Abstract
Osthole (Ost) and icariin (Ica) are extracted from traditional Chinese medicine Cnidium monnieri and Epimedii Folium, respectively, and both exhibit estrogen-like biological activity. This study aimed to determine the efficacy and safety of combining Ost with Ica on the production performance of laying hens and to explore their possible mechanisms. The production performance, egg quality, residues of Ost and Ica in eggs, serum reproductive hormone levels, expression of ovarian reproductive hormone receptor, proliferation of granulosa cells in small yellow follicles (SYF), and progesterone secretion in large yellow follicles (LYF) related genes and proteins expression were detected. The results showed that adding 2 mg/kg Ost + 2 mg/kg Ica to the feed increased the laying rate, average egg weight, Haugh unit, and protein height of laying hens. Serum follicle-stimulating hormone (FSH), luteinizing hormone (LH), and progesterone (P4) levels increased, and the expression of ovarian estrogen receptor (ER), follicle-stimulating hormone receptor (FSHR), and progesterone receptor (PGR) mRNA was up-regulated. Additionally, the mRNA and protein levels of steroidogenesis acute regulatory protein (StAR), cytochrome P450 side-chain cleavage (P450scc), and 3β-hydroxysteroid dehydrogenase (3β-HSD) increased in LYF. Furthermore, mRNA and protein levels of proliferating cell nuclear antigen (PCNA), cyclin E1, and cyclin A2 were up-regulated in SYF. The residues of Ost and Ica in egg samples were not detected by high-performance liquid chromatography (HPLC). In conclusion, dietary supplementation of Ost and Ica increased granulosa cells proliferation in SYF and increased P4 secretion in granulosa cells of LYF, ultimately improving the production performance of laying hens.
Key words: osthole, icariin, laying hen, production performance, progesterone, granulosa cell
INTRODUCTION
The rapid development of the egg industry has sparked increases in egg yield and quality. To boost egg production, people have resorted to the usage of drugs such as amoxicillin and ciprofloxacin to prevent avian infectious diseases (Xu et al., 2020). However, this practice results in the presence of drug residues in eggs (Hassan et al., 2021). Moreover, the excessive and inappropriate use of antibiotics can lead to the accumulation of harmful residues in the edible parts of poultry, which poses a potential toxic threat to humans. Due to the ban on the use of antibiotics in poultry feed, there is a global search for alternative methods to improve both the quantity and quality of eggs.
It is widely believed that supplementation of natural phytochemicals in diets can improve the health of farm animals and increase economic returns (Yu et al., 2023). Osthole (Ost) (Figure 1), a coumarin compound from the fruit of Cnidium monnieri, has anti-inflammatory, antioxidant, antibacterial, antipruritic, and neuroprotective effects (Sun et al., 2021). Progesterone receptor (PGR), estrogen-related receptor alpha (Erα), and estrogen-inducible protein (PS2) are estrogen-responsive genes used to detect the estrogenic activity of phytochemicals in MCF-7 human breast cancer cells (Castoria et al.,1999; Dunbier et al., 2010). Ost has been reported to significantly up-regulate the mRNA levels of PGR, ERα, and PS2 in MCF-7 breast cancer cells (Jia et al., 2016). Epimedii Folium has been widely used for thousands of years in China to treat infertility. Icariin (Ica) (Figure 2), extracted from Epimedii Folium, is considered the main active ingredient. Studies have shown that Ica has a significant role in protecting the nervous system, anti-inflammatory, anti-osteoporosis, and improving the reproductive system (He et al., 2020). Aromatic enzymes encoded by the cytochrome P-450 17α-hydroxylase-17,20-lyase (CYP17) and 17α-hydroxylase (CYP19) genes are key enzymes in estradiol (E2) and progesterone (P4) formation (Akhtar et al., 2011). Previous studies have shown that many bioactive compounds play a role by regulating the expression of CYP17 and CYP19, resulting in E2 and P4 effects. Ica can promote the secretion of E2 and P4 by up-regulating the expression of CYP17 and CYP19 in rat ovarian granulosa cells (Nie et al., 2019). Consequently, it is speculated that Ost and Ica may regulate the reproductive activity of laying hens.
Figure 1.
Chemical structure of Ost.
Figure 2.
Chemical structure of Ica.
Granulosa cells in poultry are involved in the regulation of the initiation of primordial follicles, the development of growing follicles, the selection of dominant follicles, and the ovulation of mature follicles (McGee and Hsueh, 2000). Proliferating cell nuclear antigen (PCNA) is produced in the process of cell mitosis, and its expression correlates with cell cycle regulators and proliferation. The higher PCNA expression indicates faster cell proliferation (Calderón et al., 2017). Different stages of the cell cycle are regulated by corresponding cyclins and their chaperone cyclin-dependent kinases (CDKs). Cyclin E-CDK2 promotes the G1 phase to the S phase, while cyclin A-CDK1 promotes DNA synthesis in the S phase (Boonstra, 2003; Johnson and Skotheim, 2013). PCNA works with cyclin E-CDK2 and cyclin A-CDK1 complexes during cell proliferation (Zhao et al., 2014; Koundrioukoff et al., 2000).
Progesterone (P4) is a hormone secreted by the ovary that acts directly on the ovulation of follicles in females (Nakada et al., 1994). P4 is only synthesized and secreted by graded follicular granulosa cells in hens (Huang et al., 1979). By steroidogenesis acute regulatory protein (StAR) firstly, cholesterol (CHOL) was transferred from the outer mitochondrial membrane to the inner mitochondrial membrane. Subsequently, CHOL was catalyzed by cytochrome P450 side-chain cleavage (P450scc) to synthesize pregnenolone (P5), which is converted to progesterone by 3β-hydroxysteroid dehydrogenase (3β-HSD) (Lee et al., 1998).
Our previous studies have shown that icariin can promote the proliferation of granulosa cells in the small yellow follicles (SYF) of laying hens by enhancing the S phase of the cell cycle. Furthermore, Ost significantly increases the expression of StAR, P450scc, and 3β-HSD genes and proteins in cultured granulosa cells, promoting P4 secretion (Sun et al., 2020). Based on these findings, it is suggested that Ost and Ica may act at different stages of follicular development in laying hens, promoting follicular development. This study aims to explore the clinical efficacy of combining Ost and Ica in laying hens and to explore its mechanism.
MATERIALS AND METHODS
Animals and Experimental Protocol
A total of 2,000 laying hens, 40-week-old Jinghong No.1 were placed in cages sizes of 60 cm × 60 cm × 40 cm having 8 birds per cage, and randomly divided into 5 treatment groups (4 replicates per treatment, 100 birds per replicate). The normal control group (NC) was fed as a basal diet, and the low (LG), medium (MG), and high (HG) dose groups were fed as a basal diet supplemented with 2 mg/kg Ica + 2 mg/kg Ost, 20 mg/kg Ica + 20 mg/kg Ost, and 100 mg/kg Ica + 100 mg/kg Ost respectively. The positive control group (PC) was fed a basal diet supplemented with 0.7 g/kg Danjibao. The detailed composition and nutrient concentration of the basic diet are presented in Table 1. The basic diet was formulated feed, provided by Qingdao Huanshan Biotechnology Co., Ltd (Shandong, China). The Ost (purity 90.6%) and Ica (purity 96.37%) were purchased from Nanjing Bencao Yikang Biotechnology Co., Ltd (Jiangsu, China). The Danjibao was purchased from Qingdao Zhongren Animal Medicine Co., Ltd (Shandong, China). During the experiment, hens were free to feed and drink. The temperature of the laying room was 26°C to 28°C, humidity was 60 to 70%, and the provided light was 17 h/d. The experiment was administered for 10 d, and observation was continued for 30 d from the first day of administration. Eggs were collected at 1 pm hrs every day and weighed once to calculate the egg production rate, average egg weight, average daily egg production, and broken soft shell rate. Feed intake was calculated every 10 d to calculate the ratio of feed to egg. Egg quality was measured on the 5th, 10th, 20th, and 30th days of the experiment respectively. Ost and Ica residues in eggs were detected on the 10th day of the experiment. Every 10 d, 8 laying hens were randomly selected from each group to measure body weight, collected wing vein blood, and then collected serum for subsequent testing. On the 30th day of the experiment, 8 laying hens were selected from each group and sacrificed by cervical dislocation. The ovaries, uterus, oviducts, SYF, and LYF were collected for further detection. All procedures adapted to the experiment were approved by the Animal Ethics Committee of Shanxi Agricultural University, Shanxi, China. The animal welfare number was SXAU-EAM-2021C0510-01.
Table 1.
Basic feed composition and nutritional level.
| Items | Content |
|---|---|
| Ingredient | % |
| Corn | 61.08 |
| Soybean meal | 17.00 |
| CaHPO4 | 1.12 |
| Limestone | 8.50 |
| NaCl | 0.30 |
| Soybean oil | 1.00 |
| DDSG | 10.00 |
| Premix1 | 1.00 |
| Total | 100 |
| Nutrient levels2 | |
| ME, MJ/kg | 11.10 |
| Crude protein% | 16.04 |
| Calcium% | 3.67 |
| Nonphytate P% | 0.39 |
| Lysine% | 0.80 |
| Methionine% | 0.63 |
Provided pre kilogram of diets: VA 9000 IU, VD3 1300 IU, VE 150 IU, VK3 5 mg, VB1 2 mg, VB2 4 mg, VB6 6 mg, VB12 0.01 mg, Biotin 0.1 mg, Pantothenic acid 10 mg, Niacin 40 mg, Folic acid 1 mg, Manganese 60 mg, Copper 6.5 mg; Iron 30 mg; Zinc 45 mg, Selenium 0.5 mg.
The nutrient level is the calculated value.
Determination of Production Performance and Egg Quality
Egg production rate, feed intake, feed-egg ratio, and broken soft shell rate were calculated. The calculations were as follows. Egg production rate (%) = total egg production during the statistical period / (number of laying hens × statistical days) × 100%. Average egg weight (g) = total egg weight during the statistical period / total egg number during the statistical period. Average egg production (g) = total egg production during the statistical period / (number of breeding hens × statistical days) × 100%. Average feed intake (g) = total feed intake/number of laying hens. Feed-egg ratio = total feed consumption / total egg weight. Broken soft shell rate (%) = daily broken soft shell number / daily egg number × 100%.
From each experimental group, the number of 20 eggs were randomly collected and placed at room temperature for 24 h to detect egg quality. Eggshell strength (kgf) was measured using an eggshell strength tester (EFR-1, ORKA, Israel). Eggshell thickness was measured using an eggshell thickness meter (NFN380, FHK, Japan). The thickness of the blunt, middle, and sharp ends of the eggshell was measured respectively, and the average value was calculated to find out the thickness of the eggshell. The horizontal and vertical diameters of the eggs were measured using a vernier caliper, and the ratio of the vertical diameter to the horizontal diameter was the egg shape index. An eggshell color analyzer (QCR-SC, TSS, UK) was used to detect the blunt, middle, and sharp-end eggshell color respectively, and the average value was taken. The Haugh unit, albumen height, and yolk color were measured by a multifunctional egg quality analyzer (EA-01, ORKA, Israel).
Determination of Body Weight, Reproductive Organ Index, and Follicle Count of Laying Hens
The weight of laying hens was measured by electronic balance (accurate to 0.1 g). The uterus, ovaries, and oviducts were also weighed using an electronic balance (accurate to 0.01 g) to calculate the uterus index, ovaries index, and oviducts index. The number of LYF (diameter > 10 mm) and SYF (diameter 5–10 mm) were calculated.
Detection of Ost and Ica Residues in Eggs
On the 10th day of the experiment, 12 eggs were randomly selected from each experimental group, shelled and homogenized, and frozen at −80°C. Eggs were thawed at room temperature, 1 ± 0.02 g egg liquid was weighed and placed in a 10 mL centrifuge tube, and 4 mL 80% acetonitrile-water solution was added to the centrifuge tube, vortexed for 30 s, oscillated for 10 min, and finally centrifuged at 12,000 rpm and 4°C for 10 min. The 2 mL supernatant was transferred to another 10 mL centrifuge tube, and 2 mL n-hexane was added to mix it well. Then 2 mL methanol was added, shaken well, and centrifuged at 10,000 rpm and 4°C for 10 min. Finally, 1 mL of the lower liquid was taken and filtered by 0.22 μm filter membrane for HPLC determination. The same batch of Ost and Ica (1 ± 0.02 mg) were accurately weighed and added to 1 g of uniform egg liquid samples, respectively. After vortex mixing, the samples were extracted and purified according to the preparation method of the sample solution, and positive sample solutions were prepared for high-performance liquid chromatography (HPLC) detection.
The chromatographic conditions were set according to the methods in the chapters of Cnidium Monnieri and Epimedii Folium in the Veterinary Pharmacopoeia of the People's Republic of China. Ost chromatographic conditions: C18 chromatographic column (250 mm × 4.6, 5 μm); the mobile phase A was acetonitrile, the mobile phase B was water, A: B = 30: 70; flow rate was 1 mL/min; injection volume was 10 μL; column temperature was 30°C; and detection wavelength was 270 nm. Ica chromatographic conditions: C18 chromatographic column (250 mm × 4.6, 5 μm); mobile phase A was acetonitrile, mobile phase B was water, A: B = 65: 35; flow rate was 1 mL/min; injection volume was 10 μL; column temperature was 30°C; and detection wavelength was 322 nm.
Determination of Reproductive Hormone Content in the Serum of Laying Hens
After the blood was collected from the wing vein, serum was collected by centrifugation at 3,000 rpm for 10 min. The contents of FSH, P4, LH, and E2 in serum were determined by ELISA. The kit used was a commercial kit (Shanghai Enzyme Linked Biotechnology Co., Ltd., Shanghai, China).
RNA Extraction and RT-qPCR
Total RNA was extracted from SYF, LYF, and ovaries by the TRIzol method. The extracted RNA was reverse transcribed into cDNA according to the instructions of the TaKaRa 2-step reverse transcription kit. The CDS region sequences of chicken β-actin, StAR, 3β-HSD, P450scc, PCNA, cyclin E1, cyclin A2, ER, LHR, FSHR, and PGR genes were searched in the NCBI database. The primers were designed by Prime Premier 5 and synthesized by Beijing Qingke Biotechnology Co., Ltd (Beijing, China). The primer sequences are shown in Table 2. RT-qPCR reaction was established in the ABI 7500 Real-Time PCR system with β-actin as an internal reference gene and a 10-fold diluted cDNA sample as a template. The relative expression levels of StAR, 3β-HSD, P450scc in LYF, PCNA, cyclin E1, and cyclin A2 in SYF and ER, LHR, FSHR, PGR mRNA in ovaries were detected respectively.
Table 2.
Primer sequences.
| Gene | Primer Sequences (5′– 3′) | Product length, bp | cDNA reference |
|---|---|---|---|
| β-actin | F: ATGAAGCCCAGAGCAAAAGA | 223 | NM_205518 |
| R: GGGGTGTTGAAGGTCTCAAA | |||
| StAR | F: AGGGTTGGGAAGGACACTCT | 200 | NM_204686 |
| R: ATACATGTGGGGCCGTTCTC | |||
| 3β-HSD | F: GCTTTGCCTTGGAGTCTGTG | 277 | D43762 |
| R: TCGGTGCTCTTGCGTTGC | |||
| P450scc | F: TCCGCTTTGCCTTGGAGTCTGTG | 112 | NM_001001756 |
| R: ATGAGGGTGACGGCGTCGATGAA | |||
| PCNA | F: ATGGGCGTCAACCTAAACAG | 182 | NM_204170 |
| R: ATTCCAAGCTGCTCCACATC | |||
| cyclin E1 | F: TATCCACCAAAGTTGCACCA | 247 | NM_001031358 |
| R: CCAGCACACAGAGATCCAAG | |||
| cyclin A2 | F: GTGCCAGACTATGTCAGCGA | 112 | NM_205244 |
| R: CCCGCATGTTGTTGGTGATG | |||
| ER | F: GCGACATGTACGTGGAAAGC | 145 | NM_205183 |
| R: AGGCTGCTTGACCCAAAAGA | |||
| LHR | F: AACGAATCGCTGACACTCAAA | 126 | NM_204936 |
| R: GTTGTGTATCCGCCTGAGGT | |||
| FSHR | F: ATGGAACCTGCCTGGATGAG | 101 | NM_205079 |
| R: ATCCAAAACAACAGGCCCGA | |||
| PGR | F: GTGTCGCTTGAGGAAGTGCTGT | 116 | NM_205262 |
| R: CGGCTGGCTGCTGAAGTGC |
Western Blot
The total protein of SYF and LYF was extracted respectively, and protein concentration was detected by the BCA protein concentration detection kit. Then 30 μg protein was added to 10% SDS-PAGE for separation and transferred to the PVDF membrane. The membrane was then blocked with Tris-buffered Tween 20 (TBST) with 5% nonfat dry milk. Add the corresponding detection protein antibody (GAPDH diluted by 1: 10000, StAR, P450scc, 3β-HSD, PCNA, cyclin A2, cyclin E1 diluted by 1: 1000), incubated overnight at 4°C. The corresponding secondary antibody was added at 1: 20,000. After incubation of the secondary antibody, each time the PVDF membrane was washed 3 times with TBST for 10 min each time. In the final, proteins of interest were detected using an enhanced chemiluminescence system (Boster, Wuhan, Hubei, China). Image J. software was used to analyze the gray scales of Western blot images.
Statistical Analysis
The data were expressed as mean ± SEM and analyzed using one-way ANOVA. Tukey's Multiple Comparison Test was implemented in GraphPad Prism 5 software (GraphPad Software, San Diego, CA). Possibility values < 0.05 were taken to indicate statistical significance.
RESULTS
Production Performance
Analyzing these data, it was showed that Compared with the NC, the laying rate of the LG was significantly increased on 16 to 27th days of the experiment (P < 0.05), and the MG was significantly increased on 22 to 30th days of the experiment (P < 0.05) (Table 3). Throughout the entire test period, the average daily egg production rate of LG and MG was 2.65% and 2.07% higher than the NC (P < 0.05) (Table 3). Additionally, the average daily egg production and average egg weight of the LG were significantly higher than those of the NC (P < 0.05) (Table 4).
Table 3.
The effect of Ost combined with Ica on laying hens' egg production rate (%).
| Normal control | LG | MG | HG | Positive Control | P-value | |
|---|---|---|---|---|---|---|
| 3 d | 87.57 ± 1.23 | 89.62 ± 1.41 | 87.83 ± 1.20 | 86.96 ± 2.02 | 88.56 ± 0.26 | 0.687 |
| 6 d | 86.50 ± 0.77b | 91.36 ± 1.38a | 89.46 ± 1.89ab | 89.85 ± 0.84ab | 88.80 ± 0.85ab | 0.019 |
| 9 d | 89.40 ± 0.47 | 89.27 ± 0.91 | 90.69 ± 1.00 | 88.37 ± 0.62 | 90.74 ± 0.97 | 0.268 |
| 12 d | 87.79 ± 0.63 | 90.11 ± 0.80 | 89.21 ± 1.29 | 88.78 ± 0.93 | 89.00 ± 0.74 | 0.592 |
| 15 d | 87.88 ± 0.80 | 89.09 ± 0.81 | 87.63 ± 0.51 | 87.49 ± 1.40 | 88.42 ± 0.77 | 0.719 |
| 18 d | 86.32 ± 0.18b | 89.83 ± 1.21a | 88.69 ± 0.86ab | 89.24 ± 0.62a | 90.11 ± 0.90a | 0.045 |
| 21 d | 88.88 ± 0.78b | 92.83 ± 1.32a | 90.85 ± 0.84ab | 90.62 ± 0.83ab | 89.52 ± 0.51b | 0.036 |
| 24 d | 87.58 ± 0.76c | 91.67 ± 0.68ab | 91.93 ± 0.82a | 88.92 ± 1.12bc | 90.51 ± 0.85ab | 0.020 |
| 27 d | 87.69 ± 0.73b | 91.04 ± 0.98a | 90.49 ± 0.76a | 89.37 ± 0.28ab | 89.17 ± 0.67ab | 0.040 |
| 30 d | 86.63 ± 0.44c | 87.90 ± 0.45bc | 90.12 ± 0.61a | 88.81 ± 0.26ab | 89.16 ± 0.54ab | 0.003 |
| Whole period | 87.62 ± 0.34b | 90.27 ± 0.66a | 89.69 ± 0.66a | 88.84 ± 0.61ab | 89.40 ± 0.45ab | 0.038 |
Different superscripts within a row indicate significant differences (P < 0.05).
Table 4.
The effect of Ost combined with Ica on the performance of laying hens.
| Items | Normal control | LG | MG | HG | Positive control | P-value | |
|---|---|---|---|---|---|---|---|
| 1–10 d | Equal egg weight (g) | 62.99 ± 1.06b | 66.65 ± 1.00a | 62.26 ± 0.85b | 63.95 ± 1.10ab | 62.55 ± 0.78b | 0.013 |
| Daily average yield (g/d) | 51.70 ± 1.04 | 54.03 ± 0.83 | 52.20 ± 1.04 | 51.75 ± 0.85 | 51.99 ± 0.64 | 0.339 | |
| Feed-egg ratio | 2.14 ± 0.07 | 2.17 ± 0.12 | 2.15 ± 0.08 | 2.17 ± 0.13 | 2.09 ± 0.09 | 0.982 | |
| Soft shell breaking rate (%) | 0.23 ± 0.11 | 0.32 ± 0.13 | 0.09 ± 0.06 | 0.15 ± 0.03 | 0.14 ± 0.03 | 0.355 | |
| 11–20 d | Equal egg weight (g) | 63.45 ± 1.15ab | 65.90 ± 0.91a | 65.25 ± 0.75ab | 64.47 ± 0.57ab | 62.94 ± 1.10b | 0.041 |
| Daily average yield (g/d) | 53.02 ± 0.75b | 55.61 ± 0.79a | 53.51 ± 0.46b | 53.19 ± 0.42b | 53.76 ± 0.48b | 0.046 | |
| Feed-egg ratio | 2.16 ± 0.03 | 2.13 ± 0.07 | 2.19 ± 0.09 | 2.19 ± 0.03 | 2.24 ± 0.10 | 0.849 | |
| Soft shell breaking rate (%) | 0.21 ± 0.10 | 0.18 ± 0.08 | 0.31 ± 0.15 | 0.06 ± 0.04 | 0.21 ± 0.08 | 0.506 | |
| 21–30 d | Equal egg weight (g) | 63.10 ± 0.81 | 65.14 ± 0.88 | 62.63 ± 1.01 | 63.52 ± 0.99 | 62.58 ± 0.79 | 0.258 |
| Daily average yield (g/d) | 52.82 ± 0.57c | 55.14 ± 0.65a | 54.70 ± 0.22ab | 53.26 ± 0.22c | 53.44 ± 0.36bc | 0.008 | |
| Feed-egg ratio | 1.99 ± 0.01 | 1.96 ± 0.03 | 1.92 ± 0.05 | 2.00 ± 0.06 | 2.01 ± 0.04 | 0.578 | |
| Soft shell breaking rate (%) | 0.24 ± 0.06 | 0.28 ± 0.08 | 0.20 ± 0.08 | 0.15 ± 0.03 | 0.18 ± 0.05 | 0.640 | |
| whole period | Equal egg weight (g) | 63.08 ± 0.44b | 65.66 ± 0.45a | 63.40 ± 0.43b | 63.55 ± 0.53b | 62.63 ± 0.50b | <0.001 |
| Daily average yield (g/d) | 52.51 ± 0.77b | 54.92 ± 0.67a | 53.47 ± 0.54ab | 52.73 ± 0.41b | 53.06 ± 0.45ab | 0.026 | |
| Feed-egg ratio | 2.10 ± 0.02 | 2.09 ± 0.03 | 2.09 ± 0.03 | 2.12 ± 0.05 | 2.11 ± 0.04 | 0.946 | |
| Soft shell breaking rate (%) | 0.23 ± 0.09 | 0.26 ± 0.09 | 0.20 ± 0.09 | 0.12 ± 0.02 | 0.18 ± 0.04 | 0.718 |
Different superscripts within a row indicate significant differences (P < 0.05).
It was noted from these results that there was no significant effect of Ost combined with Ica on improving eggshell quality and yolk color (P > 0.05) (Table 5, Table 6), but it was better than the PC in improving egg freshness. Throughout the entire test period, the Haugh unit and protein height of the LG, MG, and HG were significantly greater than those of the NC (P < 0.05), with no significant difference between PC and NC (P < 0.05) (Table 5). In addition, Ost combined with Ica deepened the eggshell color on the 20th, and 30th days, as well as throughout the entire test period (P < 0.05) (Table 6).
Table 5.
The effects of Ost combined with Ica on Haugh unit, albumen height, and yolk color.
| Items | Normal control | LG | MG | HG | align="left"Positive control | P-value | |
|---|---|---|---|---|---|---|---|
| 5 d | Haugh unit | 73.48 ± 2.12 | 75.96 ± 1.59 | 71.58 ± 1.63 | 77.59 ± 1.69 | 74.51 ± 1.45 | 0.135 |
| Albumen height (mm) | 5.80 ± 0.29 | 6.12 ± 0.21 | 5.53 ± 0.19 | 6.20 ± 0.23 | 5.88 ± 0.19 | 0.236 | |
| Yolk color | 10.00 ± 0.14 | 10.06 ± 0.17 | 10.00 ± 0.11 | 9.78 ± 0.13 | 10.00 ± 0.11 | 0.636 | |
| 10 d | Haugh unit | 68.99 ± 1.73b | 75.64 ± 1.92a | 72.41 ± 0.84ab | 74.44 ± 1.40a | 71.00 ± 1.90ab | 0.035 |
| Albumen height (mm) | 5.26 ± 0.20c | 6.19 ± 0.25a | 5.54 ± 0.11bc | 5.91 ± 0.21ab | 5.47 ± 0.22bc | 0.013 | |
| Yolk color | 11.28 ± 0.14 | 11.22 ± 0.10 | 11.28 ± 0.11 | 11.28 ± 0.11 | 11.22 ± 0.13 | 0.992 | |
| 20 d | Haugh unit | 73.64 ± 1.93c | 80.01 ± 1.00a | 78.64 ± 1.82ab | 80.07 ± 1.22a | 74.89 ± 1.45bc | 0.006 |
| Albumen height (mm) | 5.83 ± 0.24b | 6.70 ± 0.14a | 6.58 ± 0.27a | 6.70 ± 0.18a | 5.94 ± 0.19b | 0.004 | |
| Yolk color | 11.56 ± 0.15 | 11.39 ± 0.14 | 11.44 ± 0.12 | 11.22 ± 0.10 | 11.50 ± 0.12 | 0.407 | |
| 30 d | Haugh unit | 74.75 ± 1.25bc | 78.50 ± 1.27ab | 79.53 ± 1.61a | 78.98 ± 1.41ab | 74.03 ± 1.70c | 0.020 |
| Albumen height (mm) | 5.92 ± 0.16ab | 6.50 ± 0.18a | 6.55 ± 0.25a | 6.50 ± 0.20a | 5.84 ± 0.23b | 0.030 | |
| Yolk color | 11.21 ± 0.10 | 11.22 ± 0.13 | 11.17 ± 0.09 | 11.28 ± 0.14 | 11.06 ± 0.06 | 0.647 | |
| Whole period | Haugh unit | 72.75 ± 1.01c | 77.46 ± 0.61a | 75.56 ± 0.69ab | 77.70 ± 0.61a | 73.86 ± 0.76bc | <0.001 |
| Albumen height (mm) | 5.71 ± 0.13d | 6.37 ± 0.08a | 6.05 ± 0.10bc | 6.32 ± 0.09ab | 5.81 ± 0.08cd | <0.001 | |
| Yolk color | 10.99 ± 0.07 | 10.98 ± 0.07 | 10.97 ± 0.05 | 10.88 ± 0.09 | 10.94 ± 0.06 | 0.828 |
Different superscripts within a row indicate significant differences (P < 0.05).
Table 6.
The effects of Ost combined with Ica on eggshell color, egg shape index, eggshell strength, and eggshell thickness.
| Items | Normal control | LG | MG | HG | Positive control | P-value | |
|---|---|---|---|---|---|---|---|
| 5 d | Egg shape index | 1.286 ± 0.01b | 1.315 ± 0.01a | 1.305 ± 0.01ab | 1.291 ± 0.01ab | 1.300 ± 0.01ab | 0.011 |
| Eggshell strength (kgf) | 3.46 ± 0.11 | 3.40 ± 0.08 | 3.25 ± 0.17 | 3.49 ± 0.14 | 3.21 ± 0.10 | 0.417 | |
| Eggshell thickness (mm) | 0.36 ± 0.00 | 0.35 ± 0.01 | 0.35 ± 0.01 | 0.35 ± 0.01 | 0.35 ± 0.01 | 0.729 | |
| Eggshell color (%) | 26.71 ± 0.85ab | 27.16 ± 0.82a | 25.45 ± 0.87ab | 25.97 ± 0.62ab | 24.70 ± 0.72b | 0.034 | |
| 10 d | Egg shape index | 1.276 ± 0.01b | 1.305 ± 0.01ab | 1.296 ± 0.01ab | 1.301 ± 0.01ab | 1.317 ± 0.01a | 0.031 |
| Eggshell strength (kgf) | 3.29 ± 0.16 | 3.53 ± 0.09 | 3.71 ± 0.44 | 3.23 ± 0.17 | 3.42 ± 0.06 | 0.606 | |
| Eggshell thickness (mm) | 0.36 ± 0.00 | 0.37 ± 0.00 | 0.36 ± 0.01 | 0.36 ± 0.00 | 0.36 ± 0.00 | 0.570 | |
| Eggshell color (%) | 25.71 ± 0.84 | 25.22 ± 0.67 | 24.76 ± 0.71 | 25.23 ± 0.56 | 26.46 ± 0.77 | 0.188 | |
| 20 d | Egg shape index | 1.326 ± 0.01 | 1.310 ± 0.02 | 1.316 ± 0.01 | 1.328 ± 0.01 | 1.303 ± 0.02 | 0.605 |
| Eggshell strength (kgf) | 3.68 ± 0.16 | 3.27 ± 0.11 | 3.43 ± 0.14 | 3.50 ± 0.23 | 3.39 ± 0.12 | 0.474 | |
| Eggshell thickness (mm) | 0.36 ± 0.00 | 0.36 ± 0.00 | 0.35 ± 0.00 | 0.35 ± 0.00 | 0.36 ± 0.00 | 0.119 | |
| Eggshell color (%) | 28.52 ± 0.76a | 23.90 ± 0.62b | 23.84 ± 0.44b | 22.80 ± 0.43b | 27.31 ± 0.88a | 0.025 | |
| 30 d | Egg shape index | 1.297 ± 0.01b | 1.320 ± 0.01ab | 1.307 ± 0.01b | 1.311 ± 0.01b | 1.337 ± 0.01a | 0.022 |
| Eggshell strength (kgf) | 3.02 ± 0.12b | 3.61 ± 0.21a | 3.72 ± 0.04a | 3.54 ± 0.10a | 3.41 ± 0.02a | 0.010 | |
| Eggshell thickness (mm) | 0.35 ± 0.00 | 0.36 ± 0.01 | 0.36 ± 0.01 | 0.35 ± 0.00 | 0.36 ± 0.00 | 0.794 | |
| Eggshell color (%) | 27.17 ± 0.46a | 25.48 ± 0.50bc | 24.75 ± 0.30bc | 24.68 ± 0.32c | 25.87 ± 0.31b | 0.021 | |
| Whole period | Egg shape index | 1.296 ± 0.00b | 1.313 ± 0.01a | 1.306 ± 0.00ab | 1.308 ± 0.00ab | 1.315 ± 0.01a | 0.048 |
| Eggshell strength (kgf) | 3.36 ± 0.07 | 3.45 ± 0.06 | 3.53 ± 0.13 | 3.44 ± 0.06 | 3.36 ± 0.04 | 0.550 | |
| Eggshell thickness (mm) | 0.36 ± 0.00 | 0.36 ± 0.00 | 0.35 ± 0.00 | 0.35 ± 0.00 | 0.36 ± 0.00 | 0.527 | |
| Eggshell color (%) | 27.17 ± 0.46a | 25.48 ± 0.50bc | 24.75 ± 0.30bc | 24.68 ± 0.32c | 25.87 ± 0.31b | <0.001 |
Different superscripts within a row indicate significant differences (P < 0.05).
Body Weight, Reproductive Organ Index, and Number of Follicles
The analysis revealed no significant difference in the body weight of laying hens among any of the test groups on days 10, 20, and 30 of the experiment (P > 0.05) (Table 7), indicating that Ost combined with Ica did not affect the body weight of laying hens. Additionally, at the end of the experiment, there was no significant difference in the uterus, ovaries, and oviduct index among test groups (P > 0.05) (Figure. 3C–3E), indicating that Ost combined with Ica did not affect reproductive organs of laying hens.
Table 7.
The effect of Ost combined with Ica on the weight of laying hens.
| Normal control | LG | MG | HG | Positive control | P-value | |
|---|---|---|---|---|---|---|
| 10 d | 1.97 ± 0.08 | 1.98 ± 0.06 | 1.96 ± 0.07 | 1.98 ± 0.09 | 1.92 ± 0.04 | 0.443 |
| 20 d | 2.04 ± 0.05 | 2.11 ± 0.07 | 2.09 ± 0.07 | 2.01 ± 0.06 | 2.13 ± 0.08 | 0.717 |
| 30 d | 2.02 ± 0.03 | 2.06 ± 0.05 | 2.00 ± 0.08 | 2.13 ± 0.03 | 1.99 ± 0.07 | 0.270 |
Figure 3.
The effect of Ost combined with Ica on reproductive organ index and the number of follicles. (A) was the number of small yellow follicles, (B) was the number of large yellow follicles, (C) was the ovarian index, (D) was the uterine index, and (E) was the fallopian tube index at the end of the experiment. Data expressed as mean ± standard error means (SEM), different lowercase letters (a, b, c, d) indicated significant differences between groups (P < 0.05). The same letter means no significant difference between groups (P > 0.05).
In the LG, there were substantially more SYF than in the NC (P < 0.05) (Figure 3A). In all test groups, there was no appreciable change in the number of LYF (P > 0.05) (Figure 3B). It demonstrates combining Ost with Ica can encourage the growth of SYF in laying hens.
Residue Detection
HPLC analysis was conducted to detect Ost and Ica in HG egg samples. No peak corresponding to Ost or Ica was observed in the HG egg samples, while the Ost-positive sample showed a peak at 9.4 to 9.5 min (Figure 4A and 4B), and the peak of the Ica-positive additional sample occurred at 13.2-13.3 min (Figure 4C and 4D). The aforementioned findings demonstrated that eggs did not contain any Ost or Ica.
Figure 4.
Chromatograms of the test article and positive spiked samples. The contents of osthole and icariin in eggs of the high-dose group were detected by HPLC, respectively. (A) Osthole positive added sample; (B) Osthole determination in the high-dose group; (C) Icariin-positive added sample; (D) Icariin determination in the high-dose group.
Serum Reproductive Hormone Levels and Its Receptor Gene Expression in Ovaries
On day 20, the serum E2 levels in the HG considerably increased as compared to the NC (P < 0.05). However, by the end of the experiment, the serum E2 levels in the LG, MG, and HG were dramatically decreased (P < 0.01) (Figure 5A). The serum FSH levels in the MG, HG, and PC were significantly lower than the NC on 5th day of the experiment (P < 0.01) respectively, but on 20th and 30th day of the experiment, serum FSH levels in the LG, MG and the PC were significantly higher than the NC (P < 0.01) (Figure 5B). The serum LH level in LG was significantly lower than NC on the 10th day (P < 0.05), while the serum LH level in each treatment group was significantly higher than the NC on 20th and 30th day (P < 0.01) (Figure 5C). These results showed that the effects of Ost combined with Ica on serum FSH and LH were basically identical, showing a trend of decreasing first and then increasing. Ost combined with Ica increased serum P4 content of laying hens, and MG (20 mg/kg Ost + 20 mg/kg Ica) had the most obvious effect. The content of P4 in the serum of MG was significantly higher than NC on 5th, 10th, 20th, and 30th days (P < 0.01). The serum P4 level in the LG was significantly higher than the NC on 10th and 20th days (P < 0.01) (Figure 5D). At the end of the test, expression of ER and FSHR mRNA in the ovaries of the MG was significantly increased (P < 0.05) (Figure 6 A and 6B), and expression of PGR mRNA in the HG was significantly increased (P < 0.05) (Figure 6D).
Figure 5.
The effect of Ost combined with Ica on serum reproductive hormone levels. A, B, C, and D were serum E2, FSH, LH, and P4 levels on the 5th, 10th, 20th, and 30th days of the experiment., respectively. Data expressed as mean ± standard error means (SEM), different lowercase letters (a, b, c, d) indicated significant differences between groups (P < 0.05), and different uppercase letters (A, B, C, D) indicated differences between groups very significant (P < 0.01). The same letter means no significant difference between groups (P > 0.05).
Figure 6.
The effects of Ost combined with Ica on the expression of the reproductive hormone receptor gene in the ovary of laying hens. A, B, C, and D were the expression levels of ER, FSHR, LHR, and PGR mRNA at the end of the experiment. Data expressed as mean ± standard error means (SEM), different lowercase letters (a, b, c, d) indicated significant differences between groups (P < 0.05). The same letter means no significant difference between groups (P > 0.05).
Expression of Proliferation-Related Genes/Proteins in SYF
Results of the mRNA level of granulosa cell proliferation in SYF showed that the relative expression of PCNA, cyclin E1, and cyclin A2 mRNA in the LG was significantly up-regulated at the end of the experiment (P < 0.05) (Figure 7A–C). The relative expression of PCNA and cyclin A2 mRNA in the PC was significantly increased (P < 0.05) (Figure 7A and 7B). At the end of the experiment, the expression of PCNA, cyclin A2, and cyclin E1 protein in SYF of the LG was significantly higher than the NC (P < 0.01) (Figure 7D–F). The expression levels of cyclin A2 and cyclin E1 protein in the MG, HG, and PC were significantly increased (P < 0.05) (Figure 7E and 7F). The above results indicate that Ost + Ica can promote the proliferation of SYF granulosa cells in laying hens.
Figure 7.
The effect of Ost combined with Ica on PCNA, cyclin A2, and cyclin E1 mRNA and protein in SYF. A, B, and C were the expression levels of PCNA, cyclin E1, cyclin A2 mRNA, and D, E, and F were the expression levels of PCNA, cyclin E1, cyclin A2 protein in small yellow follicles at the end of the experiment. Data expressed as mean ± standard error means (SEM), different lowercase letters (a, b, c, d) indicated significant differences between groups (P < 0.05), and different uppercase letters (A, B, C, D) indicated differences between groups very significant (P < 0.01). The same letter means no significant difference between groups (P > 0.05).
Expression of P4 Synthesis-Related Genes/Proteins in LYF
The relative expression of StAR and P450scc mRNA in the LG was substantially higher than in the NC (P < 0.05) after the experiment, according to the results of P4 synthesis-related mRNA levels in LYF (Figure 8A and 8C). The relative expression of 3β-HSD mRNA in MG was significantly increased (P < 0.05) (Figure 8B). The expression levels of StAR, 3β-HSD, and P450scc protein in LG and PC were significantly higher than the NC (P < 0.01) (Figure 8D–8F). The expression of StAR, 3β-HSD, and P450scc protein in MG was also significantly increased (P < 0.05) (Figure 8D–8F). These results indicate that Ost + Ica promotes P4 secretion by increasing the expression of StAR, 3β-HSD, and P450scc in LYF.
Figure 8.
The effect of Ost combined with Ica on StAR, 3β-HSD, and P450scc mRNA and protein in LYF. A, B, C were the expression levels of StAR, 3β-HSD, P450scc mRNA, and D, E, F were the expression levels of StAR, 3β-HSD, P450scc protein in LYF at the end of the experiment. Data expressed as mean ± standard error means (SEM), different lowercase letters (a, b, c, d) indicated significant differences between groups (P<0.05), and different uppercase letters (A, B, C, D) indicated differences between groups very significant (P<0.01). The same letter means no significant difference between groups (P>0.05).
DISCUSSION
The utilization of traditional Chinese medicine and its extracts in animal production has attracted attention (Abdallah et al., 2019). Its safety, efficacy, and mechanism of action are some of the key scientific issues in the research and development of traditional Chinese veterinary drugs. Osthole, which belongs to coumarins with estrogen-like effects, has been shown to promote biosynthesis and secretion of corticosterone (Pan et al., 2015). However, a study found that coumarins extracted from Cnidium Monnieri showed a significant reduction in food intake and body weight after a week of treatment at 900 mg/day (Gong et al., 2014). Epimedii Folium has been used for thousands of years to treat male infertility, osteoporosis, hypertension, etc (Park et al., 2019). Recently, adverse reactions of Epimedii Folium and its Chinese patent medicines, notably liver injury, have been reported frequently (Li et al., 2022). In this experiment, the maximum dosage designed was 100 mg/kg Ost + 100 mg/kg ICA, which was mentioned as the safe range. Monitoring the body weight of laying hens revealed that each dose group did not affect the body weight. In addition, there were no significant changes in the reproductive organ index, indicating that the dose designed in this experiment had no obvious toxic or side effects on laying hens.
The use of antibiotics in laying hens production can lead to the accumulation of antibiotics in eggs (Chen et al., 2019). For example, sulfonamides and amides continuously administered to laying hens, and different levels of prototype drug residues could be detected in egg yolk or protein (Wang et al., 2022). Currently, no studies have shown whether the use of traditional Chinese medicine or its extracts during animal production has drug residues in animal-derived foods. In this experiment, HPLC analysis of egg samples showed no detection of Ost and Ica. Pharmacokinetic studies have shown that after Chinese medicine enters the body, it is metabolized by the liver or other pathways, and eventually discharged in its metabolites or models. The absence of Ost and Ica in this experiment may be due to their conversion into metabolites deposited in the egg yolk or protein, making them undetectable. Alternatively, this may be due to imperfections in the extraction method causing drug loss. Further research is needed to determine the exact reason for the lack of detection.
In the production of laying hens, higher economic benefits can be achieved by increasing the egg production rate, egg weight, and prolonging the peak period, or by reducing the feed-egg ratio and reducing the death rate. Numerous studies have reported that plant-derived dietary supplements can improve the laying rate, reduce the feed-egg ratio, and improve egg quality. For example, dietary supplementation with the mixture of Radix Astragali, Salviamiltiorrhiza Bunge, and Cnidium Monnieri can improve the laying performance, egg quality, and plasma hormone levels in postpeak laying hens (Zhang et al., 2021). Our previous studies have confirmed that Ost and Ica can promote the follicular development of laying hens in vitro (Sun et al., 2020). In this study, it was found that 2 mg/kg Ost + 2 mg/kg ICA could increase the laying rate and average egg weight of laying hens. Additionally, it increased the Haugh unit, and protein height, and intensified the eggshell color. Compared with the existing egg-increasing Chinese veterinary drugs in the market, Ost combined with Ica has the advantages of clear active ingredients and small dosages. Therefore, it is of great theoretical and practical significance to further explore the mechanism of the combined application of Ost and Ica to improve the production performance of laying hens.
The production performance of laying hens is closely related to the development of follicles. As chickens enter the late laying period, ovarian function and reproductive performance gradually decline, and the follicular maturation rate also decreases (Long et al., 2017). It has been suggested that increasing the number of LYF and SYF can increase the egg production rate (El-Tarabany et al., 2021). Therefore, the quantity and quality of follicles determine the production performance of laying hens. In this study, the number of SYF was significantly increased with 2 mg/kg Ost + 2 mg/kg Ica supplementation. This suggests that Ost combined with Ica might improve the production performance of laying hens by promoting follicular development.
Granulosa cell proliferation is one of the key factors in follicular growth. A study found that the epidermal growth factor can promote the proliferation of chicken pre-hierarchical follicular granulosa cells by up-regulating the expression of cyclin D1, cyclin E1, CDK2, and CDK6 genes (Lin et al., 2011). In addition, ginsenosides can promote the proliferation of chicken small yellow follicular granulosa cells by up-regulating the expression of PCNA, cyclin D1, and cyclin E proteins (Tan et al., 2010). Our previous study has found that icariin could up-regulate the expression of PCNA, cyclin A2, and cyclin E1 to induce the proliferation of chicken SYF granulosa cells. In the present study, PCNA, cyclin A2, cyclin E1 gene, and protein expression levels were significantly increased with 2 mg/kg Ost + 2 mg/kg Ica addition. It can be observed that Ost combined with Ica may improve the follicular development level of laying hens by promoting the proliferation of granulosa cells of SYF.
The reproductive activity of laying hens is regulated by hormones secreted by the “hypothalamus-pituitary-gonadal” axis. Changes in reproductive hormones, such as FSH, LH, E2, and P4, can impact laying hens' production performance (Li et al., 2023; Zhao et al., 2023). Natural products can regulate the production performance of laying hens by regulating the level of reproductive hormones. For example, adding 50 mg/kg soya-saponin to the diet of laying hens can increase the laying rate by increasing the ovarian FSHR transcription level and serum E2 level (Li et al., 2022). In this experiment, the serum P4 level of laying hens on days 5, 10, 20, and 30 was significantly increased by adding 20 mg/kg Ost + 20 mg/kg ICA to the diet. P4 plays a crucial part in ovulation. The study of plasma P4 content in laying hens at different stages of ovulation found that there was a peak value of P4 at 6 to 3 h before ovulation, which was not detected in laying hens without ovulation (Johnson and van Tienhoven, 1980). Therefore, we speculate that Ost combined with Ica improves the production performance of laying hens by promoting P4 secretion. Paradoxically, the content of E2 in serum decreased at the end of the trial. Since poultry ovaries do not form corpus luteum, P4, and E2 were synthesized by the granular layer and the membrane layer of follicles, respectively (Porter et al., 1989). Aromatase is a common rate-limiting enzyme in the biosynthesis of P4 and E2. A possible explanation is that due to the increase of P4, the content of aromatase necessary for E2 synthesis in membrane cells decreases, and the amount of E2 synthesis decreases. Leszczynski et al used the ratio of E2 to P4 in plasma to evaluate the laying rate and concluded that the smaller the ratio of E2/P4, the higher the laying rate of laying hens (Leszczynski et al., 1985).
StAR, P450scc, and 3β-HSD are 3 key enzymes in the synthesis of P4. Xiao et al reported that genistein extracted from soybean could stimulate granulosa cells to secrete P4 by up-regulating the expression of ERβ, P450scc, 3β-HSD, and StAR mRNA (Xiao et al., 2019). In our previous experiments in vitro, it was observed that Ost could increase P4 secretion by up-regulating the expression of StAR, P450scc, and 3β-HSD mRNA and protein in chicken LYF (Sun et al., 2020). In this study, the expression of StAR, P450scc, and 3β-HSD mRNA and protein in the follicles was increased with 2 mg/kg Ost + 2 mg/kg Ica addition. It can be observed that Ost combined with Ica stimulates P4 secretion by acting on the P4 synthesis process of LYF, thereby improving the production performance of laying hens.
Reproductive hormones play a physiological role by binding to receptors distributed in the ovary. By measuring the expression of the reproductive hormone receptor gene in the ovary, we found that Ost combined with Ica up-regulated the mRNA levels of ER, FSHR, and PGR. Studies showed that FSHR stimulates follicular growth and regulates ovarian development by mediating estrogen synthesis (Stilley and Segaloff, 2018). ER and PGR are necessary conditions for ovulation in female animals, and ER can also maintain granulosa cell differentiation and follicular growth (Tang et al., 2019; Smith et al., 2022). Thus, the diet of Ost combined with Ica may improve the production performance of laying hens by promoting ovarian development and ovulation and stimulating P4 secretion.
CONCLUSION
From the present study, it was concluded that 2 mg/kg Ost + 2 mg/kg ICA could significantly improve the laying rate, average egg weight, Haugh unit, protein height, and eggshell color of laying hens, and the administration effect was better than that of the positive control Danjibao. Ost combined with Ica can regulate the production performance of laying hens by promoting the proliferation of SYF granulosa cells and the secretion of P4 in LYF (Figure 9).
Figure 9.
Graph summary (created by Biorender.com).
ACKNOWLEDGMENTS
This study was supported by Central Government Guides Local Science and Technology Development Projects of Shanxi Province (YDZJSX20231A033), National Key Research and Development Program (2022YFD1801101), Key Research and Development Plan of Shanxi Province (Grant No. 202102140601019), the special fund for Science and Technology Innovation Teams of Shanxi Province (202204051001021), Shanxi “1331 Project” (No. 20211331-16, No. 20211331-13), and Shanxi Scholarship Council of China.
DISCLOSURES
All authors have no conflicts of interest to disclose.
REFERENCES
- Abdallah A., Zhang P., Zhong Q., Sun Z. Application of Traditional Chinese Herbal Medicine by-products as dietary feed supplements and antibiotic replacements in animal production. Curr. Drug. Metab. 2019;20:54–64. doi: 10.2174/1389200219666180523102920. [DOI] [PubMed] [Google Scholar]
- Akhtar M., Wright J.N., Lee-Robichaud P. A review of mechanistic studies on aromatase (CYP19) and 17α-hydroxylase-17,20-lyase (CYP17) J. Steroid. Biochem. Mol. Biol. 2011;125:2–12. doi: 10.1016/j.jsbmb.2010.11.003. [DOI] [PubMed] [Google Scholar]
- Boonstra J. Progression through the G1-phase of the on-going cell cycle. J. Cell. Biochem. 2003;90:244–252. doi: 10.1002/jcb.10617. [DOI] [PubMed] [Google Scholar]
- Calderón A., Ortiz-Espín A., Iglesias-Fernández R., Carbonero P., Pallardó F.V., Sevilla F., Jiménez A. Thioredoxin (Trxo1) interacts with proliferating cell nuclear antigen (PCNA) and its overexpression affects the growth of tobacco cell culture. Redox. Biol. 2017;11:688–700. doi: 10.1016/j.redox.2017.01.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Castoria G., Barone M.V., Di Domenico M., Bilancio A., Ametrano D., Migliaccio A., Auricchio F. Non-transcriptional action of oestradiol and progestin triggers DNA synthesis. EMBO. J. 1999;18:2500–2510. doi: 10.1093/emboj/18.9.2500. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen J., Ying G.G., Deng W.J. Antibiotic residues in food: Extraction, analysis, and human health concerns. J. Agric. Food. Chem. 2019;67:7569–7586. doi: 10.1021/acs.jafc.9b01334. [DOI] [PubMed] [Google Scholar]
- Dunbier A.K., Anderson H., Ghazoui Z., Folkerd E.J., A'hern R., Crowder R.J., Hoog J., Smith I.E., Osin P., Nerurkar A., Parker J.S., Perou C.M., Ellis M.J., Dowsett M. Relationship between plasma estradiol levels and estrogen-responsive gene expression in estrogen receptor-positive breast cancer in postmenopausal women. J. Clin. Oncol. 2010;28:1161–1167. doi: 10.1200/JCO.2009.23.9616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- El-Tarabany M.S., Nassan M.A., Salah A.S. Royal jelly improves the morphology of the reproductive tract, internal egg quality, and blood biochemical parameters in laying hens at the late stage of production. Animals (Basel) 2021;11:1861. doi: 10.3390/ani11071861. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gong X.L., Gao T.T., Zhao L.J., Zhu H., Xia Z.N., Lu W., Lu G.C. Subchronic safety evaluation of CMS-1 (a botanical antihypertensive product derived from Semen Cnidium monnieri) in Sprague-Dawley rats and beagle dogs. Regul. Toxicol. Pharmacol. 2014;69:558–571. doi: 10.1016/j.yrtph.2014.05.025. [DOI] [PubMed] [Google Scholar]
- Hassan M.M., Zowalaty M.E., Lundkvist Å., Järhult J.D., Khan Nayem M.R., Tanzin A.Z., Badsha M.R., Khan S.A., Ashour H.M. Residual antimicrobial agents in food originating from animals. Trends. Food. Sci. Technol. 2021;111:141–150. doi: 10.1016/j.tifs.2021.01.075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- He C., Wang Z., Shi J. Pharmacological effects of icariin. Adv. Pharmacol. 2020;87:179–203. doi: 10.1016/bs.apha.2019.10.004. [DOI] [PubMed] [Google Scholar]
- Huang E.S., Kao K.J., Nalbandov A.V. Synthesis of sex steroids by cellular components of chicken follicles. Biol. Reprod. 1979;20:454–461. doi: 10.1095/biolreprod20.3.454. [DOI] [PubMed] [Google Scholar]
- Jia M., Li Y., Xin H.L., Hou T.T., Zhang N.D., Xu H.T., Zhang Q.Y., Qin L.P. Estrogenic activity of osthole and imperatorin in MCF-7 cells and their osteoblastic effects in Saos-2 cells. Chin. J. Nat. Med. 2016;14:413–420. doi: 10.1016/S1875-5364(16)30037-1. [DOI] [PubMed] [Google Scholar]
- Johnson A.L., van Tienhoven A. Plasma concentrations of six steroids and LH during the ovulatory cycle of the hen, Gallus domesticus. Biol. Reprod. 1980;23:386–393. doi: 10.1095/biolreprod23.2.386. [DOI] [PubMed] [Google Scholar]
- Johnson A., Skotheim J.M. Start and the restriction point. Curr. Opin. Cell. Biol. 2013;25:717–723. doi: 10.1016/j.ceb.2013.07.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koundrioukoff S., Jónsson Z.O., Hasan S., de Jong R.N., van der Vliet P.C., Hottiger M.O., Hübscher U. A direct interaction between proliferating cell nuclear antigen (PCNA) and Cdk2 targets PCNA-interacting proteins for phosphorylation. J. Biol. Chem. 2000;275:22882–22887. doi: 10.1074/jbc.M001850200. [DOI] [PubMed] [Google Scholar]
- Lee K.A., Volentine K.K., Bahr J.M. Two steroidogenic pathways present in the chicken ovary: theca layer prefers delta 5 pathway and granulosa layer prefers delta 4 pathway. Domest. Anim. Endocrinol. 1998;15:1–8. doi: 10.1016/s0739-7240(97)00057-x. [DOI] [PubMed] [Google Scholar]
- Leszczynski D.E., Hagan R.C., Bitgood J.J., Kummerow F.A. Relationship of plasma estradiol and progesterone levels to egg productivity in domestic chicken hens. Poult. Sci. 1985;64:545–549. doi: 10.3382/ps.0640545. [DOI] [PubMed] [Google Scholar]
- Li C., Cao Y., Ren Y., Zhao Y., Wu X., Si S., Li J., Li Q., Zhang N., Li D., Li G., Liu X., Kang X., Jiang R., Tian Y. The adiponectin receptor agonist, AdipoRon, promotes reproductive hormone secretion and gonadal development via the hypothalamic-pituitary-gonadal axis in chickens. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li P., Zhang L., Guo Z., Kang Q., Chen C., Liu X., Ma Q., Zhang J., Hu Y., Wang T. Epimedium koreanum Nakai-induced liver injury-a mechanistic study using untargeted metabolomics. Front. Pharmacol. 2022;13 doi: 10.3389/fphar.2022.934057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li P., Zhao Y., Yan S., Song B., Liu Y., Gao M., Tang D., Guo Y. Soya saponin improves egg-laying performance and immune function of laying hens. J. Anim. Sci. Biotechnol. 2022;12:126. doi: 10.1186/s40104-021-00647-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lin J.X., Jia Y.D., Zhang C.Q. Effect of epidermal growth factor on follicle-stimulating hormone-induced proliferation of granulosa cells from chicken prehierarchical follicles. J. Zhejiang Univ. Sci. B. 2011;12:875–883. doi: 10.1631/jzus.B1100023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Long L., Wu S.G., Yuan F., Zhang H.J., Wang J., Qi G.H. Effects of dietary octacosanol supplementation on laying performance, egg quality, serum hormone levels, and expression of genes related to the reproductive axis in laying hens. Poult. Sci. 2017;96:894–903. doi: 10.3382/ps/pew316. [DOI] [PubMed] [Google Scholar]
- McGee E.A., Hsueh A.J. Initial and cyclic recruitment of ovarian follicles. Endocr. Rev. 2000;21:200–214. doi: 10.1210/edrv.21.2.0394. [DOI] [PubMed] [Google Scholar]
- Nakada T., Koja Z., Tanaka K. Effect of progesterone on ovulation in the hypophysectomised hen. Br. Poult. Sci. 1994;35:153–156. doi: 10.1080/00071669408417680. [DOI] [PubMed] [Google Scholar]
- Nie X., Sheng W., Hou D., Liu Q., Wang R., Tan Y. Effect of Hyperin and Icariin on steroid hormone secretion in rat ovarian granulosa cells. Clin. Chim. Acta. 2019;495:646–651. doi: 10.1016/j.cca.2018.05.004. [DOI] [PubMed] [Google Scholar]
- Pan Z., Fang Z., Lu W., Liu X., Zhang Y. Osthole, a coumadin analog from Cnidium monnieri (L.) Cusson, stimulates corticosterone secretion by increasing steroidogenic enzyme expression in mouse Y1 adrenocortical tumor cells. J. Ethnopharmacol. 2015;175:456–462. doi: 10.1016/j.jep.2015.10.009. [DOI] [PubMed] [Google Scholar]
- Park W., Park S., Song G., Lim W. Inhibitory effects of osthole on human breast cancer cell progression via induction of cell cycle arrest, mitochondrial dysfunction, and ER stress. Nutrients. 2019;11:2777. doi: 10.3390/nu11112777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Porter T.E., Hargis B.M., Silsby J.L., Halawani M.E. Differential steroid production between theca interna and theca externa cells: a three-cell model for follicular steroidogenesis in avian species. Endocrinology. 1989;125:109–116. doi: 10.1210/endo-125-1-109. [DOI] [PubMed] [Google Scholar]
- Smith K.M., Dinh D.T., Akison L.K., Nicholls M., Dunning K.R., Morimoto A., Lydon J.P., Russell D., Robker R.L. Intraovarian, isoform-specific transcriptional roles of progesterone receptor in ovulation. Cells. 2022;11:1563. doi: 10.3390/cells11091563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stilley J.A.W., Segaloff D.L. FSH actions and pregnancy: looking beyond ovarian FSH receptors. Endocrinology. 2018;159:4033–4042. doi: 10.1210/en.2018-00497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun M., Sun M., Zhang J. Osthole: an overview of its sources, biological activities, and modification development. Chem. Res. 2021;30:1767–1794. doi: 10.1007/s00044-021-02775-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun N., Zhang Y., Hou Y., Yi Y., Guo J., Zheng X., Sun P., Sun Y., Khan A., Li H. Effects of osthole on progesterone secretion in chicken preovulatory follicles granulosa cells. Animals (Basel) 2020;10:2027. doi: 10.3390/ani10112027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tan T.Q., Ge C., Mi Y., Jin Y., Zhang C. Ginsenosides promote proliferation of granulosa cells from chicken prehierarchical follicles through PKC activation and up-regulated cyclin gene expression. Cell Biol. Int. 2010;34:769–775. doi: 10.1042/CBI20090244. [DOI] [PubMed] [Google Scholar]
- Tang Z.R., Zhang R., Lian Z.X., Deng S.L., Yu K. Estrogen-receptor expression and function in female reproductive disease. Cells. 2019;8:1123. doi: 10.3390/cells8101123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang R., Zhang C.X., Li Z.Y., Zheng Z.Y., Xiang Y., Liu Y., Zhao R.F., Fang J. Detection of fluoroquinolone and sulfonamide residues in poultry eggs in Kunming city, southwest China. Poult Sci. 2022;101 doi: 10.1016/j.psj.2022.101892. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiao Y.Q., Shao D., Tong H.B., Shi S.R. Genistein increases progesterone secretion by elevating related enzymes in chicken granulosa cells. Poult Sci. 2019;98:1911–1917. doi: 10.3382/ps/pey411. [DOI] [PubMed] [Google Scholar]
- Xu J., Sangthong R., McNeil E., Tang R., Chongsuvivatwong V. Antibiotic use in chicken farms in northwestern China. Antimicrob. Resist. Infect. Control. 2020;9:10. doi: 10.1186/s13756-019-0672-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu S., Li L., Zhao H., Zhang S., Tu Y., Liu M., Zhao Y., Jiang L. Dietary citrus flavonoid extract improves lactational performance through modulating rumen microbiome and metabolites in dairy cows. Food Funct. 2023;14:94–111. doi: 10.1039/d2fo02751h. [DOI] [PubMed] [Google Scholar]
- Zhang L., Zhong G., Gu W., Yin N., Chen L., Shi S. Dietary supplementation with daidzein and Chinese herbs, independently and combined, improves laying performance, egg quality and plasma hormone levels of post-peak laying hens. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao H., Zhang S., Xu D., Lee M.Y., Zhang Z., Lee E.Y., Darzynkiewicz Z. Expression of the p12 subunit of human DNA polymerase δ (Pol δ), CDK inhibitor p21(WAF1), Cdt1, cyclin A, PCNA and Ki-67 in relation to DNA replication in individual cells. Cell Cycle. 2014;13:3529–3540. doi: 10.4161/15384101.2014.958910. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao J., Pan H., Liu Y., He Y., Shi H., Ge C. Interacting networks of the hypothalamic-pituitary-ovarian axis regulate layer hens performance. Genes (Basel) 2023;14:141. doi: 10.3390/genes14010141. [DOI] [PMC free article] [PubMed] [Google Scholar]