bp) consistent with Paracoccidioides spp. was observed in six (10%) of the analyzed samples (Table SI1). In the municipality of Plácido de Castro, four samples (66.60%) were recorded, and one (16.60%) each in the municipalities of Acrelândia and Senador Guiomard. The six environmental amplicons obtained were subjected to sequencing and then compared with previously deposited sequences in GenBank. The results revealed 100% identity with P. brasiliensis. Furthermore, phylogenetic analysis of the amplicons associated with P. brasiliensis exhibited significant genetic variability (Fig. 2).
Fig. 2.
Phylogenetic tree of Paracoccidioides based on ITS sequences obtained by maximum likelihood using the Bayesian Information Criterion. Graphics program: ModelFinder in the IQ-TREE 2 software
Discussion
This study represented the first detection of P. brasiliensis in soil samples from rural areas of the state of Acre. These samples tested positive in three different municipalities, indicating a widespread distribution of the fungus in the investigated region. This suggests that the local population is significantly exposed to this fungus and, consequently, at risk of infection. These findings are in agreement with previous studies that documented Paracoccidioides spp. infection and cases of the disease in patients treated at healthcare facilities in the state [2, 8].
Molecular detection in soil samples was positive in the municipalities of Acrelândia, Plácido de Castro, and Senador Guiomard, but negative in Bujari, Rio Branco and Sena Madureira. The highest detection rate of Paracoccidioides spp. was identified in samples from Plácido de Castro (Table SI1). However, it is important to note that these samples were collected during a period of lower rainfall, which may suggest that the fungus exhibits greater resistance to adverse environmental conditions in this region [5].
The genus Paracoccidioides has the soil as its natural reservoir but can infect accidental hosts such as humans, domestic, and wild animals. Among these animals, the armadillo stands out for having a less active immune system and lower body temperature, factors that make them more susceptible to infection by this fungus [15]. Furthermore, these animals have a habit of digging for food and living underground, which increases their exposure to the fungus present in the environment [15].
Paracoccidioides spp. was detected in soil samples from armadillo burrows. Previous studies have also reported similar findings in Rondônia, Goiás, and Tocantins [5, 6]. These investigations reinforce the hypothesis that abiotic factors within the armadillo burrow, such as temperature, humidity, and protection from solar radiation, favor the development of the fungus. Consequently, these factors are considered suitable for mapping the geographical distribution of the fungus in the environment [16].
The samples were collected from soil in rural properties engaged in cattle farming and family agriculture. In the municipalities where the detection of Paracoccidioides was positive, approximately 50% of their territories are deforested, with cattle farming being the main economic activity [17]. These results reinforce the hypothesis that agricultural expansion with deforestation of preserved areas exposes the soil and alters its physicochemical characteristics, favoring the emergence of new endemic areas of the disease in the Amazon region [5].
The isolation of Paracoccidioides spp. from soil is a significant challenge, as the diversity of saprophytic fungi in these samples, along with the use of pesticides, can inhibit the growth and identification of these microorganisms under laboratory conditions [18]. With this perspective, molecular techniques have shown promise in documenting the occurrence of this fungus in the environmentt.
In this study, molecular methods were employed, resulting in the detection of six (10%) samples identified as P. brasiliensis. Similar results have also been found in other states, such as São Paulo (10%) and Tocantins (6.66%) [6, 11]. The PCR and Nested-PCR techniques exhibit high sensitivity and specificity, allowing for the identification of the fungus in environmental samples with low DNA concentrations. This contributes to the detection of this genus in various regions [5, 19].
Although the ITS region is not useful for distinguishing different species of the Paracoccidioides genus, the observation of P. lutzii clustered in a distinct clade suggests that the six amplicons in this study belong to the P. brasiliensis species. Previous studies suggest that P. lutzii is composed of a single monophyletic and recombined population, identified in Ecuador as well as in the Central-West and Northern regions of Brazil [19].
On the other hand, P. brasiliensis encompasses a complex of different cryptic species, such as P. brasiliensis (S1a and S1b), P. americana, P. restrepiensis, P. venezuelensis, P. lobogeorgii, and P. ceti [1, 2]. It is relevant to highlight that the species P. lobogeorgii has been predominantly identified in the state of Acre, as well as in São Paulo, Brazi [2]. Given this diversity of species, it is suggested that future studies utilize the ADP-ribosylation factor (ARF) and the 43kDa immunodominant glycoprotein (GP43) genes to analyze samples from this region, to determine the predominant cryptic species in the Southwestern Amazon [20].
Conclusion
The estimate of PCM cases in the state of Acre may be underestimated. However, the detection of Paracoccidioides in 10% of the samples reinforces the hypothesis of a gradual expansion of this fungus over the years in the northern region of the country, possibly driven by the growth of agricultural activities. Furthermore, these findings also indicate favorable climatic conditions for the dispersion of the fungus in the Southwestern Amazon, suggesting that the local population is at risk of contracting the disease.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
We thank the Coordination for the Improvement of Higher Education Personnel (CAPES) and the Graduate Support Program (PROAP) for their support.
Author contributions
All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by [Iasminy R. Silva Ferreira], [Marcus de M. Teixeira], [Atilon V. de Araújo], [Eduardo Bagagli], [Hans G. Garces], [Leila P. Peters] and [Clarice M. Carvalho]. The first draft of the manuscript was written by [Iasminy R. Silva Ferreira] and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Funding
Partial financial support was received from the Coordination for the Improvement of Higher Education Personnel (CAPES) and the Graduate Support Program (PROAP).
Data availability
The data presented in this study are openly available in NCBI, accession number OQ456013, OQ456014, OQ456015, OQ456016, OQ456017, OQ456018.
Code availability
Not applicable.
Declarations
Ethics approval
Not applicable.
Informed consent
Informed consent was obtained from all individual participants reported in the study.
Consent to participate
Not applicable.
Consent for publication
Not applicable.
Conflict of interest
All authors declare that they have no conflicts of interest pertaining to this work.
Footnotes
Responsible Editor: Celia Maria de Almeida Soares
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Teixeira MM, Cattana ME, Matute DR, Muñoz JF, Arechavala A, Isbell K, Schipper R, Santioso G, Tracogna F, Sosa MA, Cech N, Alvarado P, Barreto L, Chacón Y, Ortellado J, Lima CM, Chango R, Vega GN, Shikanai-Yasuda MA, Felipe MSS, Giusiano G. Genomic diversity of the human pathogen Paracoccidioides across the South American continent. Fungal Genet Biol. 2020;140(1):1–28. doi: 10.1016/j.fgb.2020.103395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Vilela R, Hoog S, Bensch K, Bagagli E, Mendoza L. A taxonomic review of the genus Paracoccidioides, with focus on the uncultivable species. PLoS Negl Trop Dis. 2023;17(4):1–25. doi: 10.1371/journal.pntd.0011220. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Shikanai-Yasuda MA, Mendes RP, Colombo AL, Queiroz-Telles FD, Kono ASG, Paniago AM, Nathan A, Valle ACF, Bagagli E, Benard G. Brazilian guidelines for the clinical management of paracoccidioidomycosis. Rev Soc Bras Med Trop. 2017;50(5):715–740. doi: 10.1590/0037-8682-0230-2017. [DOI] [PubMed] [Google Scholar]
- 4.Martinez R. New trends in paracoccidioidomycosis epidemiology. J Fungi. 2017;3(1):1–13. doi: 10.3390/jof3010001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Arantes TD, Theodoro RC, Teixeira MM, Bosco SDMG, Bagagli E. Environmental mapping of Paracoccidioides spp. in Brazil reveals new clues into genetic diversity, biogeography and wild host association. PLoS Negl Trop Dis. 2016;10(4):1–18. doi: 10.1371/journal.pntd.0004606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Teixeira AGK, Yamauchi DH, Rossi A, Sousa HR, Garces HG, Júnior JL, Júnior AOS, Felipe MSS, Bagagli E, Junior HFA, Teixeira MM. Clinical and Eco-epidemiological aspects of a novel hyperendemic area of paracoccidioidomycosis in the Tocantins-Araguaia Basin (Northern Brazil) Caused by Paracoccidioides sp. J Fungi. 2022;8(5):1–11. doi: 10.3390/jof8050502. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Trompier RGE, Costa AR, Silva RSU (2020) Paracoccidioidomicose no estado do Acre, Brasil: aspectos epidemiológicos e clínicos. In: Silva RSU, Meneguetti DUO (org.) Ciências Médicas na Amazônia, 1º ed. Stricto Sensu, Rio Branco, pp 81–94. 10.35170/ss.ed.9786586283235.06
- 8.Taborda PR, Taborda VA, Mcginnis MR. Lacazia loboi gen. nov., comb. nov., the etiologic agent of lobomycosis. J Clin Microbiol. 1999;37(6):2031–2033. doi: 10.1128/jcm.37.6.2031-2033.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.White TJ, Bruns T, Lee S, Taylor JIMA. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR protocols: a guide to methods and applications. San Diego: Academic; 1990. pp. 315–322. [Google Scholar]
- 10.Theodoro R, Candeias JM, Araújo JP, Jr, Bosco SDMG, Macoris SADG, Junior LOP, Franco M, Bagagli E. Molecular detection of Paracoccidioides brasiliensis in soil. Med Mycol. 2005;43(8):725–729. doi: 10.1080/13693780500129418. [DOI] [PubMed] [Google Scholar]
- 11.Hrycyk MF, Garces HG, Bosco SMG, Oliveira SL, Marques AS, Bagagli E. Ecology of Paracoccidioides brasiliensis, P. lutzii and related species: infection in armadillos, soil occurrence and mycological aspects. Med Mycol J. 2018;56(8):950–962. doi: 10.1093/mmy/myx142. [DOI] [PubMed] [Google Scholar]
- 12.Steenwyk JL, Buida TJ, Shen XX, Rokas A. ClipKIT: a multiple sequence alignment trimming software for accurate phylogenomic inference. PLoS Biol. 2020;18(12):1–25. doi: 10.1371/journal.pbio.3001007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kalyaanamoorthy S, Minh BQ, Wong TK, Haeseler AV, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods. 2017;14(6):587–589. doi: 10.1038/nmeth.4285. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Nguyen LT, Schmidt HÁ, Haeseler AV, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol. 2015;32(1):268–274. doi: 10.1093/molbev/msu300. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Bagagli E, Bosco SDMG, Theodoro RC, Franco M. Phylogenetic and evolutionary aspects of Paracoccidioides brasiliensis reveal a long coexistence with animal hosts that explain several biological features of the pathogen. Infect Genet Evol. 2006;6(5):344–351. doi: 10.1016/j.meegid.2005.12.002. [DOI] [PubMed] [Google Scholar]
- 16.Bagagli E, Sano A, Coelho KI, Alquati S, Miyaji M, Camargo ZP, Gomes GM, Franco M, Montenegro MR. Isolation of Paracoccidioides brasiliensis from armadillos (Dasypus noveminctus) captured in an endemic area of paracoccidioidomycosis. Am J Trop Med Hyg. 1998;58(4):505–512. doi: 10.4269/ajtmh.1998.58.505. [DOI] [PubMed] [Google Scholar]
- 17.Programa Estadual de Zoneamento Ecológico Econômico do Estado do Acre (ZEE). http://semapi.acre.gov.br/wp-content/uploads/sites/20/2021/12/COMPLETO-Resumo-Executivo-do-ZEE-Acre-Fase-III_V16_WEB.pdf. Accessed Jun 2023
- 18.Macedo PM, Costa BSS, Paes RA, Trilles L, Oliveira RMZ, Valle ACF, Wanke B. Paracoccidioides brasiliensis habitat: far beyond armadillo burrows? Mem Inst Oswaldo Cruz. 2020;115(1):1–3. doi: 10.1590/0074-02760200208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Teixeira MM, Theodoro RC, Nino-Veja G, Bagagli E, Felipe MS. Paracoccidioides species complex: ecology, phylogeny, sexual reproduction, and virulence. PLoS Pathog. 2014;10(10):1–4. doi: 10.1371/journal.ppat.1004397. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Theodoro RC, Teixeira MM, Felipe MSS, Paduan KS, Ribolla PM, Blas GS, Bagagli E. Genus Paracoccidioides: species recognition and biogeographic aspects. PLoS One. 2012;7(5):1–15. doi: 10.1371/journal.pone.0037694. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data presented in this study are openly available in NCBI, accession number OQ456013, OQ456014, OQ456015, OQ456016, OQ456017, OQ456018.
Not applicable.


