Abstract
Background
Anaplasma ovis (A. ovis) is the predominant causative agent of anaplasmosis in goats and sheep in most tropical and subtropical regions of the world. However, there is considerable variation in reported infection rates, breed susceptibility, and controversial findings regarding the haemolytic effects of A. ovis infection in goats.
Objectives
Thus, we investigated the molecular and haematological aspects of A. ovis infection in goats from Ahvaz city.
Methods
One hundred and fifty apparently healthy goats (74 blacks and 76 Najdi goats) were randomly sampled from six flocks in the Ahvaz suburb during ticks’ activity season. Haematological evaluation, smear microscopic (SM) examination and PCR assay were performed to assess A. ovis infection. Additionally, the percentage of parasitemia was determined from blood smears.
Results
SM examination revealed that 25.7% of the goats displayed erythrocyte Anaplasma‐like inclusion bodies. PCR analysis indicated that 54% of the goats were positive for A. ovis infection (44.6% of blacks and 63.2% of Najdi goats). No significant difference in haematological values was observed between healthy and infected goats based on PCR testing. However, a significant difference in haematological indices was observed between the group with parasitemia level of 0.01–0.02% (SM and PCR positive) compared to the healthy goats (SM and PCR negative), particularly concerning Hb, PCV and RBC count (p < 0.01).
Conclusions
When the parasitemia exceeds 0.01%, A. ovis infection may disrupt haematological parameters in infected goats. The high prevalence of A. ovis infection (54%) among the studied goats underscores the importance of giving special attention to implementing necessary measures for disease control in the Ahvaz suburb.
Keywords: Anaplasma ovis, Najdi goat, parasitemia, PCR, smear microscopy
Seventy‐sex Najdi and 74 black native goats were included. In blood SM, 25.7% of the goats displayed intra‐erythrocyte Anaplasma‐like inclusion bodies and in PCR assay, 54% were positive for A. ovis infection (44.6% of blacks and 63.2% of Najdi goats). When the parasitemia exceeded 0.01%, A. ovis infection could disrupt the haematological parameters in the infected goats.

1. INTRODUCTION
Rickettsia from the genus Anaplasma are obligate intracellular organisms that have been able to affect the health of humans, domestic animals, and pets in the past few decades (Parola et al., 2005; Cabezas‐Cruz et al., 2019). The species of this genus in ruminant animals include Anaplasma (A) marginale, A. centrale, A. ovis, A. platys, A. bovis, A. phagocytophilum and A. capra. These are causative agents of anaplasmosis, an important disease of domestic animals worldwide. Tick bites primarily transmit these pathogens; however, other types of transmission through fly bites, blood transfusions and contaminated reusable needles have also been reported (Bekker et al., 2002; Uilenberge et al., 1997). This disease not only increases the cost of veterinary care but also causes reduced milk production, reduced body weight, abortion, and even death (Atif, 2015; Stuen et al., 2003; Torina et al., 2008). Tick‐borne diseases significantly impact livestock farmers' livelihoods and are of great importance in developing countries (Perry et al., 2002). A. ovis is the primary causative agent of anaplasmosis in sheep and goats, which has been confirmed in most tropical and subtropical regions of the world (Cabezas‐Cruz et al., 2019; Lacasta et al., 2021; Naeem et al., 2023). This disease is mostly benign, but when combined with other factors such as stress, severe mite infestation, food deprivation, hot air and simultaneous infections, it may lead to the acute stage of the disease (Friedhoff, 1997; Stuen et al., 2003). A molecular prevalence of A. ovis infection (15.3%) has been reported in goats in China (Liu et al., 2012). A high prevalence of A. ovis infection (52.0%) has been found based on DNA detection in goats in France (Cabezas‐Cruz et al., 2019). Jalali et al. (2016) have also detected an infection rate of 65.4% with A. ovis in goats in Ahvaz city.
It has been quoted that A. ovis generally exhibits mild pathogenicity and causes subclinical infections in small ruminants (Cabezas‐Cruz et al., 2019). In addition, it has been noted that this disease typically manifests only mild clinical symptoms unless accompanied by factors that induce stress (Renneker et al., 2013). Conversely, certain researchers have indicated that infection with A. ovis in goats is associated with marked changes in haematological parameters (Ahmadi‐Hamedani et al., 2012). Additionally, reports suggest severe haemolytic disease in sheep and goats caused by this pathogen (Lacasta et al., 2020; Lu, 1997; Tibbitts et al., 1992). Nevertheless, studies on the pathogenicity and haemolytic effects of A. ovis infection in goats have produced conflicting findings.
Najdi goat, a breed prevalent in Iran known for its milk and meat production, is primarily found in the eastern and central regions of Khuzestan province, extending to the coastal areas of the Persian Gulf. While it is minimally present in other parts of the country, limited attention has been given by researchers to the infection rate of A. ovis and its haemolytic effects in goats in Khuzestan province and the Ahvaz suburb region in southwest Iran. Therefore, the objective of the present study was to investigate the molecular and haematological aspects of A. ovis infection in black and Najdi goats in Ahvaz city.
2. MATERIALS AND METHODS
2.1. Animals and sampling
This cross‐sectional study was conducted on 150 apparently healthy goats, including 76 black goats and 74 Najdi goats, which were randomly sampled from six flocks in the five geographical regions (north, south, east, west and centre) of Ahvaz city, located in southwest Iran, during the ticks' activity season, between May and June 2022. The geographical map of the sampling areas is presented in the Figure 1. The average age of the Najdi goats was 2.5 ± 1.3 years, while the average age of the black goats was 1.82 ± 1.1 years.
FIGURE 1.

The geographical map of the 5 sampling areas in Ahvaz city, located in southwest Iran.
For haematological and molecular analyses, a 10 mL blood sample was collected from the Jugular vein of each goat. The blood sample was divided into two EDTA‐containing tubes. Additional independent variables, such as age, gender and cokeeping with the other livestock species, were also recorded. One whole blood sample was immediately transferred to the clinical pathology laboratory for haematological analysis and microscopic examination. The other sample was stored at −20°C until DNA extraction could be performed for PCR analysis in the parasitology laboratory.
Notably, 10 out of the 150 EDTA blood samples were clotted and were therefore not subjected to smear microscopic (SM) examination and haematological analysis.
2.2. SM examination and parasitemia determination
One hundred forty out of 150 blood samples underwent SM examination and haematology analysis. The prepared blood smears were fixed with methanol and stained with Giemsa dye for 15 min. Subsequently, differential white blood cell (WBC) analysis was performed, including lymphocyte, neutrophil and eosinophil counts. Additionally, the smears were examined for the presence of marginally or submarginally Anaplasma‐like inclusion bodies in the erythrocytes.
The parasitemia rate was determined by counting infected red blood cells (RBCs) using a 100× immersion objective lens in a minimum of 20 microscopic fields. The number of infected cells was then expressed as a percentage (Jalali et al., 2013 and 2016; Shompole et al., 1989).
Considering the PCR as the most sensitive and reliable test for diagnosing Anaplasma spp. (Noaman & Shayan, 2010; Shabana et al., 2018), the specificity and sensitivity for the SM method were calculated as follows:
2.3. Haematological examination
Haematological examination included measuring the total WBC (white blood cell) count, RBC (red blood cell) count, haemoglobin (Hb) concentration and packed cell volume (PCV) using an Auto Hematology Analyzer (BC2800, Mindray, China) on EDTA blood samples.
2.4. DNA extraction
According to the manufacturer's instructions, DNA extraction from whole blood samples was performed using a Sinaclon DNA extraction kit (Iran). The extracted DNA was stored at −20°C until performing PCR analysis.
2.5. PCR and sequencing
A pair of oligonucleotide primers targeting the MSP4 gene sequence of A. ovis were utilised, according to the method established by Alessandra and Santo (2012). The Thermocycler used was TC‐96/G/H(b)C (China). The specific primer set designed for A. ovis consisted of the forward primer A. ovis MSP4 Fw (5/‐TGAAGGGAGCGGGGTCATGGG‐3/) and the reverse primer A. ovis MSP4 Rev (5/‐GAGTAATTGCAGCCAGGGACTCT‐3/). The PCR reaction was conducted in a total volume of 25 µL, comprising 12.5 µL of PCR Master Mix (2X, Sinaclon, Iran), 1 µM of each A. ovis primer, 50 ng of DNA and distilled water. The thermal profile for the PCR cycles was as follows: initial denaturation at 95°C for 10 s, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 15 s (specific for A. ovis), and extension at 72°C for 30 s. The final extension step was set at 72°C for 5 min. Subsequently, 7 µL of the PCR product from each sample was subjected to electrophoresis on a 1.5% agarose gel stained with Safe Stain solution. The DNA bands were visualised using a UV transilluminator (Paya Pajouhesh, Iran). The expected size of the PCR product amplified by the A. ovis primer pair was 347 base pairs (bp). One positive control and one negative control sample were included to validate the PCR assay. The positive control sample included a Najdi goat that was previously referred to a Veterinary Teaching Hospital, at Shahid Chamran University of Ahvaz. The infected goat showed lethargy, anorexia, tick infestation, difficulty in breathing, and pale mucous membranes in clinical examination. Haematology results also showed severe anaemia (PCV 13.3% and Hb 4.5 g/dL). In smear microscopic examination, intra‐erythrocyte Anaplasma‐like inclusion bodies were observed and the PCR test was also positive with the expected size of 347 base pairs (bp). The result of its genomic sequencing also confirmed A. ovis infection.
Amplicons corresponding to the expected size from six samples were purified using a PCR purification kit (Vivantis, Revongen Corporation Center, 47600 Subang Jaya, Selangor Darul Ehsan, Malaysia). Amplicons were sequenced using specific primers and a Big Dye Terminator V.3.1 Cycle Sequencing kit in an ABI 3130 Genetic Analyzer (Applied Biosystems, Foster City, California 94404, USA).
2.6. Statistical analysis
Data distribution analysis was conducted using the Kolmogorov–Smirnov test, which revealed that the Hb and PCV values, RBC, WBC and lymphocyte counts followed a normal distribution. On the other hand, the data for neutrophil and eosinophil counts did not exhibit a normal distribution. To investigate the relationship between the infection rate and the variables of age, gender and breed, the chi‐square test and Fisher's exact test were employed. Additionally, the independent sample t‐test was utilised to compare the mean values of haematological indices between the two groups, infected and noninfected, as determined by the PCR test. The Mann–Whitney U test was employed to compare the mean values of neutrophil count and eosinophil count between the infected and noninfected groups. For comparisons between three groups of parasitemia (0.01–0.02%, less than 0.01%, and healthy goats), the one‐way ANOVA and supplementary LSD (least significant difference) tests were used. The significance level was set at p < 0.05. Statistical analysis was performed using SPSS 21.0 for Windows, developed by SPSS Inc., Chicago, IL, USA.
3. RESULTS
3.1. Blood smear microscopic examination and parasitemia findings
A comprehensive analysis was conducted on blood samples obtained from a total of 140 goats, consisting of 64 black and 76 Najdi breed individuals. The results revealed the presence of Anaplasma‐like inclusion bodies in red blood cells (RBCs), with 19 (29.7%) positive cases detected in the black goat group and 17 (22.4%) in the Najdi goat group. Overall, the examination showed that 25.7% of black and Najdi goats exhibited the presence of Anaplasma‐like inclusion bodies (Figure 2).
FIGURE 2.

Najdi goat erythrocytes infected with Anaplasma‐like inclusion bodies (arrow) in a Giemsa‐stained blood smear.
The mean parasitemia values observed in the blood smears of black and Najdi goats infected with Anaplasma‐like inclusion bodies were determined to be 0.0127 ± 0.006% and 0.0141 ± 0.007%, respectively. No statistically significant difference was found in parasitemia percentages between the two goat breeds (p > 0.05).
3.2. PCR results
According to the results of the PCR test, out of the total sample size of 76 Najdi goats and 74 black goats, 48 (63.2%) and 33 (44.6%), respectively, tested positive for A. ovis infection. In total, 81 (54%) out of the 150 goats included in the study were found to be positive for A. ovis infection using the PCR test. The PCR products specific to A. ovis exhibited an expected band size of 347 bp (Figure 3). Among the positive samples, six were sequenced to verify the positive results. The average size fragment of the gene from the amplified A. ovis was 320 bp. The consensus gene sequences were blasted in the NCBI Genbank database, and they showed the A. ovis Msp4 gene percentage identity ranging from 99.33 to 100. The accession numbers OR972395‐OR972400 were obtained for submitted sequences.
FIGURE 3.

Electrophoresis on agarose gel of the amplified product of a fragment of A. ovis msp4 gene by PCR method using A. ovis specific primer. Column 1: negative sample, columns 2 to 5: A. ovis positive samples, column 6: 100‐bp DNA ladder (Cinnagen, Iran), column 7: positive control sample, column 8: negative control sample.
3.3. Relationship between PCR and SM results
Among the 150 blood samples evaluated, 10 samples could not undergo SM preparation due to blood clotting. Consequently, these 10 samples were excluded from the analysis to assess the relationship between SM and PCR results.
Of the remaining 140 goats, PCR results indicated that 75 goats were infected with A. ovis. Of the 75 goats with positive PCR results for A. ovis, 29 were also positive in the SM. Additionally, 7 out of the 65 goats that tested negative for A. ovis in the PCR test were positive in the SM.
Statistical analysis utilising the chi‐square and continuity correction tests revealed a significant relationship between the two diagnostic methods (p < 0.01). The kappa coefficient of agreement for PCR and SM methods was determined to be 20.7%.
The sensitivity and specificity of the SM method were determined as 38.7% and 89.2%, respectively (Alessandra & Santo, 2012; Noaman & Shayan, 2010).
3.4. Relationship of breed, age, sex and keeping with other livestock with the A. ovis infection based on PCR result
The relationship between A. ovis infection and variables such as breed, age, sex and cohabitation with other livestock species was investigated. The statistical analysis revealed a significant association between breed and A. ovis infection (p < 0.02). Specifically, the Najdi breed exhibited a significantly higher infection rate compared to the black breed (Table 1).
TABLE 1.
Relationship between the breed and A. ovis infection based on PCR results.
| Breed | PCR+ for A. ovis | PCR– for A. ovis |
|---|---|---|
| Najdi | 48 (63.3%) | 28 (36.8%) |
| Black | 33 (44.6%) | 41 (55.4%) |
| Total | 81 (54%) | 69 (46%) |
| p Value | < 0.02 | |
The chi‐square analysis indicated a significant relationship between age and A. ovis infection, with goats over 1 year old (in both breeds) showing a significantly higher infection rate than those under 1 year old (p < 0.01) (Table 2). All infected and noninfected goats were kept together with other livestock.
TABLE 2.
Relationship of age and gender with the A. ovis infection based on PCR results.
| Najdi | Black | ||||
|---|---|---|---|---|---|
| PCR+ | PCR– | PCR+ | PCR– | ||
| Age | ≤1 year | 6 (28.6%) | 15 (71.4%) | 9 (26.5%) | 25 (73.5%) |
| >1 year | 42 (76.4%) | 13 (23.6%) | 24 (60.0%) | 16 (40.0%) | |
| Total | 48 (63.1%) | 28 (36.9%) | 33 (44.6%) | 41 (55.4%) | |
| p value | < 0.01 | < 0.01 | |||
| Gender | Female | 45 (66.2%) | 23 (33.8%) | 29 (52.7%) | 26 (47.3%) |
| Male | 3 (37.5%) | 5 (62.5%) | 4 (21.1%) | 15 (78.9%) | |
| Total | 48 (63.1%) | 28 (36.9%) | 33 (44.6%) | 41 (55.4%) | |
| p value | > 0.05 | < 0.03 | |||
In contrast to Najdi goats, black female goats displayed a significantly higher infection rate with A. ovis compared to black male goats (p < 0.03) (Table 2).
3.5. Comparing the haematological indices between the infected and noninfected goats (based on parasitemia)
The haematological indices of two groups with different levels of parasitemia (0.01–0.02% and less than 0.01%) were compared to the group of healthy goats (no parasitemia in SM and negative PCR) using one‐way ANOVA and supplementary LSD test. The analysis demonstrated statistically significant differences in Hb, PCV and RBC count values among the groups (p < 0.01) (Table 3).
TABLE 3.
Comparison of the means ± SD values of the haematological indices between the two groups of infected goats based on parasitemia (%) with the healthy goats.
| Parasitemia (0.01–0.02%) | Parasitemia (< 0.01%) | Healthy | Reference value* | p Value | |
|---|---|---|---|---|---|
| Hb (g/dL) | 6.8 ± 0.7bc | 7.3 ± 0.3ab | 8.5 ± 1.2a | 8–12 | < 0.01 |
| PCV (%) | 18.0 ± 1.7bc | 19.4 ± 1.5ab | 21.2 ± 2.8a | 22–38 | < 0.01 |
| RBC (106/µL) | 12.8 ± 1.6bc | 13.1 ± 0.9ab | 15.7 ± 2.0a | 8–18 | < 0.01 |
| WBC (103/µL) | 14.3 ± 4.0a | 13.1 ± 2.2a | 16.8 ± 5.3a | 4–13 | > 0.05 |
Note: Different superscript letters in each column indicate statistically significant differences between the groups.
∗Constable et al. (2017).
3.6. Comparing the haematological indices between the infected and noninfected Najdi and black goats (based on PCR)
Comparing the mean values of Hb, PCV and RBC count between the infected and noninfected Najdi and black goats by use of an independent sample t‐test did not show any statistically significant differences (p > 0.05) (Table 4).
TABLE 4.
Comparison of the means ± SD of haematological indices between the PCR‐positive and ‐negative results for A. ovis infection in the Najdi and black goats.
| Haematological indices | Najdi goats | p Value | Black goats | p Value | ||
|---|---|---|---|---|---|---|
| PCR+ | PCR– | > 0.05 | PCR+ | PCR– | > 0.05 | |
| Hb (g/dL) | 7.6 ± 1.1 | 7.6 ± 1.3 | > 0.05 | 8.3 ± 1.4 | 8.6 ± 0.9 | > 0.05 |
| PCV (%) | 20.4 ± 2.9 | 20.2 ± 3.0 | > 0.05 | 21.7 ± 3.6 | 21 ± 2.7 | > 0.05 |
| RBC (106/µL) | 13.9 ± 1.9 | 14.4 ± 2.3 | > 0.05 | 14.8 ± 2.3 | 16.1 ± 1.5 | > 0.05 |
| WBC (103/µL) | 16.8 ± 5.7 | 15.4 ± 5.5 | > 0.05 | 16.8 ± 5.3 | 17.1 ± 5.2 | > 0.05 |
| Neutrophil (103/µL) | 6.2 ± 4.2 | 5.5 ± 4.3 | > 0.05 | 6.5 ± 3.1 | 5.3 ± 3.2 | > 0.05 |
| Lymphocyte(103/µL) | 8.0 ± 4.8 | 7.5 ± 4.5 | > 0.05 | 10.0 ± 3.5 | 11.1 ± 3.9 | > 0.05 |
| Eosinophil (103/µL) | 0.3 ± 0.09 | 0.1 ± 0.05 | > 0.05 | 0.33 ± 0.05 | 0.31 ±0.05 | > 0.05 |
4. DISCUSSION
Iran is located in the Palearctic and Oriental zoogeographic regions, with different types of climate. The ecology of ticks, their interactions with the environment and the risk of infection by tick‐borne pathogens are directly related to the spatial and temporal variations. As a result, the diversity of climate and the vast geographical area increases the diversity of tick populations, leading to the risk of transmission of different tick‐borne pathogens. It has been reported that 46 species of ticks (10 Argasidae and 36 Ixodidae) in 10 genera occur in Iran. Tick species can be considered sentinels to track tick‐borne pathogens' circulation before an outbreak. Based on the previous studies, the occurrence of ticks on goats in Iran was 57%, and Rhipicephalus, Haemaphysalis and Dermacentor were the most abundant ticks (Cabezas‐Cruz et al., 2019; Rahbari et al., 2007; Renneker et al., 2013; Sarangi et al., 2021). Ahvaz city, situated in southwestern Iran, is the primary hub of Khuzestan province. With its tropical characteristics and humid climate, the region has been identified as a hotspot for tick infestation and anaplasmosis in domestic ruminants. A systematic review and meta‐analysis conducted by Soosaraei et al. (2020) demonstrated that Khuzestan province exhibits the highest prevalence of anaplasmosis compared to other regions in Iran.
4.1. SM discussion
Examining peripheral blood smears (SM) is a traditional technique for diagnosing rickettsial infections in vertebrate hosts (Lew & Jorgensen, 2005). Among the 150 goats studied, 140 underwent SM examination, revealing an infection rate of 25.7% with Anaplasma‐like inclusion bodies. A study conducted by Razmi et al. (2006) in Mashhad reported a 38.9% infection rate of A. ovis in goats using the SM method. Similarly, El Hamdi et al. (2022) observed an overall prevalence of 40.5% A. ovis infection in lambs and ewes in Tunisia through SM examination. In contrast, Nasreen et al. (2016) reported a lower infection rate of 8.3% in goats in Pakistan. These findings diverge from the results of the present study. Conversely, Noaman et al. (2009) in Isfahan (33.3%) and Jalali et al. (2013) in Ahvaz (29%) reported prevalence rates based on the SM method that aligned with the current study's findings. These variations in infection rates may be influenced by geographic differences, different breeds and species, climate conditions, carrier conditions and farmers’ lack of awareness regarding disease transmission (Rahman et al., 2022; Soosaraei et al., 2020). Additionally, factors such as varying sample sizes, diagnostic method implementation, material quality, and expertise levels of specialists may contribute to differences in study results. It is essential to distinguish Anaplasma‐like inclusion bodies from Heinz bodies, Howell–Jolly bodies and colour depositions, particularly during low parasitemia, which can present a challenge even for highly skilled specialists (Carelli et al., 2007; Ge et al., 1995).
4.2. PCR discussion
Among the 150 goats studied, 81 (54%) were found to be infected with A. ovis based on PCR testing. In a previous study conducted by Jalali et al. (2016) on 100 local (black) goats using PCR in the Ahvaz region, the rate of A. ovis infection was 30%. In the current study, the infection rate of black goats was determined to be 44.3%, indicating a significant increase (from 30% to 44.3%) over 6 years (from 2016 to 2022), which can be considered a health concern. Ahmadi‐Hamedani et al. (2012) also reported a similar high prevalence of A. ovis infection (63.7%) in 193 goats in north and northeastern Iran. Conversely, Mohammadian et al. (2021) reported a lower prevalence of 10% in sheep in the Kurdistan province, west Iran. Likewise, a recent study in the Corsica region of France reported a high prevalence of A. ovis infection (52%) in the goat population using PCR testing, which aligns with the present study's findings (Cabezas‐Cruz et al., 2019).
Fluctuations in infection rates across different studies could be influenced by factors such as geographical variations, climate conditions (Almahallawi et al., 2022), different breeds (Galon et al., 2022), tick control programs (Rahman et al., 2022), differences in husbandry methods, as well as farmers' lack of knowledge regarding iatrogenic transmission contributing to disease spread. The high rate of A. ovis infection (54%) observed in the studied goats highlights the need for special attention and appropriate measures to control the disease in the Ahvaz suburb.
Regarding the relationship between SM and PCR results, out of the 97 goats that tested positive in the PCR test and underwent SM examination, 36 goats (37.1%) were positive for SM. The remaining PCR‐positive goats that tested negative in the SM examination could be considered persistently infected animals. In this context, Ruiz et al. (2023) have previously mentioned long‐lasting A. ovis infection throughout the productive life of sheep. Conversely, 7 out of the 65 goats that tested negative for A. ovis in the PCR test were positive in the SM. It may result from multi‐species Anaplasma mixed infection, as recently shown by researchers such as Aung et al. (2022) and Ochirkhuu et al. (2017). Therefore, exploring the possibility of multiple species mixed infections in such situations would be valuable. Given the low kappa coefficient of agreement (0.20) found between PCR and SM methods, SM is unsuitable for detecting low parasitemia in carrier or persistently infected goats.
4.3. Relationship between A. ovis infection and animal variables of breed, age and sex
The present results indicate a significant effect of breed on the A. ovis infection rate in goats. Specifically, the Najdi breed showed a significantly higher infection rate with A. ovis than the black breed (63.2% vs. 44.6%, respectively). Previous research by Rahman et al. (2022) has also identified breed as a significant risk factor associated with anaplasmosis in goats. Similarly, a recent survey reported that local goat breeds exhibited higher resistance to anaplasmosis than exotic breeds (Galon et al., 2022). Currently, limited information is available regarding breed resistance to anaplasmosis in goats. However, one possible explanation could be the greater susceptibility of exotic breeds to tick bites when compared to local breeds (Galon et al., 2022; Schwalback et al., 2003). Despite these explanations, both the black and Najdi breeds are native to the Khuzestan province, and no definitive reason has been identified to explain the difference in their sensitivity to anaplasmosis. However, the traditional husbandry practices of Najdi goats, including keeping them in small‐size flocks, confined housing, and often in proximity to other farm animals such as horses, dogs and domestic birds, may contribute to this disparity.
A significant relationship between age and A. ovis infection was observed in the studied goats. Goats older than 1 year old exhibited a significantly higher infection rate than those under 1 year old. In accordance with the present study, Cabezas‐Cruz et al. (2019) found that goats older than 3 years were at a higher risk of contracting A. ovis than younger ones. Zhou et al. (2017) have previously reported a higher A. ovis infection rate in aged sheep. The potential for increased contact rates in older animals can explain this. Furthermore, female goats showed a significantly higher infection rate with A. ovis than males in the present study. This finding is consistent with the results reported by Yousefi et al. (2017) and Abdullah et al. (2020) in goats, as well as Belal et al. (2014) in cows. It is suggested that female goats may be more susceptible to anaplasmosis due to increased stress levels such as parturition and inadequate food supply, especially towards the end of pregnancy. Additionally, hormonal imbalances during milk production and mating have been proposed as potential predisposing factors by interfering with the immune status (Abdullah et al., 2020; Rahman et al., 2022).
4.4. Comparing the haematological indices between the infected and noninfected groups
When the PCR test was used to diagnose infected and noninfected goats, no significant differences were found in the Hb, PCV and RBC count values between the two groups. This finding is consistent with the study conducted by Mohammed and Idoko (2012) in Nigeria, where no significant difference in haematological parameters was observed between seemingly healthy goats with A. ovis infection and noninfected goats. Most infected goats in the current study, which tested positive in PCR but showed no parasitemia in SM (microscopic examination of blood smears), were in a chronic or persistent infection state. This may explain why there were no significant changes in the haematological indices compared to the noninfected group.
Interestingly, among the studied goat flocks that showed no signs of illness during sampling, the infected goats with parasitemia levels ranging from 0.01% to 0.02% exhibited subclinical lower levels of Hb, PCV and RBC count compared to the group with parasitemia below 0.01% and the noninfected goats. Specifically, the mean PCV value of the infected goats with 0.01–0.02% parasitemia (18.0 ± 1.7%) was lower than the normal PCV range of 22–38% reported by Constable et al. (2017) for goats.
5. CONCLUSIONS
It appears that A. ovis infection with parasitemia exceeding 0.01% may impact haematological parameters in infected goats. Furthermore, goats that tested positive only in the PCR test were likely in a chronic or persistent infection state. The high prevalence of A. ovis infection (54%) among the studied goats underscores the importance of giving special attention to implementing necessary measures for disease control in the Ahvaz suburb.
AUTHOR CONTRIBUTIONS
Hossein Hamidinejat: Conceptualisation; investigation; methodology; project administration; writing – review & editing. Ali Abbas Nikvand; Conceptualisation; investigation; methodology; formal analysis; writing – original draft; and writing – review & editing. Maryam Abbas Zadeh; Investigation and data curation. Seyedeh Missagh Jalali: Investigation; methodology; data curation; writing – original draft; writing – review & editing. Somayeh Bahrami: Investigation; methodology; and data curation.
CONFLICT OF INTEREST STATEMENT
The authors declare that they have no conflict of interest regarding this study.
ETHICS STATEMENT
Sampling and all the experiments in this study were carried out in compliance with the requirements of the animal welfare committee of Shahid Chamran University following the Iranian Veterinary Medical Association guidelines. (Ethical Approval No. EE/401.24.3.89117/SCU.AC.IR).
PEER REVIEW
The peer review history for this article is available at https://www.webofscience.com/api/gateway/wos/peer-review/10.1002/vms3.1404.
ACKNOWLEDGEMENTS
This work was supported by Shahid Chamran University of Ahvaz, Grant/Award Number: SCU.VC1401.30378.
Abbas Zadeh, M. , Hamidinejat, H. , Nikvand, A. A. , Jalali, S. M. , & Bahrami, S. (2024). Molecular and haematological investigations on Anaplasma ovis infection in goats in Ahvaz, Iran: Insights into infection rate, haemolytic effect and breed influences. Veterinary Medicine and Science, 10, e1404. 10.1002/vms3.1404
DATA AVAILABILITY STATEMENT
Data are available upon reasonable request to the corresponding author.
REFERENCES
- Abdullah, D. A. , Ali, F. F. , Jasim, A. Y. , Ola‐Fadunsin, S. D. , Gimba, F. I. , & Ali, M. S. (2020). Clinical signs, prevalence, and hematobiochemical profiles associated with Anaplasma infections in sheep of North Iraq. Veterinary World, 13(8), 1524–1527. 10.14202/vetworld.2020.1524-1527 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ahmadi‐hamedani, M. , Khaki, Z. , Rahbari, S. , & Ahmadi‐Hamedani, M. A. (2012). Hematological profiles of goats naturally infected with Anaplasma ovis in north and northeast Iran. Comparative Clinical Pathology, 21, 1179–1182. 10.1007/s00580-013-1692-x [DOI] [Google Scholar]
- Alessandra, T. , & Santo, C. (2012). Tick‐borne diseases in sheep and goats: Clinical and diagnostic aspects. Small Ruminant Research, 106, S6–S11. 10.1016/j.smallrumres.2012.04.026 [DOI] [Google Scholar]
- Almahallawi, R. , Omer, S. A. , Hazazi, H. , Amor, N. , Mohammed, H. O. , & Mohammed, O. B. (2022). Occurrence of anaplasmosis among sheep (Ovis aries) and goats (Capra hircus) in Madina and Tabuk, Saudi Arabia. Journal of King Saud University Science, 43(4), 101929. 10.1016/j.jksus.2022.101929 [DOI] [Google Scholar]
- Atif, F. A. (2015). Anaplasma marginale and Anaplasma phagocytophilum: Rickettsiale pathogens of veterinary and public health significance. Parasitology Research, 114(11), 3941–3957. 10.1007/s00436-015-4698-2 [DOI] [PubMed] [Google Scholar]
- Aung, A. , Kaewlamun, W. , Narapakdeesakul, D. , Poofery, J. , & Kaewthamasorn, M. (2022). Molecular detection and characterization of tick‐borne parasites in goats and ticks from Thailand. Ticks and Tick‐borne Diseases, 13(3), 101938. 10.1016/j.ttbdis.2022.101938 [DOI] [PubMed] [Google Scholar]
- Bekker, C. P. , De Vos, S. , Taoufik, A. , Sparagano, O. A. , & Jongejan, F. (2002). Simultaneous detection of Anaplasma and Ehrlichia species in ruminants and detection of Ehrlichia ruminantium in Amblyomma variegatum ticks by reverse line blot hybridization. Veterinary Microbiology, 89, 223–238. 10.1016/s0378-1135(02)00179-7 [DOI] [PubMed] [Google Scholar]
- Belal, S. S. H. , Al Mahmud, M. A. , & Ferdous, M. J. (2014). Prevalence of anaplasmosis in cattle in Sirajganj district of Bangladesh. Research in Agriculture, Livestock and Fisheries, 1(1), 97–103. 10.3329/ralf.v1i1.22370 [DOI] [Google Scholar]
- Cabezas‐Cruz, A. , Gallois, M. , Fontugne, M. , Allain, E. , Denoual, M. , Moutailler, S. , Devillers, E. , Zientara, S. , Memmi, M. , Chauvin, A. , Agoulon, A. , Vayssier‐taussat, M. , & Chartier, C. (2019). Epidemiology and genetic diversity of Anaplasma ovis in goats in Corsica, France. Parasites & Vectors, 12(3), 1–11. 10.1186/s13071-018-3269-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carelli, G. , Decaro, N. , Lorusso, A. , Elia, G. , Lorusso, E. , Mari, V. , Ceci, L. , & Buonavoglia, C. (2007). Detection and quantification of Anaplasma marginale DNA in blood samples of cattle by real‐time PCR. Veterinary Microbiology, 124, 107–114. 10.1016/j.vetmic.2007.03.022 [DOI] [PubMed] [Google Scholar]
- Constable, P. D. , Hinchcliff, K. W. , Done, S. H. , & Grunberg, W. (2017). A Textbook of the Diseases of Cattle, Horses, Sheep, Pigs, and Goats (11th ed., pp. 2217–2218). New York: Saunders Ltd. [Google Scholar]
- El Hamdi, S. , Mhadhbi, M. , Ben Said, M. , Mosbah, A. , Gharbi, M. , Klabi, I. , Daaloul‐Jedidi, M. , Belkahia, H. , Selmi, R. , Darghouth, M. A. , & Messadi, L. (2022). Anaplasma ovis prevalence assessment and cross validation using multiparametric screening approach in sheep from central Tunisia. Pathogens, 11, 1358. 10.3390/pathogens11111358 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Friedhoff, K. T. (1997). Tick‐borne diseases of sheep and goats caused by Babesia, Theileria or Anaplasma spp. Parassitologia, 39(1), 99–109. PMID: 9530692. [PubMed] [Google Scholar]
- Galon, E. M. , Ybañez, R. H. , Macalanda, A. M. , Estabillo, G. R. , Montano, M. T. R. , Veedor, M. D. , Garvida, A. , Fabon, R. J. , Callanta, M. R. , Labutong, K. J. , Tumwebaze, M. A. , Byamukama, B. , Ji, S. , Zafar, I. , Ybanez, A. , & Xuan, X. (2022). First Molecular Identification of Babesia, Theileria, and Anaplasma in Goats from the Philippines. Pathogen, 11(10), 1109. 10.3390/pathogens11101109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ge, N. L. , Kocan, K. M. , Murphy, G. L. , & Blouin, E. F. (1995). Detection of Anaplasma marginale DNA in bovine erythrocytes by slot‐blot and in situ hybridization with a PCR‐mediated digoxigenin‐labeled DNA probe. Journal of Veterinary Diagnostic Investigation, 7, 465–472. 10.1177/104063879500700407 [DOI] [PubMed] [Google Scholar]
- Jalali, S. M. , Bahrami, S. , Rasooli, A. , & Hasanvand, S. (2016). Evaluation of oxidant/antioxidant status, trace mineral levels, and erythrocyte osmotic fragility in goats naturally infected with Anaplasma ovis . Tropical Animal Health and Production, 48(6), 1175–1181. 10.1007/s11250-016-1071-0 [DOI] [PubMed] [Google Scholar]
- Jalali, S. M. , Khaki, Z. , Kazemi, B. , Bandehpour, M. , Rahbari, S. , Razi Jalali, M. , & Yasini, S. P. (2013). Molecular detection and identification of Anaplasma species in sheep from Ahvaz, Iran. Iranian Journal of Veterinary Research, 14, 50–56. 10.22099/ijvr.2013.1389 [DOI] [Google Scholar]
- Lacasta, D. , Ferrer, L M. , Sanz, S. , Labanda, R. , González, J. M. , Benito, A. A. , Ruiz, H. , Rodriguez‐Largo, A. , & Ramos, J. J. (2020). Anaplasmosis outbreak in lambs: First report causing carcass condemnation. Animals, 10, 1851. 10.3390/ani10101851 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lacasta, D. , Lorenzo, M. , Gonzalez, J. M. , Ruiz de Arcaute, M. , Benito, A. Á. , Baselga, C. , Milian, M. E. , Lorenzo, N. , Jimenez, C. , Villanueva‐Saz, S. , & Ferrer, L. M. (2021). Epidemiological study related to the first outbreak of ovine anaplasmosis in Spain. Animals, 11(7), 2036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lew, A. , & Jorgensen, W. (2005). Molecular approaches to detect and study the organisms causing bovine tick borne diseases: Babesiosis and anaplasmosis. African Journal of Biotechnology, 4, 292–302. 10.5897/AJB2005.000-3058 [DOI] [Google Scholar]
- Liu, Z. , Ma, M. , Wang, Z. , Wang, J. , Peng, Y. , Li, Y. , Guan, G. , Luo, J. , & Yin, H. (2012). Molecular survey and genetic identification of Anaplasma species in goats from central and southern China. Applied Environmental Microbiology, 78(2), 464–470. 10.1128/AEM.06848-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lu, W. (1997). Ovine anaplasmosis in northwest China. Tropical Animal Health and Production, 29(4), 16S–18S. 10.1007/BF02632909 [DOI] [Google Scholar]
- Mohammadian, B. , Noaman, V. , & Emami, S. J. (2021). Molecular survey on prevalence and risk factors of Anaplasma spp. infection in cattle and sheep in West of Iran. Tropical Animal Health and Production, 53, 266. 10.1007/s11250-021-02707-1 [DOI] [PubMed] [Google Scholar]
- Mohammed, G. , & Idoko, I. S. (2012). Hemoparasites and hematological evaluations in Sokoto Res goats slaughtered during the dry season in Sabon Gari local government area, Kaduna state, Nigeria. Nigerian Veterinary Journal, 33(1), 407–415. [Google Scholar]
- Naeem, M. , Amaro‐Estrada, I. , Taqadus, A. , Swelum, A. A. , Alqhtani, A. H. , Asif, M. , Sajid, M. , Khan, A. U. , Tariq, A. , Anjum, S. , & Khan, A. (2023). Molecular prevalence and associated risk factors of Anaplasma ovis in Pakistani sheep. Frontiers in Veterinary Science, 10, 1096418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nasreen, A. , Saeed, K. , Khan, A. , Niaz, S. , & Akhtar, N. (2016). Serodiagnosis and haematological effect of anaplasmosis in goats and sheep of district Mardan, Khyber Pakhtunkhwa, Pakistan. World Journal of Zoology, 11(2), 67–80. 10.5829/idosi.wjz.2016.11.2.10341 [DOI] [Google Scholar]
- Noaman, V. , Shayan, P. , & Amininia, N. (2009). Molecular diagnostic of Anaplasma marginale in carrier cattle. Iranian Journal of Parasitology, 4(1), 26–33. [Google Scholar]
- Noaman, V. , & Shayan, P. (2010). Comparison of microscopy and PCR‐RFLP for detection of Anaplasma marginale in carrier cattle. Iranian Journal of Microbiology, 2(2), 89–94. PMCID: PMC3279773. [PMC free article] [PubMed] [Google Scholar]
- Ochirkhuu, N. , Konnai, S. , Odbileg, R. , Murata, S. , & Ohashi, K. (2017). Molecular epidemiological survey and genetic characterization of Anaplasma species in Mongolian livestock. Vector‐Borne and Zoonotic Diseases, 17(8), 539–549. 10.1089/vbz.2017.2111 [DOI] [PubMed] [Google Scholar]
- Parola, P. , Davoust, B. , & Raoult, D. (2005). Tick‐ and flea‐borne rickettsial emerging zoonoses. Veterinary Research, 36, 469–492. 10.1051/vetres:2005004 [DOI] [PubMed] [Google Scholar]
- Perry, B. D. , Randolph, T. F. , Mcdermott, J. J. , Sones, K. R. , & Thornton, P. K. (2002). Investing in animal health research to alleviate poverty. International Livestock Research Institute. Corpus ID: 82692850. [Google Scholar]
- Rahbari, S. , Nabian, S. , & Shayan, P. (2007). Primary report on distribution of tick fauna in Iran. Parasitology Research, 101, 175–177. [DOI] [PubMed] [Google Scholar]
- Rahman, M. , Faruque, M. R. , Rahman, M. M. , & Chowdhury, M. Y. E. (2022). Epidemiology and molecular detection of Anaplasma spp. in goats from Chattogram district, Bangladesh. Veterinary Medicine and Science, 8(4), 1240–1249. 10.1002/vms3.775 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Razmi, G. R. , Dasrjerdi, K. , Hosseini, H. , Naghibi, A. , Barati, F. , & Aslani, M. R. (2006). An epidemiological study on Anaplasma infection in cattle, sheep, and goats in Mashhad suburb, Khorasan Province, Iran. Annals of the New York Academy of Sciences, 1078, 479–481. 10.1196/annals.1374.089 [DOI] [PubMed] [Google Scholar]
- Renneker, S. , Abdo, J. , Salih, D. E. A. , Karagenç, T. , Bilgiç, H. , Torina, A. , Oliva, A. G. , Campos, J. , Kullmann, B. , Ahmed, J. , & Seitzer, U. (2013). Can Anaplasma ovis in small ruminants be neglected any longer? Transboundary and Emerging Diseases, 60, 105–112. 10.1111/tbed.12149 [DOI] [PubMed] [Google Scholar]
- Ruiz, H. , de Arcaute, M. R. , Benito, A. A. , Villanueva‐Saz, S. , & Calasanz, J. (2023). Long‐lasting infection with Anaplasma ovis in sheep. Veterinary Research Communication, 74(3), 1–5. 10.1007/s11259-023-10186-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarangi, L. N. , Rana, S. K. , Prasad, A. , Ponnanna, N. M. , & Sharma, G. K. (2021). Prevalence of antibodies to Anaplasma in cattle and buffaloes of different organized herds in India. Journal of Parasitic Diseases, 45(2), 359–365. 10.1007/s12639-020-01312-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schwalback, M. J. , Greyling, J. P. C. , & David, M. (2003). The efficacy of a 10% aqueous Neem (Azadirachta indica) seed extract for tick control in Small East African and Toggenburg female goat kids in Tanzania. South African Journal of Animal Science, 33(2), 83–88. 10.4314/sajas.v33i2.3760 [DOI] [Google Scholar]
- Shabana, I. I. , Alhadlag, N. M. , & Zaraket, H. (2018). Diagnostic tools of caprine and ovine anaplasmosis: a direct comparative study. BMC Veterinary Research, 14(165), 1–8. 10.1186/s12917-018-1489-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shompole, S. , Waghela, S. D. , Rurangirwa, F. R. , & McGuire, T. C. (1989). Cloned DNA probes identify Anaplasma ovis in goats and reveal a high prevalence of infection. Journal of Clinical Microbiology, 27(12), 2730–2735. 10.1128/jcm.27.12.2730-2735.1989 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stuen, S. , Nevland, S. , & Moum, T. (2003). Fatal cases of tick‐borne fever (TBF) in sheep caused by several 16S rRNA gene variants of Anaplasma phagocytophilum . Annals of the New York Academy of Sciences, 990, 433–434. 10.1111/j.1749-6632.2003.tb07407.x [DOI] [PubMed] [Google Scholar]
- Soosaraei, M. , Haghi, M. M. , Etemadifar, F. , Fakhar, M. , Teshnizi, S. H. , Asfaram, S. , & Esboei, B. R. (2020). Status of Anaplasma spp. infection in domestic ruminants from Iran: A systematic review with meta‐analysis. Parasite Epidemiology and Control, 11, e00173. 10.1016/j.parepi.2020.e00173 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tibbitts, T. , Goff, W. , Foreyt, W. , & Stiller, D. (1992). Susceptibility of two Rocky Mountain bighorn sheep to experimental infection with Anaplasma ovis . Journal of Wildlife Diseases, 28, 125–129. 10.7589/0090-3558-28.1.125 [DOI] [PubMed] [Google Scholar]
- Torina, A. , Alongi, A. , Naranjo, V. , Scimeca, S. , Nicosia, S. , Di Marco, V. , Caracappa, S. , Kocan, K. M. , & de la Fuente, J. (2008). Characterization of Anaplasma infections in Sicily, Italy. Annals of the New York Academy of Science, 1149, 90–93. [DOI] [PubMed] [Google Scholar]
- Uilenberge, G. (1997). General review of tick‐borne diseases of sheep and goats worldwide. Parasitologia, 39, 161–165. [PubMed] [Google Scholar]
- Yousefi, A. , Rahbari, S. , Shayan, P. , Sadeghi‐Dehkordi, Z. , & Bahonar, A. (2017). Molecular detection of Anaplasma marginale and Anaplasma ovis in sheep and goat in west highland pasture of Iran. Asian Pacific Journal of Tropical Biomedicine, 7(5), 455–459. 10.1016/j.apjtb.2017.01.017 [DOI] [Google Scholar]
- Zhou, M. , Cao, S. , Sevinc, F. , Sevinc, M. , Ceylan, O. , Ekici, S. , Jirapattharasate, C. , Moumouni, P. F. , Liu, M. , Wang, G. , Iguchi, A. , Vudriko, P. , Suzuki, H. , & Xuan, X. (2017). Molecular detection and genetic characterization of Babesia, Theileria and Anaplasma amongst apparently healthy sheep and goats in the central region of Turkey. Ticks and Tick Borne Diseases, 8, 246–252. 10.1016/j.ttbdis.2016.11.006 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data are available upon reasonable request to the corresponding author.
