Evaluating Bacillus flexus as bioremediators for ammonia removal in shrimp culture water and wastewater and characterizing microbial communities in shrimp pond sludge

Abstract

The accumulation of nitrogen compounds in shrimp farming water and effluent presents a major challenge. Ammonia is a form of nitrogen that limits shrimp growth due to its potential toxicity and effects on shrimp health and water quality. This study is aimed at identifying promising bioremediators from shrimp pond sludge to mitigate ammonia levels in both culture water and wastewater and at determining major bacterial communities in sludge using metagenomic analysis. A sludge sample was collected from a shrimp pond in Selangor, Malaysia, to isolate potential ammonia-removing bacteria. Out of 64 isolated strains, Bacillus flexus SS2 showed the highest growth in synthetic basal media (SBM) containing ammonium sulfate at a concentration of 70 mg/L as the sole nitrogen source. The strain was then incubated in SBM with varying pH levels and showed optimal growth at pH 6.5–7. After 24 h of incubation, B. flexus SS2 reduced the ammonia concentration from an initial concentration of 5 to 0.01 mg/L, indicating a 99.61% reduction rate, which was highest in SBM at pH 7. Moreover, the strain showed ammonia removal ability at concentrations ranging from 5 to 70 mg/L. Metagenomic analysis revealed that Proteobacteria was the most abundant phylum in the sludge, followed by Cyanobacteria, Actinobacteria, Chloraflexi, Firmicutes, and Campilobacterota. Bacillus flexus SS2 belongs to the Bacillota phylum and has the potential to serve as a bioremediator for removing ammonia from shrimp culture water and wastewater.

Introduction

Ammonia is one of the common nitrogenous pollutants in water, which comprises unionized ammonia (NH3) and ionized ammonia (NH₄⁺) [1]. Unionized ammonia (NH3) is highly toxic, and its concentration is affected appreciably by the changes in the pH levels of water. The more toxic unionized form (NH3) is more likely to form when the pH is higher, while ionized (NH4+) is more likely to form when the pH is lower. In shrimp culture, ammonia is generally found in the culture water and wastewater. Although nitrogen compound such as ammonia is considered beneficial for algae consumption, if present in a concentration higher than it should, the toxicity will cause mortality to the cultured shrimp, not to mention eutrophication which will result in the growth of many invading microorganisms [2].

Feed residues and nitrogenous wastes excreted by shrimp contribute mainly to the accumulation of ammonia. Generally, nitrogen utilization efficiency of feeds in shrimp culture is about 30%, while the remaining 70% is usually discharged into the environment [3]. A high concentration of ammonia in water will disrupt the dissolved oxygen level and can eventually lead to shrimp mortality [4]. Whenever the levels of ammonia in culture water exceed the desirable range, water replacement is one of the ways to control the concentration of ammonia [5]. However, in return, this will result in the build-up of a large volume of wastewater with a high concentration of ammonia, which cannot be discharged directly into the environment without proper treatment.

Currently, there are several biological and chemical methods for wastewater management. Land-based aquaculture wastewater is usually treated using settlement ponds; however, the efficiency is inconsistent, and the removal rate is too slow [6]. These methods are not environmentally friendly, costly, and often encounter challenges in large-scale applications [7].

Microbial-based technologies are one of the most viable methods in achieving sustainable aquaculture practice [8]. Microbial remediation using probiotics is currently gaining wide interest in managing water quality and preventing disease outbreaks in the aquaculture industry [9]. Bioremediation is the application of microorganisms to convert toxic components to harmless end products [10]. It is cost-effective and capable of eliminating contaminants without damaging the environment [11].

Sludge is formed due to large quantities of supplemental feed. The main components of sludge are uneaten feed, phytoplankton, decaying plant materials, animal wastes, sedimentary minerals, airborne debris, protozoa, bacteria, and fungi. Sludge will affect the habitat availability of cultured animals and produce toxic matters that can endanger the lives of aquatic animals. Despite this, the sludge from shrimp ponds is home to a variety of microbial communities and may contain beneficial bacteria that could function as bioremediators [12].

This research is aimed at isolating potential bioremediators from shrimp pond sludge which contains a high concentration of ammonia and is home to a wide range of microbial species. The isolated bacteria undergo a series of in vitro screening to determine their ability to remove ammonia under controlled conditions. Meanwhile, metagenomic analysis of shrimp pond sludge was also done to evaluate the composition of microbes.

Materials and methods

Media preparation

Synthetic basal media (SBM) containing an artificial source of ammonia was used in the in vitro reduction assay. The composition of ammonia in SBM (g/L) consists of 0.472 g of (NH₂)₄SO₄, 10 g of glucose, 0.104 g of NaCl, 2.15 g of Na₂HPO₄.12H₂0, 0.09 g of KH₂PO₄, and 3 mL of trace element solution. The trace element solution contained 0.3 g of MgSO₄.7H₂0, 0.1 g of MnSO₄, 0.112 g of H₃BO₃, 0.03 g of FeSO₄.7H2O, 0.06 g of CaCl₂, and 0.042 g of Na₂MoO₄.H₂O (per liter). The initial pH of the media was adjusted to natural pH7 [13]. The concentrations of (NH₄)₂SO₄ (sole nitrogen source) and glucose (carbon source) were adjusted depending on the requirement of the experiment while maintaining a C:N ratio (w/w) of 10.

For the isolation process and bacteria culture media, tryptic soy agar (TSA) and tryptic soy broth (TSB) supplemented with 1.5 % sodium chloride were used.

Sludge collection and isolation process

A sludge sample was collected from one of the shrimp ponds in Selangor, Malaysia. This earthen pond cultured Penaeus vannamei larvae as the primary species. Freshly harvested sludge was collected from the sludge canal on the same day the shrimp was harvested from the pond. The accumulated sludge was dewatered through compression using a filter cloth. A 0.1 g of dewatered sludge was homogenized and added with 900 μL of 1.5% saline before being diluted until 10⁻⁴. Then, 100 μL from each dilution (from 10⁰ until 10⁴) was pipetted onto TSA plates and spread evenly using a sterile hockey stick. All the plates were incubated overnight at 30 °C. Purification was done the next day to obtain a pure culture.

Bacteria morphology and characteristics

The colonies were differentiated based on their characteristics such as size, color, shape, margin, elevation, and texture.

Bacterial cultures

Pure isolates were sub-cultured on TSA supplemented with 1.5 % sodium chloride and incubated overnight at 30 °C. Before the experimental assay, bacteria were picked and inoculated in 30 mL of TSB with 1.5 % NaCl and incubated overnight at 30 °C with shaking. The next day, the culture was centrifuged for 10 min at 5000 rpm and resuspended with saline water. The concentration of bacterial cultures was adjusted to 10⁹ CFU/mL prior to use (concentration was selected based on the previous preliminary study, data not published).

Growth and tolerance of isolates in SBM media containing a high concentration of ammonia

A 0.1 mL of an overnight culture of isolates (10⁹ CFU/mL) was inoculated into 10 mL of SBM (1% inoculation) with an initial concentration of ammonia adjusted at 70 mg/L and incubated with shaking at 30 °C for 24 h. Samples were taken for absorbance reading at 600 nm using a spectrophotometer to observe the growth.

Identification of a potential bioremediator

The genomic DNA of the potential bioremediator was isolated using a Genomic DNA Mini Kit (Geneaid, Taiwan). The gene was amplified using the polymerase chain reaction method (PCR) with 16S universal primers; 8F (5′ AGAGTTTGATCCTGGCTCAG 3′) and 1429R (5′ ACG GCT CCT TGT TAC GAC TT 3′). The amplification of the DNA was performed using Eppendorf 5331 Mastercycler^R Gradient PCR thermal cycler (Eppendorf, Germany). The 16S rRNA amplification was performed by initial denaturation at 95 °C for 1 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing temperature of the primers at 55 to 65°C for 15 s, and extension at 72 °C for 1 min and 30 s with final extension at 72 °C for 10 min. Detection of a PCR product was performed using gel electrophoresis, where 12 μL of PCR amplicons was run on a 1% of agarose gel matrix with the addition of RedSafe Nucleic Acid Staining Solution (20,000x) (Labotaq, Spain) and 1 kb DNA ladder (GeneDireX, USA). The purification of PCR products and DNA sequencing was done by 1st BASE Laboratory Sdn. Bhd., Malaysia. The determined sequences were aligned and compared using the BLAST program (http://www.ncbi.nlm.nih.gov/blast/).

Effects of different pH levels on the growth and ammonia reduction rate

The pH level of SBM was adjusted to pH 6, pH 6,5, pH 7, pH 7.5, and pH 8, respectively, before being inoculated with 1% bacterial inoculum. The initial concentration of ammonia was adjusted to a minimum of 5 mg/L. Ammonia concentrations in the samples were measured using a spectrophotometric method [14] as described in the section ammonia analysis below after 24 h of incubation to determine ammonia reduction.

Removal rate at a different initial concentration of ammonia

The concentration of ammonia in SBM was adjusted to 5 mg/L, 10 mg/L, 15 mg/L, 20 mg/L, 25 mg/L, 30 mg/L, 40 mg/L, 50 mg/L, 60 mg/L, and 70 mg/L before inoculated separately with a potential bioremediator culture at 1% inoculation volume. The reduction of ammonia was analyzed within 24 h of incubation using similar analysis [14] as described in the section below.

Ammonia analysis

Ammonia analysis was carried out following Parson Method [14]. Samples collected were analyzed immediately. A 20 g of phenol was dissolved in 200 mL of 95% ethyl alcohol to make a phenol solution. Next, 1 g of sodium nitroprusside was dissolved with Milli-Q water to prepare a sodium nitroprusside solution. The oxidizing reagent was prepared by adding 100 mL of alkaline reagent (100 g of sodium citrate and 5 g of sodium hydroxide dissolved in 500 mL Milli-Q water) to 25 mL of sodium hypochlorite containing 1% of chlorine. For the standard solution, ammonium sulfate (NH₄)₂SO₄ was dehydrated beforehand in the oven at 70 °C for 2 h. Then, 9.433 g of the ammonium sulfate (NH₄)₂SO₄ was dissolved in 1 L of Milli-Q water (1000 mg/L). A series of standard solutions (0, 0.01, 0.03, 0.05, 0.07, 0.1, 0.3, 0.5, 0.7, and 1.0 mg/L) was prepared. For the procedure of ammonia analysis, 10 mL of standard solution and related samples was transferred into separate 25 mL volumetric flasks. Subsequently, phenol solution and sodium nitroprusside (400 μL each) were added to the samples and well-mixed before adding 1 mL of oxidizing solution. The samples were incubated at room temperature for 1 h, and the absorbance was determined using a spectrophotometer set to 640 nm.

Metagenomic analysis

The genomic DNA was extracted from a commercial kit by FastDNA™ Spin Soil Kit (MP Biomedicals, USA), and purified gDNA that passed the DNA quality control was amplified using locus-specific sequence primers for the bacterial 16S V3-V4 region. The forward primer was CCTACGGGNGGCWGCAG, and the reverse primer was GACTACHVGGGTATCTAATCC. All the PCR reactions were carried out with REDiant 2X PCR Master Mix (1st Base Laboratory, Malaysia), and the bacterial 16S rRNA gene of selected regions (16S V3–V4) was amplified using locus-specific primers; 28F 5′-GAGTTTGATCNTGGCTCAG-3′ and 519R 5′-GTNTTACNGCGGCKGCTG-3. The libraries were normalized and pooled according to the protocol recommended by Illumina and proceeded to sequence using the MiSeq 300 PE platform.

Paired-end reads were first removed from sequence adaptors and low-quality reads using BBDuk of the BBTools package. Then, the forward and reverse reads were merged using USEARCH v11.0.667. All sequences that are shorter than 150 bp or longer than 600 bp (sequenced on the MiSeq platform) were removed from downstream processing. Reads are then aligned with 16S rRNA (SILVA Release 132) or UNITE ITS database and inspected for chimeric errors using VSEARCH v2.6.2. After these quality assessment steps, reads were clustered de novo into OTUs at 97% similarity using UPARSE v11.0.667; rare OTUs with less than 2 reads (doubleton) which are often spurious are deleted from downstream processing. A single representative sequence from each OTU was randomly chosen, and Pynast was used to align and construct a phylogenetic tree against the SILVA 132 16S rRNA database. Taxonomic assignment of OTU was achieved using QIIME V1.9.1 against the Silva database 16S rRNA database.

Statistical analysis

Statistical analyses were performed using IBM SPSS Statistics 20 software. All data were in triplicated and analyzed with one-way analysis of variance (ANOVA). Turkey’s test was used for pairwise comparison of means. Results were expressed as the mean ± standard error of the mean (SEM), and statistical differences were considered significant at p < 0.05.

Results and discussion

Sludge collection and isolation process

In the isolation process, 64 bacteria were successfully isolated using TSA. These isolates were differentiated by observing their morphology. All isolates were used in the next screening phase.

Growth and tolerance of isolates in SBM media containing a high concentration of ammonia

Among 64 bacterial isolates, nine bacteria were able to grow in SBM containing ammonium sulfate (70 mg/L) as the sole nitrogen source (Fig. 1). Growth was observed within 24 h of inoculation for all isolates. Both SS2 and ZB2 isolates registered significantly higher growth (p < 0.05) at OD 600 readings of 0.472 and 0.423, respectively.

Fig. 1.

Growth of different bacterial isolates in synthetic basal media (SBM) after 24 h of incubation. Different alphabets indicate significant differences among treatments (p < 0.05)

The ability of potential bioremediators to grow in synthetic media with ammonia indicates that these strains were able to utilize ammonia as the sole nitrogen source for their nutrient requirements. In addition, the growth of the strains was not inhibited or affected by the presence of ammonia. Bacteria with bioremediation properties can utilize contaminants or toxic compounds as their main sources of energy and nutrients [15].

Identification of potential bioremediators

The potential bioremediator SS2 was identified using 16S rRNA sequencing. The results showed 99.14% similarity with B. flexus (Table 1). Bacillus sp. is generally associated with its good traits [16, 17]. They are common probiotics and bioremediators used in aquaculture [11]. Some species of Bacillus, e.g., Bacillus subtilis, Bacillus licheniformis, and Bacillus cereus, are commonly documented as suitable candidates for bioremediation as they possess good bioremediation characteristics. Bacillus subtilis strain A1 successfully completes the nitrogen cycle by converting ammonia to nitrogen gas in industrial wastewater treatment [17, 18]. Likewise, Bacillus vietnamensis strain VCM8 can significantly reduce total ammonia nitrogen in shrimp culture wastewater [19].

Table 1.

Identification of the SS2 isolate using 16s rRNA sequencing

	Description	Query cover	Similarity (%)	Accession number
SS2	Bacillus flexus strain IFO15715 16S ribosomal RNA, partial sequence	99%	99.14%	NR024691.1

Although Bacillus sp. is quite common in water, its concentration is often not sufficient to exert beneficial properties. Hence, they need to be added from an external source, which may increase their efficacy in bioremediating contaminants in water [11].

Earlier findings by Setyati et al. [20] documented that B. flexus strains C13 and C14 were capable of utilizing nitrogen in yeast extract supplemented with 4% molasses for their growth. Since then, there has been less research on these strains in the bioremediation aspects.

Effects of different pH levels on growth and ammonia reduction rate

Bacillus flexus SS2 showed significantly higher growth in more slightly alkaline conditions, optimally at pH 6.5 to 8 (Fig. 2). At pH 6 and below, the growth began to severely slow down, indicating that it cannot withstand an acidic environment. The optimum pH for biodegradation is known to be between pH 6.5 and pH 8.5 [21]. The changes in pH concentration will have an impact on microbial activity where the removal rate of ammonia or other toxic compounds may fluctuate accordingly.

Fig. 2.

Growth of Bacillus flexus SS2 in synthetic basal media (SBM) at different pH levels after 24 h of incubation. Different alphabets indicate significant differences among treatments (p < 0.05)

Ammonia occurs in its toxic state at a higher pH level, which indicates that SS2 has high susceptibility towards ammonia, and the growth did not get inhibited even in the presence of toxic ammonia. Generally, Bacillus grows optimally at neutral pH and several times better in alkaline conditions [22].

These findings correlated with Sheela et al. [1], showing that Bacillus sp. grew well in basal inorganic media up to pH 9. This implies that Bacillus sp. can grow at higher pH levels, where ammonia is in its toxic form. Bacillus sp. has a minimal growth rate at lower pH, suggesting that acidic conditions hindered their growth.

In general, bacteria grow optimally in certain pH ranges. Bacillus flexus SS2 may grow more vigorously at pH 6.5 than pH 6, as this is within their favored range. At pH 6.5, ammonia could be used by the bacteria more effectively, hence improving its food availability and facilitating higher growth. In addition, enzyme activities that are essential for bacterial metabolism are significantly influenced by pH [23]. These enzymes may function better around pH 6.5, which would help bacteria proliferate by improving their ability to utilize nutrients and produce energy.

Standard curve was constructed based on the absorbance obtained from ammonia standard solution prepared using ammonium sulfate (NH₂)₄SO₄ at concentrations 0, 0.01, 0.03, 0.05, 0.07, 0.1, 0.3, 0.5, 0.7, and 1.0 mg/L. It was used to determine the concentration of ammonia in mg/L unit based on the absorbance reading obtained from spectrophotometer.

The initial concentration of ammonia was set at 5 mg/L for all pH values. After 24 h incubation period, B. flexus SS2 was able to reduce ammonia concentration to 0.01 mg/L, which is 99.61% and recorded the highest in SBM at pH 7 for 1% inoculation (Fig. 3). The reduction was also observed in SBM at pH 6.5, 7.5, and 8, which is in line with the growth of B. flexus SS2 at these pH levels. An almost similar result was reported by Gogoi et al. [24], where Bacillus albus strain ASSF01 successfully reduced ammonia with an initial concentration ranging from 1.7 to 4.7 mg/L to 0.5 mg/L within 12–16 h of incubation.

Fig. 3.

Reduction rate of ammonia after inoculation with 1% of Bacillus flexus SS2 within 24 h. Different alphabets indicate significant differences among treatments (p < 0.05)

The correlation between the growth of SS2 in SBM media and the removal rate might be due to ammonia assimilation, where bacteria can directly utilize ammonia and transform it into cellular components [25]. Theoretically, this type of bioremediation agent has a higher efficiency to remove ammonia in the environmental sample.

Despite a noticeably slow growth rate, the significant reduction in ammonia (>60%) at pH 6 indicates that bacteria in this environment prioritize other mechanisms than growth, potentially involving ammonia transformation or assimilation. This research suggests that bioremediation techniques need to go beyond conventional growth-centric methods. Investigating the pH 6 metabolic adaptations of bacteria may reveal different ammonia reduction pathways and provide information for customized bioremediation techniques. Understanding the importance of stress responses and taking into account the dynamics of microbial communities may result in creative solutions that maximize environmental conservation efforts in situations where rapid bacterial growth is constrained.

Removal rate at different initial concentrations of ammonia

To investigate the growth and ammonia removal ability of SS2 at different concentrations, ammonia concentrations were varied from 5 to 70 mg/L in SBM at pH 7, with 1% inoculation, and observed for 24 h (Fig. 4). At 5 mg/L, a removal rate of 96.44% was recorded. Although the removal rate was slower as the ammonia concentration increased, removal was still observed at 70 mg/L. The growth of B. flexus SS2 was not inhibited by the high concentration of ammonia, indicating that the removal process could still occur, albeit at a slower rate and potentially beyond the 24-h timeframe [26].

Fig. 4.

Reduction rate of ammonia at different concentrations after inoculation with 1% of Bacillus flexus SS2 within 24 h. Different alphabets indicate significant differences among treatments (p < 0.05)

Metagenomic analysis

The summary of operational taxonomic unit (OTU) was at 263,000 with paired-end (PE) reads at 112,190. At the phylum level, OTU belonging to Proteobacteria recorded 23%, which was the most abundant phylum in the sludge. This was in line with a study by Pinnell and Turner [27], which stated that Proteobacteria is one of the common phyla found in a wastewater sample. Cyanobacteria was the second most abundant phylum with 15% OTU, followed by Actinobacteria (13 %), Chloraflexi (11 %), Firmicutes or also known as Bacillota (9 %), and Campilobacterota (8%) (Table 2).

Table 2.

Relative abundance of phylum and family levels in sludge samples

Phylum	Relative abundance (%)	Family	Relative abundance (%)
Proteobacteria	23	Cyanobiaceae	12.3
Cyanobacteria	15	Sulfurovaceae	9.1
Actinobacteria	13	Rhodobacteraceae	7
Chloroflexi	11	Anaerolineaceae	4.12
Firmicutes	9	Woeseiaceae	4
Campilobacterota	8	Peptostreptococcales-Tissierellales	3.79
Bacteroidota	6	Chloroplast	3.4
Desulfobacterota	3	Ilumatobacteraceae	3.04
Planctomycetota	3	Pirellulaceae	3
Synergistota	2	Nocardioidaceae	2.44
Deinococcota	1.8	Flavobacteriaceae	1.43
Dependentiae	1.3	Vibrionaceae	1.4
Myxococcota	0.9	Bacillaceae	1.22

At the family level, Cyanobiaceae made up the most with 12.3%, followed by Sulfurovaceae (9.1%), Rhodobacteraceae (7%), Anaerolineaceae (4.12%), Woeseiaceae (4%), Vibrionaceae (1.4%), and Bacillaceae (1.22%).

Two main genera fall under the family Bacillaceae, i.e., the genus Bacillus and Thalassobacillus. In this study, isolated Bacillus flexus SS2 belongs to the genus Bacillus and family Bacillaceae, indicating that this strain might be naturally present in the sludge but in a low concentration.

Biological treatment relies on the capability of microbes to decompose and remove toxic wastes. The waste components must offer favorable environmental conditions for the microbes to function. Sludge and wastewater contain natural biological food and nutrients that can support microbial growth, resulting in a diverse range of microbial species present in waste materials.

Xie et al. [28] reported that Bacillus amyloliquefaciens isolated from activated sludge retains bioremediation properties. Similar bacteria species isolated from industrial wastewater are also able to degrade ammonia within 24 h of the incubation period [29]. Bacillus sp. has a well-recognized capacity for breaking down pollutants, but these bacteria are not present in sufficient quantities naturally [30], necessitating their supply from an external source.

Conclusion

Bacillus flexus SS2, isolated from shrimp pond sludge, demonstrated the ability to grow in synthetic basal media (SBM) with a high concentration of ammonia (70 mg/L) using ammonium sulfate as the sole nitrogen source. Bacillus flexus SS2 exhibited significantly higher growth in SBM with pH values ranging between 6.5 and 7. Furthermore, the strain was capable of reducing ammonia concentration from 5 to 0.01 mg/L (99.61%) optimally in SBM at pH 7, and ammonia removal was observed even at concentrations as high as 70 mg/L. As a result, Bacillus flexus SS2 has the potential to serve as a bioremediator for removing ammonia from shrimp culture water and wastewater.

Funding

This research was funded by the Ministry of Higher Education Malaysia (MOHE) through SATREPS JICA-JST COSMOS (Continuous Operation System for Microalgae Production Optimized for Sustainable Tropical Aquaculture) 2016–2021.

Data availability

The datasets generated during the current study are not publicly available due to respect for people’s privacy but are available from the corresponding author on reasonable request.

Declarations

Conflict of interest

The authors declare no competing interests.