Stiffness promotes cell migration, invasion, and invadopodia in nasopharyngeal carcinoma by regulating the WT‐CTTN level

Abstract

Matrix stiffness potently promotes the malignant phenotype in various biological contexts. Therefore, identification of gene expression to participate in mechanical force signals transduced into downstream biochemical signaling will contribute substantially to the advances in nasopharyngeal carcinoma (NPC) treatment. In the present study, we detected that cortactin (CTTN) played an indispensable role in matrix stiffness‐induced cell migration, invasion, and invadopodia formation. Advances in cancer research have highlighted that dysregulated alternative splicing contributes to cancer progression as an oncogenic driver. However, whether WT‐CTTN or splice variants (SV1‐CTTN or SV2‐CTTN) regulate matrix stiffness‐induced malignant phenotype is largely unknown. We proved that alteration of WT‐CTTN expression modulated matrix stiffness‐induced cell migration, invasion, and invadopodia formation. Considering that splicing factors might drive cancer progression through positive feedback loops, we analyzed and showed how the splicing factor PTBP2 and TIA1 modulated the production of WT‐CTTN. Moreover, we determined that high stiffness activated PTBP2 expression. Taken together, our findings showed that the PTBP2‐WT‐CTTN level increases upon stiffening and then promotes cell migration, invasion, and invadopodia formation in NPC.

Alteration of WT‐CTTN expression modulated matrix stiffness‐induced cell migration, invasion, and invadopodia formation. Splicing factor PTBP2 modulated the production of WT‐CTTN.

Abbreviations

CTTN

cortactin

ECM

extracellular matrix

HNSC

head and neck squamous carcinoma

NPC

nasopharyngeal carcinoma

PTBP2

polypyrimidine tract binding protein 2 gene

SFs

splicing factors

TIA1

T‐cell intracellular antigen‐1

WT

wild‐type

1. INTRODUCTION

Nasopharyngeal carcinoma (NPC) is the most common malignant tumor in the head and neck region in Southern China and Southeast Asia. ¹ Although improvements in early and timely detection and therapy have been achieved, metastasis remains the predominant mode of treatment failure. ² , ³ Metastases develop from a sequence of interrelated steps, including nonrandom survival of a few subpopulations of cells, invadopodia formation, invasion, and the establishment of a tumor microenvironment. ⁴ , ⁵ Matrix stiffness or increasing in tissue rigidity plays a significant role in these processes. ⁶ , ⁷ , ⁸

Solid cancer progression is significantly related to an increase in matrix stiffness, driven mostly by cross‐linking of extracellular matrix (ECM) collagens and elastin, triggering mechanotransduction to biochemical signaling. ⁹ , ¹⁰ However, the importance of mechanical forces in NPC progression have not been thoroughly studied. Therefore, we set out to understand how matrix stiffening promotes cell migration, invasion, and invadopodia formation in nasopharyngeal carcinoma.

Cell migration, invasion, and invadopodia formation are significantly affected by their F‐actin cytoskeletal network continuously assembling and disassembling. ¹¹ Cortactin, as one actin‐binding protein, ¹² regulates cytoskeletal dynamics in these processes. ¹³ van Rossum et al. identified two CTTN splice variants (SV1 and SV2). SV1‐ and SV2‐cortactin lack the sixth repeat (exon 11) or fifth and sixth repeats (exons 10 and 11), respectively. ¹⁴ In all tissues and cells analyzed, scientists found that SV1‐CTTN is co‐expressed with WT‐CTTN, whereas the SV2‐CTTN shows lower abundances. ¹⁴ This study's goal is to identify CTTN splicing events for induction of cell migration, invasion, and invadopodia formation in response to high matrix stiffness in NPC.

2. MATERIALS AND METHODS

2.1. Cells and cell culture

All cell lines used were cultured at the Department of Otolaryngology Laboratory, Affiliated Hospital of Nantong University. Among them, four human NPC cell lines (CNE1, CNE2, 5‐8F, and 6‐10B) were maintained in RPMI 1640 (BI Biological Industries) supplemented with 10% FBS (Biological Industries Israel Beit‐Haemek, 04‐001‐1ACS), whereas NP69 cells were maintained in keratinocyte‐SFM medium supplemented with EGF (Invitrogen). CNE2 cell line was recently authenticated by short tandem repeat analysis. ¹⁵

2.2. Preparation of polyacrylamide gel substrates

The composition of polyacrylamide (PA) gels with different stiffness is displayed in Figure 1A. Briefly, 25‐mm circular coverslips were covered with 50 μL of sodium hydroxide (NaOH) (0.1 M) and air dried and then activated with 50 μL APES 5 min later. Coverslips were carefully washed and then incubated with 0.5% glutaraldehyde in PBS buffer. Next, coverslips were rinsed and air dried after 30 min. To polymerize, Acrylamide, Bis‐acrylamide (Sigma‐Aldrich, MO, USA) and distilled H₂O mixed for 15 min with their desired concentrations was added onto dichlorodimethylsilane‐treated chloro‐silanated glass slides. Next, Ammonium persulfate and TEMED were added to polymerize the gel. After 30 min, the gels were functionalized with sulfo‐SANPAH (0.2 mg/mL) under a 365‐nm ultraviolet light. Finally, 50 μg/mL of rat tail collagen I was added to the PA gel surface.

FIGURE 1.

High stiffness promotes cell migration, invasion, and invadopodia formation in nasopharyngeal carcinoma. (A) Scheme of the preparation of polyacrylamide (PA) gels was showed as indicated. (B, C) Transwell assays were used to detect the migration/invasion abilities. Cell numbers were calculated as the average of 10 random fields per filter. Statistical analyses were peformed using Student's t‐test. (D, E) Invadopodia were visualized by confocal microscopy. Blue, DAPI staining; green, CTTN; red, F‐actin (stained by phalloidin). Statistical analyses were peformed using Student's t‐test. *p < 0.05, ***p < 0.001.

2.3. Quantitation of CTTN splicing by RT‐PCR

Briefly, cellular RNAs were isolated with a FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme Biotech, Nanjing, China). One microgram of total RNA was used for first‐strand cDNA synthesis with a Biosharp BL696A Reverse Transcription Kit. RT–PCR primers for CTTN were designed as follows:

• Forward primer (F1): GGTGTGCAGACAGACAGAC

• Forward primer (F2): CAGACCCTTAAGGAGAAGG

• Reverse primer (Re): TGGTCACAGCTTCGACAGG.

F1/Re‐PCR products represented the WT and SV1 transcripts. The conditions of PCR: denaturation at 95°C for 3 min, 95°C for 15 s, 60°C for 15 s, 72°C for 30 s for 35 cycles, and then 72°C for 5 min for extension. F2/Re‐PCR products represented the WT, SV1, and SV2 transcripts. The conditions of PCR were as follows: denaturation at 95°C for 3 min, 95°C for 15 s, 60°C for 15 s, 72°C for 50 s for 35 cycles, and then 72°C for 5 min for extension. The products were resolved on 1.5% agarose gels and then visualized using the Gel Documentation System (G: BOX, Syngene, UK).

2.4. Western blot

Twenty micrograms of lysate (BCA Protein Assay Kit) were separated on SDS‐PAGE gel and transferred to PVDF. Then, the membranes were blocked with 5% nonfat milk in TBST and incubated with the indicated primary antibodies. Thereafter, the membranes incubated with HRP‐linked IgG were visualized using the enhanced chemiluminescence system (ECL, Cell Signaling Technologies).

The antibodies used were as follows: rabbit anti‐human Cortactin monoclonal antibody (ab81208, Abcam,UK), rabbit anti‐human GAPDH monoclonal antibody (10494‐1‐AP, proteintech, Wuhan, China), rabbit anti‐human PTBP2 (A9124, ABclonal, Wuhan, China), and rabbit anti‐human TIA1 (12133‐2‐AP, proteintech, Wuhan, China).

2.5. Plasmid construction and transfection

Cell transfection was carried out at a working concentration according to the manufacturer's instructions. Ubi‐MCS‐3FLAG‐SV40‐EGFP‐CTTN (Flag‐WT‐CTTN) and mock vector (Flag‐NC) were supplied by Genechem (Shanghai, China). HU6‐MCS‐Ubiquitin‐EGFP‐CTTN (sh‐CTTN) and mock vector (shNC) were supplied by Genechem (Shanghai, China). Small‐interfering RNA (siRNA) for PTBP2, TIA1, and its negative controls were supplied by RiboBio (Guangzhou, China).

The target sequences used in this study were:

• PTBP2_siRNA

• GTGTTACTCTGTCTAAACA

• TIA1_siRNA

• ATGCCCGAGTGGTAAAAGA

• shCTTN1

• CGGCAAATACGGTATCGACAA

• shCTTN2

• GAAAGACTACTCCAGTGGTTT.

2.6. Transwell migration/invasion assay

The transwell assay were conducted with Corning Transwell plates (24 well; 8 μm). NPC cells in 200 μL serum‐free medium were seeded in the upper chamber, and 500 μL medium with 10% FBS was added to the lower chamber. After 12–16 h, the non‐migrating/non‐invading cells attached to the surface of the upper chamber were removed. The cells were fixed and stained, and images were captured. Of note, transwell filters were pre‐coated with Matrigel (BD, USA) for the invasion assay.

2.7. Invadopodia assay

Invadopodia assays were performed following Jie Shen's study. ¹⁶ In brief, 20% nitric acid‐pretreated coverslips (12 mm) were washed and incubated with 50 μg/mL poly‐L‐lysine. Then, coverslips were incubated with enough 0.5% glutaraldehyde and inverted onto gelatin with a droplet size of 30 μL. After 10 min, coverslips were treated with 5 mg/mL sodium borohydride and sterilized with 70% ethanol. Next, coverslips were incubated in pre‐warmed medium in the 12‐well type culture plate for 1 h.

A total of 6 × 10⁴ CNE2 cells pretreated with Flag‐WT‐CTTN, sh‐CTTN, or mock control were seeded on each coverslip. After 24 h culturing, cells were fixed and permeabilized with 0.1% Triton X‐100. Nonspecific binding was blocked with 5% BSA for 2 h. Then, cells were treated with TRITC‐Phalloidin (YESEN, Shanghai, China) for 30 min. After washing in PBS, coverslips were stained with DAPI and captured by confocal microscopy.

2.8. Statistical analysis

Each assay was repeated thrice at least. Statistical results were performed with GraphPad Prism 9. *p < 0.05 **p < 0.01, and ***p < 0.001 were considered significant differences.

3. RESULTS

3.1. High stiffness promotes cell migration, invasion, and invadopodia formation in nasopharyngeal carcinoma

To explore the role of matrix stiffness in NPC progression, we used a collagen‐coated polyacrylamide hydrogel system to mimic soft and stiff substrates ranging from 10 to 60 kPa in vitro (Figure 1A). After 48 h stimulation with different mechanical forces, NPC cells presented a pro‐migration and pro‐invasion phenotype at the high matrix stiffness of 60 kPa examined by transwell assays, which was similar to findings of increasing matrix stiffness inducing malignant phenotype in previous studies ¹⁷ , ¹⁸ (Figure 1B,C). Then, immunofluorescence assays were used to investigate how NPC cells gain the ability to migrate and invade. They showed that increasing matrix stiffness induced invadopodia formation to acquire a mesenchymal morphology (Figure 1D,E). These data demonstrate that matrix stiffness regulates the migration, invasion, and invadopodia formation of NPC cells.

3.2. WT‐CTTN is important for matrix stiffness‐induced invadopodia formation

Alternative splicing (AS) defines as a fundamental process by which a given gene allows the generation of multiple mRNA transcripts to increase protein diversity. It is well known that CTTN regulates invadopodia formation. ¹⁹ , ²⁰ As alternative splicing of CTTN generates WT‐CTTN, SV1‐CTTN, and SV2‐CTTN (Figure 2A), we analyzed CTTN‐related AS events in head and neck squamous carcinoma (HNSC) by utilizing TCGA spliceseq dataset (http://bioinformatics.mdanderson.org/TCGASpliceSeq/). The data showed that the most common type of CTTN alternative splicing is exon 11 skipping. HNSC tissues tend to have higher PSI level of CTTN exon 11 versus normal tissues (73.2% vs. 64.5%) (Figure 2B). RT‐PCR analysis on mRNA from human NPC cells using primers with F1‐Re and F2‐Re were further applied to discriminate between these splice variants involving invadopodia formation. The results showed that WT product and SV1 product were prominently expressed in all cell lines. SV2 expression was hardly detectable (Figure 2C). Additionally, NPC cell lines had a higher WT‐/SV1‐CTTN ratio than the noncancerous nasopharyngeal epithelial cell line NP69 (Figure 2C). Importantly, CNE2 cells with the highest CTTN protein level (Figure 2C) were chosen in subsequent experiments. In addition, as an initial test for verification, we analyzed the effect of WT‐CTTN on matrix stiffness‐induced invadopodia formation for higher expression than SV1‐CTTN. First, CNE2 cells were transfected with FLAG‐tagged WT‐CTTN, lentiviral CTTN‐shRNA, or mock vector (Figure 2D). Then, based on immunofluorescence assays, we found that a decreased CTTN level reduced the difference between soft and stiff substrate groups, whereas upregulation of WT‐CTTN significantly enhanced matrix stiffness‐induced invadopodia formation (Figure 2E,F), indicating that WT‐CTTN was positively associated with matrix stiffness‐induced invadopodia formation.

FIGURE 2.

WT‐CTTN is essential for matrix stiffness‐induced invadopodia formation. (A) Diagram of WT‐CTTN, SV1‐CTTN, and SV2‐CTTN was showed as indicated. (B) Box plot of the percent spliced in (PSI) distribution of CTTN exon 11 was analyzed by utilizing the TCGA spliceseq data set. (C) UP: Levels of CTTN in nasopharyngeal carcinoma (NPC) cells and noncancerous cell line NP69 were measured by western blot. Down: The alternative splicing products of CTTN were analyzed by RT‐PCR using primers with F1 (5‐GGTGTGCAGACAGACAGAC‐3) and Re (5‐TGGTCACAGCTTCGACAGG‐3) (WT, SV1, and SV2) and with F2 (5‐CAGACCCTTAAGGAGAAGG‐3) and Re (5‐TGGTCACAGCTTCGACAGG‐3) (WT and SV1). (D) Transfection efficiency of Flag‐WT‐CTTN and sh‐CTTN vectors were measured by RT‐PCR (left: with primers F1‐Re, right: with forward primer [5‐ataagactggttttggaggc‐3] and reverse primer [5‐ggagtagtcttgctgggact‐3]). (E, F) Invadopodia were visualized by confocal microscopy. Blue, DAPI staining; green, CTTN; red, F‐actin (stained by phalloidin). Statistical analyses were peformed using Two‐way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001.

3.3. WT‐CTTN induces matrix stiffness‐related cell migration and invasion

The increasing invadopodia number per cell is important for tumor migration and invasion, ²¹ , ²² , ²³ we further examined the oncogenic role of WT‐CTTN in NPC. First, TCGA data were applied to assess the relationship between CTTN and clinical outcomes in head and neck cancers (including patients with NPC), showing that patients exhibiting a high CTTN level displayed shorter overall survival (OS) and progression‐free survival (DFS) rates than those with low CTTN level (Figure 3A,B). Next, based on transwell assays, silencing CTTN expression attenuated cell migration and invasion, while WT‐CTTN upregulation enhanced these functions (Figure 3C–F). Moreover, based on transwell assays and the collagen‐coated polyacrylamide hydrogel system, CTTN knockdown reduced the difference between soft and stiff substrate groups, whereas upregulation of WT‐CTTN significantly enhanced matrix stiffness‐induced cell migration and invasion in NPC, indicating that WT‐CTTN was important for matrix stiffness‐induced migration and invasion (Figure 3G–L).

FIGURE 3.

WT‐CTTN induces matrix stiffness‐related cell migration and invasion. (A, B) Statistical analyses of overall survival (OS) and disease‐free survival (DFS) rates of CTTN in head and neck squamous carcinoma (HNSC) patients using TCGA database were show as indicated. (C, D) Transwell assays were performed after transfection with Flag‐NC or Flag‐WT‐CTTN. Statistical analyses were peformed using Student's t‐test. (E, F) Transwell assays were performed after transfection with sh‐NC or sh‐CTTN. Statistical analyses were peformed using Student's t‐test. (G–L) Transwell assays were performed after transfection with Flag‐WT‐CTTN or sh‐CTTN between soft and stiff substrate groups. Statistical analyses were peformed using Two‐way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001.

3.4. WT‐CTTN level is regulated by splicing factors TIA1 and PTBP2

Splicing factors (SFs) are important for AS events through selective removal of introns or inclusion of exons. ²⁴ , ²⁵ To understand SFs in the splicing of CTTN, we analyzed a splicing regulatory network following Li et al., ²⁶ showing that TIA1, PTBP2, SRSF11, RBM5, SRSF15, and HNRNPH1 participated in regulating CTTN alternative splicing. Among these candidate SFs, T‐cell intracellular antigen‐1 (TIA1) and polypyrimidine tract binding protein 2 gene (PTBP2) stood out for greatest effect on CTTN alternative splicing based on Pearson's coefficient (Figure 4A). In addition, TIA1 reduced the ratio of WT‐/SV1‐CTTN in CNE2 cells, whereas PTBP2 increased the ratio of WT‐/SV1‐CTTN (Figure 4B–D), suggesting that overexpression of PTBP2 enhanced inclusion of exon 11 while TIA 1 reduced exon 11 inclusion. Of note, based on the transwell assays and immunofluorescence assays, the migration, invasion, and invadopodia formation blocked by shCTTN in NPC could be restored by TIA1 inhibition, whereas the migration, invasion, and invadopodia formation enhanced by WT‐CTTN overexpression could be abolished by PTBP2 inhibition (Figure 4E–I). These findings indicate that WT‐CTTN is regulated by splicing factors TIA1 and PTBP2 to control cell migration, invasion, and invadopodia formation in NPC.

FIGURE 4.

WT‐CTTN level is regulated by splicing factors TIA1 and PTBP2. (A) Li et al. performed genome‐wide profiling of alternative splicing (AS) events by RNA‐Seq data from TCGA program in head and neck squamous carcinoma (HNSC) patients. We extracted CTTN‐related AS data from their supplementary table S7. (B) Transfection efficiency was measured by western blot analysis. Statistical analyses were peformed using Student's t‐test. (C, D) The AS of WT‐CTTN and SV1‐CTTN affected by TIA1 or PTBP2 knockdown were analyzed by RT‐PCR and western blot analysis. After being transiently transfected with either TIA1‐knockdown siRNAs, PTBP2‐knockdown siRNAs, or control siRNA, RNAs or protein were extracted. Statistical analyses were peformed using Studefnt's t‐test. (E–G) Transwell assays were performed after treatment as indicated. Statistical analyses were peformed using One‐way ANOVA. (H, I) Invadopodia were visualized by confocal microscopy. Blue, DAPI staining; green, CTTN; red, F‐actin (stained by phalloidin). Statistical analyses were peformed using One‐way ANOVA. **p < 0.01, ***p < 0.001.

3.5. High stiffness activates PTBP2 expression to upregulate WT‐CTTN level

To further clairfy the mechanism of high stiffness‐induced cell migration, invasion, and invadopodia formation, we extracted protein from soft and stiff CNE2 cells. Based on western blot assays, we found that PTBP2 instead of TIA1 was significantly upregulated in stiff compared to soft CNE2 cells (Figure 5A). In addition, PTBP2 reduced the ratio of WT‐/SV1‐CTTN in different mechanical settings was validated by RT‐PCR assay (Figure 5B). To investigate whether PTBP2 mediated matrix stiffness‐induced cell migration, invasion, and invadopodia formation, we performed rescue experiments. After transfection with PTBP2 siRNA, soft and stiff CNE2 cells were treated with FLAG‐tagged WT‐CTTN or mock vector. Based on transwell and immunofluorescence assays, PTBP2 knockdown attenuated matrix stiffness‐induced cell migration, invasion, and invadopodia formation. Of note, the abovementioned phenotypes blocked by PTBP2 inhibition could be restored by Flag‐WT‐CTTN treatment (Figure 5C–F). Moreover, western blot assays revealed that PTBP2 knockdown reduced matrix stiffness‐induced WT‐CTTN level, indicating that matrix stiffness promoted malignant phenotypes by activating the PTBP2–WT–CTTN axis (Figure 5G). These results demonstrate that the PTBP2–WT–CTTN level increases upon stiffening and then promotes cell migration, invasion, and invadopodia formation in NPC.

FIGURE 5.

High stiffness activates PTBP2 expression to upregulate the WT‐CTTN level. (A) CNE2 cells treated as indicated were analyzed by western blot. Statistical analyses were peformed using Student's t‐test. (B) The alternative splicing (AS) of WT‐CTTN and SV1‐CTTN affected by PTBP2 knockdown were analyzed by RT‐PCR in different mechanical settings. (C, D) Transwell assays were performed after treatment as indicated. Statistical analyses were peformed using Two‐way ANOVA. (E, F) Invadopodia were visualized by confocal microscopy. Blue, DAPI staining; green, CTTN; red, F‐actin (stained by phalloidin). Statistical analyses were peformed using One‐way ANOVA. (G) Levels of CTTN in nasopharyngeal carcinoma (NPC) cells treated as indicated were measured by western blot. *p < 0.05, **p < 0.01, ***p < 0.001.

4. DISCUSSION

Tumors are influenced by the mechanical signals from their microenvironment. Stiffness is converted to mechanical force signals (e.g., ECM stiffness, local topography, and applied force), ²⁷ which are sensed by cells and lead to downstream biochemical signaling to play a role in tumor invasion and metastasis. ⁹ In this study, we demonstrated that increasing ECM stiffness promotes cell migration, invasion, and invadopodia formation by directly upregulating CTTN level. This mechanotransduction pathway might suggest an important role in nasopharyngeal carcinoma, as CTTN enriched and matrix stiffening act synergistically to promote the carcinogenesis and tumor progression. ²⁸ , ²⁹ , ³⁰

As invadopodia are key to maintain a high cell migration and invasive ability, ²³ we examined the molecular mechanism underlying matrix stiffness‐induced invadopodia formation. Invadopodia are cancer‐specific membrane structures, which are rich in filamentous‐actin and numerous actin regulators. ³¹ Cortical actin‐binding protein (Cortactin or CTTN) is a cytoskeletal actin‐binding protein described as modulation by Src‐mediated tyrosine phosphorylation, which is highly conserved during activation of intracellular cortical signaling. ³² , ³³ Advances in cancer research have been made in understanding the role of CTTN in invadopodia formation, showing that CTTN accumulate in invadopodia and promote the cortical microfilament actin cell skeleton formation. ³⁴ , ³⁵ However, the role of CTTN in matrix stiffness‐induced‐invadopodia is still under investigation.

Human CTTN is intergenic on chromosome 11q13 and is encoded by the EMS1 gene. ³⁶ It was reported to be highly expressed in breast and head and neck carcinoma. ³⁷ Alternative splicing of CTTN generates WT‐CTTN, SV1‐CTTN, and SV2‐CTTN. Among them, SV1‐CTTN is co‐expressed with WT‐CTTN, whereas the SV2 variant has lower abundances. In this study, we confirmed that, consistent with WT‐CTTN, SV1‐CTTN is expressed in all NPC cell lines and noncancerous nasopharyngeal epithelial cell line NP69. Moreover, WT‐CTTN has higher expression than SV1‐CTTN. van Rossum et al. demonstrated that WT‐CTTN increased cell migration, whereas overexpression of SV1‐CTTN showed less motility than cells with higher WT‐CTTN level. ¹⁴ We further evaluated the role of WT‐CTTN in matrix stiffness‐related malignant phenotypes, showing that WT‐CTTN enhanced matrix stiffness‐induced cell migration, invasion, and invadopodia formation.

To understand which factors were related to CTTN splicing, we analyzed a splicing regulatory network following Li et al. For the first time, we demonstrated that PTBP2 and TIA1 dysregulated in NPC are the key regulators of CTTN splicing expression. However, which factor might affect the function of CTTN splicing during matrix stiffness remains to be determined. In this study, we found that PTBP2 instead of TIA1 was upregulated in stiff compared to soft NPC cells. In addition, reduced expression of PTBP2 alleviated the role of WT‐CTTN in matrix stiffness‐related cell migration, invasion, and invadopodia formation. Our study identified that WT‐CTTN regulates matrix stiffness‐related malignant phenotypes, and the most remarkably changed SF in this process is PTBP2.

Overall, our observations suggest that the mechanism whereby matrix stiffness promotes cell migration, invasion, and invadopodia formation is by upregulating WT‐CTTN level. Our study provides evidence that PTBP2 splicing factor knockdown reduces the matrix stiffness‐induced WT‐CTTN level, and matrix stiffness promotes malignant phenotypes by activating PTBP2. Our study indicates that the PTBP2–WT–CTTN axis provides potential molecular targets for preventing matrix stiffness‐related malignant progression in NPC.

AUTHOR CONTRIBUTIONS

Lili Bao: Investigation; validation; writing – original draft; writing – review and editing. Ming Zhong: Investigation; validation. Zixiang Zhang: Investigation; validation. Xiangqing Yu: Investigation; validation. Bo You: Data curation; formal analysis; investigation. Yiwen You: Data curation; formal analysis; investigation. Miao Gu: Data curation; formal analysis; investigation. Qicheng Zhang: Writing – review and editing. Wenhui Chen: Writing – review and editing. Wei Lei: Writing – review and editing. Songqun Hu: Conceptualization; writing – original draft; writing – review and editing.

FUNDING INFORMATION

This work was supported by grants from the National Natural Science Foundation of China (Grant No. 81972554, 82173288, 82372977, and 82303335), the Natural Science Foundation of Jiangsu Province (Grant No. BK20201208), the CSCO Clinical Oncology Research Foundation of Beijing (Grant No. Y‐HR2019‐0463), Jiangsu Provincial Medical Key Discipline (Laboratory) Cultivation Unit (Grant No. JSDW202244), and Jiangsu Provincial Research Hospital (Grant No. YJXYY202204).

CONFLICT OF INTEREST STATEMENT

The authors declare no conflict of interest.

ETHICS STATEMENT

Approval of the research protocol by an institutional review board: All experiments were conducted in accordance with the approved guidelines from Affiliated Hospital of Nantong University (Approval ID: 2018–L048).

Informed consent: N/A.

Registry and the registration number of the study/trial: N/A.

Animal studies: N/A.

Bao L, Zhong M, Zhang Z, et al. Stiffness promotes cell migration, invasion, and invadopodia in nasopharyngeal carcinoma by regulating the WT‐CTTN level. Cancer Sci. 2024;115:836‐846. doi: 10.1111/cas.16075