Abstract
Background:
The MUC1 gene encodes glycoproteins attached to cell membrane that play a protective role in gastric cancer and protect epithelial surfaces against external factors such as Helicobacter pylori. H. pylori infection can induce a cascade of innate and acquired immune responses in gastric mucosa. Relationship between rs4072037G>A polymorphism of MUC1 gene and increased susceptibility to H. pylori infection aimed to investigate in patients with gastric cancer in Mazandaran, northern Iran.
Methods:
A case-control study was conducted on 99 patients with gastric cancer (H. pylori positive and negative) and 98 controls (H. pylori positive and negative) without gastric cancer (confirmed by pathological biopsy samples obtained during endoscopy). H. pylori infection was diagnosed by histological examination using Giemsa staining. Genomic DNA extracted from peripheral blood was analyzed by PCR-RFLP technique.
Results:
Analysis of all genetic models showed no significant relationship between rs4072037G>A polymorphism and risk of gastric cancer (GC). The relationship between H. pylori infection and rs4072037G>A polymorphism showed an increased susceptibility to gastric cancer in both positive and negative H. pylori groups (including case and control groups). The genetic model of GA/GG and H. pylori- positive versus GA/GG and H. pylori-negative showed a significantly increased susceptibility to gastric cancer (OR=0.251, CI: 0.128-0.493, P=0.000).
Conclusion:
These findings indicate that rs4072037G>A polymorphism may interact with H. pylori infection to increase the risk of GC.
Key Words: Gastric cancer, H. pylori, MUC1 5640G>A polymorphism, PCR-RFLP, Genotype.
Cardiac and non-cardiac gastric cancers are common all over the world. Gastric cancer with more than 1,000,000 new cases and 783,000 deaths (about 1 in 12 deaths worldwide) is the fifth most common cancer in the world and was the third leading cause of cancer death in 2018 (1). The prevalence of gastric cancer is more than twice higher in men than women. Gastric cancer is the most common cancer in men and the leading cause of death in several West Asian countries such as Iran, Turkmenistan, and Kyrgyzstan (1). The prevalence rate of gastric cancer in Iran is reported to be as high as 7300 cases per year and is the most common cancer among both sexes (2). Gastric cancer is highly prevalent in northern provinces of Iran, including Mazandaran, Golestan, and Ardabil (3, 4). Involvement of different environmental factors such as alcohol, smoking, diet (high salt intake and low fruit consumption), and infectious agents like H. pylori has been investigated in gastric cancer (1).
The prevalence of H. pylori infection varies in different countries. H. pylori contamination is prevalent in about 70% of Iranian people (5) and is responsible for 90% of new cases of noncardiac gastric cancer (1). H. pylori is a gram-negative, microerophilic and flagellate bacterium (6). Most people are exposed to H.pylori infection during childhood and usually develop gastritis during lifetime. The bacterium causes chronic inflammation and significantly increases the risk of developing gastric ulcer disease and gastric cancer which is the result of H.pylori binding to gastric mucosal epithelial cells, inducing an inflammatory response, gastric epithelial cells mutation, inhibition of apoptosis, stimulation of angiogenesis, and cell proliferation (7, 8).
MUC1 gene encodes a membrane-bound glycoprotein that binds to upper surface of the gastrointestinal epithelium by a transmembrane domain and protects epithelial surfaces against harmful environmental factors (9, 10). There are three types of mucin, two secretories, MUC5AC and MUC6, and a membrane bound, MUC1, which is dominant in gastric mucus (11, 12). MUC1 is known as a tumor-associated molecule in many cancers due to overexpression and abnormal glycolysis (13). This gene is involved in transformation of malignancy by interacting or regulating the function of other protein like beta-catenin and p53 (14, 15).
MUC1 rs4072037 polymorphism (ref SNP ID: 5640; G> A) is located in exon 2 of the MUC1 gene. This polymorphism is involved in alternative splicing which can produce two different products: a full-length transcription or an incomplete transcription product without a tandem repeat or TR domain. The conversion of variant A (ACGG) to variant B (ACAG) leads to creation of a new splicing acceptor position. Allele G and A rs4072037 polymorphism lead to long and short VNTR, respectively. The rs4072037A allele causes deletion of 9 amino acids in MUC1 gene product. It is believed that, as a result, this truncated non-functional protein increases the risk of gastric cancer (16-20).
The length of VNTR allele of the MUC1 gene affects susceptibility to H. pylori (21). It is reported that the smallest size of VNTR allele is associated with H. pylori infection (13) which then alters the structure and function of gastric epithelial mucins. MUC1 and MUC5AC are major known mucins that play a protective role against H.pylori in carcinogenic process (22). The bacterial gastric pathogen H. pylori expresses several adhesins that target mucin glycan structures. The BabA adhesin binds to the fucosylated ABO/Lewis b antigen (Leb) and H type 1 antigens on mucins, while the SabA adhesin binds to the sialyl-Lewis x (sLex) and sialyl-Lewis an antigens (sLea). The released MUC1 binds to H. pylori and thus can act as a decoy receptor to prevent adhesion of the organism to the epithelial surface. Additional evidence of the barrier function of MUC1 is that knockdown of MUC1 expression results in more H. pylori adhesion even when bacteria lack the BabA and SabA adhesins. MUC1 prevents this type of H. pylori binding likely by steric hindrance due to its long rigid filamentous structure (23).
Association between rs4072037 G>A polymorphism of MUC1 gene and susceptibility to H. pylori in patients with gastric cancer (H.pylori positive or negative) compared with healthy individuals (H. pylori positive or negative was aimed to investigate in this study.
Methods
Population study: 99 patients were recruited with gastric cancer (78 males and 19 females, mean age: 66.11 ± 9.1 years) from outpatient chemotherapy and oncology wards in Comprehensive Cancer Center in Sari Imam Khomeini Hospital, Iran. The patients were selected based on clinical signs, tumor location, and tumor grade and stage according to WHO criteria. Also, 98 control samples (78 men and 19 women, mean age: 56.95±18.4 years) were selected from patients in Sari Imam Khomeini Hospital due to a gastrointestinal problems. Although a bigger sample size will be better, unfortunately for some limitations, it was not possible to gather more samples in this research.
Pathological examination of endoscopic biopsy specimens of these patients showed no signs of gastric cancer. The presence of H.pylori in gastric biopsy specimens was determined using Giemsa staining. This research was approved by the Ethics Committee of Mazandaran University of Medical Sciences (IR.MAZUMS.IMAMHOSPITAL. REC.1398.6561). Sampling from patients and controls were applied after filling an informed consent form, which is taken from all participants in this research.
DNA extraction: Peripheral venous blood (5 ml) was collected in a tube containing EDTA and stored at minus 80 °C. Blood samples were taken from patients before chemotherapy. Also, blood samples were taken from the control group after endoscopy of patients with gastrointestinal symptoms and confirmation of no cancerous mass by a gastroenterologist. Control group with malignant biopsy specimens who were confirmed by pathology examination were excluded from the study. Genomic DNA was extracted using a blood DNA extraction kit (Denazist, Iran) according to the manufacturer's instructions.
Genotype analysis: PCR-RFLP method was used to analyze the polymorphism of rs4072037G>A MUC1 gene. A fragment of 188 bp PCR containing polymorphism rs4072037G>A of MUC1 gene with a total reaction volume of 25 μl was amplified using two primers: The primers for PCR were designed by ourselves and the fragment sizes also were defined using different bioinformatics softwares, like Primer-BLAST and Gene Runner. Forward primer: TAAAGACCCAACCCTATGACT and Reverse primer: AGAGTACGCTGCTGGTCATACTC. A reaction mixture containing 2 μl of template DNA, 12 μl of 2x PCR Master Mix RED (Amplicon, Denmark), 10 μl of distilled water, and 0.3 μl of both forward and reverse primers. PCR reactions were performed under the following conditions: 94°C for 5 minutes followed by 35 cycles of 94°C for 60 seconds and 72°C for 60 seconds. The annealing temperature was set at 60°C for 60 seconds and PCR product was observed on 1% agarose gel containing Green Viewer ™ DNA dye. The 188 bp PCR products were digested using ALWNI restriction enzyme for 5 hours at 37°C according to the conditions mentioned in the enzyme protocol (Thermo-Fisher Scientific, USA). After enzymatic digestion, the products were observed by 2% agarose gel electrophoresis containing Green Viewer ™ DNA dye. Enzymatic digestion products included: undigested homozygous GG genotype (188 bp), digested AA homozygous genotype (114 and 74 bp), and heterozygous GA genotype produced three fragments of 188, 114 and 74 bp (fig.1). After actual restriction enzyme digestion, the PCR fragments were exactly the same size as we designed and predicted.
Statistical analysis: Statistical analysis was performed using SPSS V22 software package, (SPSS, Chicago, IL, USA). Chisquare test was used to evaluate the differences in distributions of demographic characteristics between gastric cancer patients and normal controls. The expected frequency of control genotypes was tested against Hardy–Weinberg equilibrium. The odds ratio (OR) and 95% confidence interval (CI) were calculated using a logistic regression model and p<0.05 was considered statistically significant. Otherwise, the pooled ORs and 95% CIs without adjustments were calculated for frequencies of rs4072037 (G>A) alleles and genotypes, respectively. We also used two-stage Mendelian Randomisation (MR) method to investigate individual causal relationships between allele status and helicobacter pylori infection and gastric cancer as dependent variable. Statistical power in Mendelian randomization studies was calculated with STATA 11.
Results
Demographic and pathological information of 99 case and 98 control group (H.pylori-negative and H.pylori-positive subgroups) are summarized in tables 1 and 2, respectively. No significant relationship was observed between rs4072037 G>A polymorphism of MUC1 gene and risk of gastric cancer in all genetic models (table 3). The genotype and allelic frequency of rs4072037 G>A and their relationship with gastric cancer and H. pylori risk are summarized in tables 4 and 5. Also, the relationship between rs4072037 G>A polymorphism genotypes and pathological features of gastric tumor are summarized in table 6. Also, the relationship between rs4072037G> A polymorphism genotypes and H. pylori in case and control groups was examined against increased susceptibility to gastric cancer. Findings showed no significant relationship between the frequencies of GG, GA, and AA genotypes and negative H. pylori and positive H. pylori in case and control groups (P= 0.760 and P= 0.785, respectively) (table 4). When the GA/GG genotype of rs4072037 was considered as a reference in negative H. pylori, a significant difference was found between GA/GG genotype in positive H. pylori group (OR = 0.251, 95% CI: 0.128–0.493, p = 0.000) (table 5). Also a Mendelian Normalisation (MR) test between allele status and helicobacter pylori infection and gastric cancer as dependent variable show that rs4072037 had not causally affected (beta=0.276, se=0.564, P=0.626). The statistical power in Mendelian randomization analysis was 0.42 for AA genotype in compared with GA/GG genotypes.
Table 1.
Demographic characteristics of the cases and controls groups
| Sex | Control | Case | P-value |
|---|---|---|---|
| Male | 71 (72.4) | 80 (80.8) | 0.181 |
| Female | 27 (27.6) | 19 (19.2) | |
| Age | 56.95±18.4 | 66.11±9.1 | 0.000 |
Table 2.
Tumor characteristics, including tumor site, tumor grade, lymphatic invasion, perineural invasion, tumor stage and tumor type (n=99)
| Characteristics | n | Percentage | |
|---|---|---|---|
| Tumor site | Cardia | 16 | 16.2 |
| Non-Cardia | 83 | 83.8 | |
| Grade | 1 | 6 | 6.1 |
| 2 | 56 | 56.6 | |
| 3 | 37 | 37.4 | |
| Lymphatic invasion | Present | 62 | 62.6 |
| Absent | 37 | 37.4 | |
| Perineural invasion | Present | 36 | 36.4 |
| Absent | 63 | 63.6 | |
| T (Tumor) | 1 | 1 | 1.0 |
| 2 | 37 | 37.4 | |
| 3 | 50 | 50.5 | |
| 4 | 11 | 11.1 | |
| N (Nodes) | 0 | 25 | 25.3 |
| 1 | 32 | 32.3 | |
| 2 | 35 | 35.4 | |
| 3 | 7 | 7.1 | |
| M (Metastasis) | 0 | 71 | 71.7 |
| 1 | 28 | 28.3 | |
| Stage | 1 | 17 | 17.2 |
| 2 | 32 | 32.3 | |
| 3 | 24 | 24.2 | |
| 4 | 26 | 26.3 | |
| Tumor type | Diffuse | 59 | 60.2 |
| Intestinal | 39 | 39.8 | |
Table 3.
Comparison of genotype and allele frequencies of MUC1 gene polymorphisms between gastric cancer patients (n=99) and normal controls (n=98) using chi-square analysis
| SNP a | Genotype/Allele | Controls(n=98) | Cases(n=99) | OR b (95% CI c ) | P -value |
|---|---|---|---|---|---|
| MUC1 5640G>A (rs4072037) | AA | 21 (21.4) | 16 (16.2) | - | - |
| GA | 43 (43.9) | 47 (47.5) | 0.697 (0.323-1.507) | 0.359 | |
| GG | 34 (34.7) | 36 (36.4) | 0.720 (0.323-1.604) | 0.421 | |
| GA+GG | 77 (78.6) | 83 (83.8) | 0.707 (0.344-1.453) | 0.345 | |
| GA+AA | 64 (65.3) | 63 (63.6) | 0.930 (0.519-1.667) | 0.807 | |
| AA+GG | 55 (56.1) | 52 (52.5) | 0.865 (0.494-1.516) | 0.612 | |
| A | 85 (43.4) | 79 (39.9) | - | - | |
| G | 111 (56.6) | 119 (60.1) | 0.867 (0.581-1.294) | 0.485 |
Table 4.
Interaction of polymorphism genotypes rs4072037G> A in case and control groups with negative and positive H. pylori infection
| H. pylori status | Genotypes | Controls(n =98) | Cases(n = 99) | P- value | ||
|---|---|---|---|---|---|---|
| n | % | n | % | |||
| - | GG | 27 | 36.5 | 19 | 43.2 | 0.760 |
| GA | 31 | 41.9 | 17 | 38.6 | ||
| AA | 16 | 21.6 | 8 | 18.2 | ||
| + | GG | 7 | 29.2 | 17 | 30.9 | 0.785 |
| GA | 12 | 50.0 | 30 | 54.5 | ||
| AA | 5 | 20.8 | 8 | 14.5 | ||
| Total | GG | 34 | 34.7 | 36 | 36.4 | 0.636 |
| GA | 43 | 43.9 | 47 | 47.5 | ||
| AA | 21 | 21.4 | 16 | 16.2 | ||
Table 5.
Joint effects of H. pylori seropositivity and variants of the rs4072037 polymorphism on risk of GC
| H. pylori status | Genotypes | Controls(n =98) | Cases(n = 99) | OR(95% CI) | P- value | ||
|---|---|---|---|---|---|---|---|
| n | % | n | % | ||||
| - | GA+GG | 58 | 59.1 | 36 | 36.3 | - | - |
| AA | 16 | 16.4 | 8 | 8.1 | 1.241 (0.482-3.194) | 0.654 | |
| + | GA+GG | 19 | 19.4 | 47 | 47.5 | 0.251 (0.128-0.493) | 0.000 |
| AA | 5 | 5.1 | 8 | 8.1 | 0.388 (0.118-1.278) | 0.120 | |
Table 6.
Distribution of genotypes MUC1 rs4072037G>A by tumor characteristics
| Variable | rs4072037 | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| GG | GA | AA | p -value | GG+GA | p -value | AA+GA | P -value | ||
| Tumor site | Cardia | 6 (37.5) | 7 (43.8) | 3 (18.8) | 0.932 | 13 (81.2) | 0.719 | 10(62.5) | 1.000 |
| Non-Cardia | 30 (36.1) | 40 (48.2) | 13 (15.7) | 70 (84.3) | 53(63.9) | ||||
| Grade | I | 1 (16.7) | 4 (66.7) | 1 (16.7) | 0.376 | 5 (83.3) | 0.232 | 5(83.3) | 0.386 |
| II | 19 (33.9) | 25 (44.6) | 12 (21.4) | 44 (78.6) | 37(66.1) | ||||
| III | 16 (43.2) | 18 (48.6) | 3 (8.1) | 34 (91.9) | 21(56.8) | ||||
| Lymphatic invasion | Present | 25 (40.3) | 28 (45.2) | 9 (14.5) | 0.554 | 53 (85.5) | 0.583 | 37(59.7) | 0.388 |
| Absent | 11 (29.7) | 19 (51.4) | 7 (18.9) | 30 (81.1) | 26(70.3) | ||||
| Perineural invasion | Present | 11 (30.6) | 19 (52.8) | 6 (16.7) | 0.648 | 30 (83.3) | 1.000 | 25(69.4) | 0.394 |
| Absent | 25 (39.7) | 28 (44.4) | 10 (15.9) | 53 (84.1) | 38(60.3) | ||||
| T (Tumor) | T1 | 0 (0.0) | 0 (0.0) | 1 (100.0) | 0.413 | 0 (0.0) | 0.144 | 1(100.0) | 0.772 |
| T2 | 14 (37.8) | 18 (48.6) | 5 (123.5) | 32 (86.5) | 23(62.2) | ||||
| T3 | 17 (34.0) | 25 (50.0) | 8 (16.0) | 42 (84.0) | 33(66.0) | ||||
| T4 | 5 (45.5) | 4 (36.4) | 2 (18.2) | 9 (81.8) | 6(54.5) | ||||
| N (Nodes) | N0 | 7 (28.0) | 14 (56.0) | 4 (16.0) | 0.745 | 21(84.0) | 0.519 | 18(72.0) | 0.767 |
| N1 | 13 (40.6) | 16 (50.0) | 3 (9.4) | 29(90.6) | 19(59.4) | ||||
| N2 | 13 (37.1) | 14 (40.0) | 8 (22.9) | 27(77.1) | 22(62.9) | ||||
| N3 | 3 (42.9) | 3 (42.9) | 1 (14.3) | 6(85.7) | 4(57.1) | ||||
| M (Metastasis) | M0 | 28 (39.4) | 33 (46.5) | 10 (14.1) | 0.503 | 61(85.9) | 0.377 | 43(60.6) | 0.360 |
| M1 | 8 (28.6) | 14 (50.0) | 6 (21.4) | 22(78.6) | 20(71.4) | ||||
| Stage | I | 5 (29.4) | 9 (52.9) | 3 (17.6) | 0.588 | 14(82.4) | 0.311 | 12(70.6) | 0.493 |
| II | 14 (43.8) | 15 (46.9) | 3 (9.4) | 29(90.6) | 18(56.2) | ||||
| III | 10 (41.7) | 11 (45.8) | 3 (12.5) | 21(87.5) | 14(58.3) | ||||
| IV | 7 (26.9) | 12 (46.2) | 7 (26.9) | 19(73.1) | 19(73.1) | ||||
| Tumor type | Diffuse | 19 (32.2) | 29 (49.2) | 11 (18.6) | 0.593 | 48(81.4) | 0.580 | 40(67.8) | 0.396 |
| Intestinal | 16 (41.0) | 18 (46.2) | 5 (12.8) | 34(87.2) | 23(59) | ||||
Discussion
We evaluated the association between polymorphism rs4072037G>A MUC1 gene with Helicobacter pylori in patients with gastric cancer in a case-control study. Previous studies have shown that MUC1 gene polymorphisms are associated with susceptibility to gastric cancer (24, 25).
Helicobacter pylori causes a wide range of gastrointestinal injuries from gastric ulcers to gastric adenocarcinoma (21). The human mucin (MUC) family consists of MUC1 to MUC21, which are classified into secretory (e.g. MUC2, MUC5AC, MUC5B, and MUC6) and transmembrane members (e.g., MUC1, MUC4, and MUC20) (26, 27). MUC1, MUC4, MUC13, and MUC16 are single pass type I transmembrane proteins and act as a protective mucus gel through their O-glycosylated repetitive ectodomines. MUC1 in the stomach is a ligand for Helicobacter pylori that plays an important role in gastric carcinogenesis (20). The MUC1 N-terminal subunit (MUC1-N) contains highly conserved 20 amino acid tandem repeats (with rs4072037 G allele in MUC1 gene) that are extensively modified by O-glycans. Alterations in glycosyl-transferase expression in malignant cells leads to glycosylation of MUC1-N tandem repeats (TR domain) (28).
According to evidence, homozygous AA genotype (small size VNTR) is associated with an increased risk of H. pylori infection and gastric cancer (29-34). Adherence of H. pylori is dependent on the expression of bacterial adhesins and cognate host glycans, displayed by glycoproteins and glycosphingolipids in gastric epithelium and also by mucins in the gastric mucus layer (35). MUC1 can block the adhesion of HP blood group antigen-binding adhesion and sialic acid-binding adhesion to the gastric mucosa, which in turn limits the HP colonization, and MUC1 acts as a barrier against exogenous insults in normal epithelial cells. Therefore, low expression of MUC1 may cause a reduction in its barrier function in the stomach and subsequently increases GCa susceptibility (36).
We compared allele (G vs. A) and genotype (GA vs. AA; GG vs. AA) between cases and controls along with dominant model (AG + AA vs. GG), recessive model (AA vs. AG + GG), and over-dominant model (AA+GG vs. AG) (37). Also the association of rs4072037 polymorphism and H. pylori with susceptibility to gastric cancer is evaluated. In our previous study which was published earlier, with 91 GC patients and 96 controls, a significant relationship was observed between rs4072037G>A and susceptibility to GC (38). The present study, though did not show such association. Because of the limitation in sample size, which may lead to limited statistical power in this study. Fifty individuals with gastritis were investigated as controls which also may contradict the result if rs4072037G>A play a role in susceptibility to gastric cancer. Similarly, a meta-analysis by Xinyang Liu et al. included a hospital-based control group with gastritis and a healthy population-based control group. In that research, hospital-based control group could influence the role of MUC1 gene rs4072037 polymorphism in carcinogenesis (39).
Silva et al. reported that Colombian and Portuguese patients with chronic gastritis were genetically different in VNTR locus. They showed that smaller VNTR genotypes of the MUC1 gene increase susceptibility to intestinal metaplasia in Colombian patients with gastritis. They also observed that MUC1 gene polymorphism is involved in the development of chronic atrophic gastritis and intestinal metaplasia, which is a precursor to gastric carcinoma (40). Moreover, immunohistochemical analysis of 95 patients with gastritis in Northern Europe showed relation between susceptibility to gastritis and the length of MUC1 gene functional allele (41).
In the current study, comparison of rs4072037 AG/GG genotypes and H. pylori positive shows an association P= 0.000) with OR =0.251 and 95% confidence interval 0.128-0.493. H. pylori causes a wide range of gastrointestinal injuries from gastric ulcers to gastric adenocarcinoma (21). MUC1 membrane mucosa is abnormally expressed in different cancers and in the stomach, it is a ligand for H. pylori and plays a key role in gastric carcinogenesis (20). MUC1 is involved in negative regulation of NLRP3 inflammation by regulating NF-κB nuclear factor pathway. Regulation of NLRP3 inflammatory activity by MUC1 is critical for prevention of severe gastritis (28). Variable number of 20 amino acid tandem repeat units (VNTR or TR domain) lead to polymorphisms in the extracellular domain of MUC1 protein. People infected with H. pylori with shorter VNTRs are more susceptible to gastritis and increased risk of stomach cancer (41). MUC1 expression is induced by inflammatory cytokines (tumor necrosis factor-α (TNFα), interferon-γ, IL-6) and Lack of IL-10 and its anti-inflammatory response leads to impaired regulation of MUC1 activation, resulting in chronic inflammation and progression of carcinogenesis. In this regard, the conventional factor-κB kinase-β (IKKβ)–nuclear factor-κB (NF-κB) inhibitory pathway is a possible mediator of cancer progression due to inflammation induced by microorganisms such as Helicobacter pylori (41). Functional polymorphism rs4072037 in MUC1 gene involved in inflammatory response in patients with H. pylori is significantly associated with a predisposition to gastric cancer (32). An immunohistochemical analysis based on TR antibody showed that H. pylori may react with MUC1 TR domain on the surface of gastric epithelium and stimulate shedding and internalization. Also, an association was found between functional allele length differences in response to H. pylori (41). The association between small sizes of VNTR and increased risk of H. pylori infection is confirmed (42) and homozygous Short-Short (SS) VNTR of the MUC1 gene is reported to be associated with H. pylori compared to the Long-Long (LL) genotype (43, 44).
A meta-analysis by Beom Su Kim et al. 2020, also showed an association between A allele of rs4072037 and GC. For diffuse-type GC, an association was observed for heterozygous GA (GA vs AA), and AG/GG vs. AA in a dominant model. But, no associations were observed with intestinal type-GC (31).
There are some limitations in the present study. First, although age, sex, and tumor site were taken into consideration for subgroup analysis, other important risk factors, such as diet, smoking and drinking status were missing, which might also contribute to the etiology of GC. Second, hospital-based control group limited the role of rs4072037 polymorphism of MUC1 gene in carcinogenesis, so it is also important and may have a different genetic basis in the etiology. Third, the sample size of the cases and control was largely reduced in the analysis, which may lead to limited statistical power in analysis. In the previous study (38), it is not exactly clear that a strong relationship exists between MUC1 rs4072037 polymorphism and gastric cancer. Also, there was not any study in Iranian population available in this regard. More importantly, the relationship between this polymorphism, H. Pylori and gastric cancer is not clear yet.
The lack of association between rs4072037G> A polymorphism and gastric cancer in this research may be related to small sample size as well as due to the presence of gastritis patients among control group. Also, an association between rs4072037G>A, H. pylori and susceptibility to gastric cancer may show an example of gene-environment interactions in etiology of gastric cancer. Future works with larger sample size are needed to be investigate the relation of rs4072037 G>A and risk of gastric cancer in Iranian populations and other ethnicities to prove current findings.
Acknowledgments
The authors gratefully acknowledge the financial support of Mazandaran University of Medical Sciences and collaboration of Cancer Registration Center at Mazandaran University of Medical Sciences and all the volunteers who participated in this study.
Funding:
The current study was financially supported by Mazandaran University of Medical Sciences (Grant No. 6561). The funding bodies played no role either in the design of the study, data collection, analysis, interpretation of data, or in the writing of the manuscript.
Ethics approval and consent to participate:
Ethical approval for the study was granted by the Mazandaran University of Medical Sciences (Sari Imam Khomeini Hospital) before the study was conducted (approval number: IR.MAZUMS.IMAMHOSPITAL.REC.1398.6561). All experiments were performed in accordance with relevant medical guidelines and global and local regulations. In our samples, there was no any less than 16 year and also all participants provided signed, written informed consent before study entry. Sampling from patients and controls were applied after filling an informed consent form, which is taken from all the participants in this research.
Consent for publication:
Not Applicable
Availability of data and materials:
The datasets used and/or analyzed during the current study are available from the author for correspondence upon reasonable request
Conflict of Interests:
The authors declare that they have no competing interests.
Authors’ contribution:
M.B.H.S. and R.S.H. conceived and designed the study; H.J. collected samples based on pathological features; R.A. and H.J. performed the experiments; R.A.N. and R.A. analyzed and interpreted the data; R.S.H. and M.B.H.S. and R.A. wrote and edited the manuscript; all authors read and approved the final manuscript.
References
- 1.Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394–424. doi: 10.3322/caac.21492. [DOI] [PubMed] [Google Scholar]
- 2.Farmanfarma KK, Mahdavifar N, Hassanipour S, Salehiniya H. Epidemiologic Study of Gastric Cancer in Iran: A Systematic Review. Clin Exp Gastroenterol. 2020;13:511–42. doi: 10.2147/CEG.S256627. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Malekzadeh R, Derakhshan MH, Malekzadeh Z. Gastric cancer in Iran: epidemiology and risk factors. Arch Iran Med. 2009;12:576–83. [PubMed] [Google Scholar]
- 4.Pourfarzi F, Whelan A, Kaldor J, Malekzadeh R. The role of diet and other environmental factors in the causation of gastric cancer in Iran—a population based study. Int J Cancer. 2009;125:1953–60. doi: 10.1002/ijc.24499. [DOI] [PubMed] [Google Scholar]
- 5.Eghbali Z, Mojtahedi A, Ansar MM, Asl SF, Aminian K. Detection of 23SrRNA mutations strongly related to clarithromycin resistance in Helicobacter pylori strains isolated from patients in the north of Iran. Jundishapur J Microbiol. 2016;9:e29694. doi: 10.5812/jjm.29694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ruggiero P. Helicobacter pylori and inflammation. Curr Pharm Des. 2010;16:4225–4236. doi: 10.2174/138161210794519075. [DOI] [PubMed] [Google Scholar]
- 7.Chiba T, Marusawa H, Seno H, Watanabe N. Mechanism for gastric cancer development by Helicobacter pylori infection. J Gastroenterol Hepatol. 2008;23:1175–1181. doi: 10.1111/j.1440-1746.2008.05472.x. [DOI] [PubMed] [Google Scholar]
- 8.Lillehoj EP, Guang W, Ding H, Czinn SJ, Blanchard TG. Helicobacter pylori and gastric inflammation: Role of MUC1 mucin. J Pediatr Biochem. 2012;2:125–132. doi: 10.3233/JPB-2012-00058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gendler SJ. MUC1, the renaissance molecule. J Mammary Gland Biol Neoplasia. 2001;6:339–353. doi: 10.1023/a:1011379725811. [DOI] [PubMed] [Google Scholar]
- 10.Sun H, Wu X, Wu F, et al. Associations of genetic variants in the PSCA, MUC1 and PLCE1 genes with stomach cancer susceptibility in a Chinese population. PloS One. 2015;10:e0117576. doi: 10.1371/journal.pone.0117576. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Radziejewska I, Leszczyńska K, Borzym-Kluczyk M. Influence of monoclonal anti-Lewis b, anti-H type 1, and anti-sialyl Lewis x antibodies on binding of Helicobacter pylori to MUC1 mucin. Mol Cell Biochem. 2014;385:249–255. doi: 10.1007/s11010-013-1833-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Díaz P, Valenzuela Valderrama M, Bravo J, Quest AF. Quest, Helicobacter pylori and gastric cancer: adaptive cellular mechanisms involved in disease progression. Front Microbiol. 2018;9:5. doi: 10.3389/fmicb.2018.00005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bafna S, Kaur S, Batra SK. Membrane-bound mucins: the mechanistic basis for alterations in the growth and survival of cancer cells. Oncogene. 2010;29:2893–2904. doi: 10.1038/onc.2010.87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Wei X, Xu H, Kufe D. Kufe, Human MUC1 oncoprotein regulates p53-responsive gene transcription in the genotoxic stress response. Cancer cell. 2005;7:167–178. doi: 10.1016/j.ccr.2005.01.008. [DOI] [PubMed] [Google Scholar]
- 15.Sousa AM, Rei M, Freitas R, et al. Effect of MUC1/β-catenin interaction on the tumorigenic capacity of pancreatic CD133+ cells. Oncol Lett. 2016;12:1811–1817. doi: 10.3892/ol.2016.4888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Zhang L, Vlad A, Milcarek C, Finn OJ. Human mucin MUC1 RNA undergoes different types of alternative splicing resulting in multiple isoforms. Cancer Immunol Immunother. 2013;62:423–435. doi: 10.1007/s00262-012-1325-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Saeki N, Ono H, Yanagihara K, et al. rs2294008T, a risk allele for gastric and gallbladder cancers, suppresses the PSCA promoter by recruiting the transcription factor YY 1. Genes Cells. 2015;20:382–391. doi: 10.1111/gtc.12228. [DOI] [PubMed] [Google Scholar]
- 18.Wen R, Gao F, Zhou CJ, Jia YB. Polymorphisms in mucin genes in the development of gastric cancer. World J Gastrointest Oncol. 2015;7:328–37. doi: 10.4251/wjgo.v7.i11.328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Xu Q, Yuan Y, Sun LP, et al. Risk of gastric cancer is associated with the MUC1 568 A/G polymorphism. Int J Oncol. 2009;35:1313–20. doi: 10.3892/ijo_00000449. [DOI] [PubMed] [Google Scholar]
- 20.Ng W, Loh AX, Teixeira AS, Pereira SP, Swallow DM. Genetic regulation of MUC1 alternative splicing in human tissues. Br J Cancer. 2008;99:978–85. doi: 10.1038/sj.bjc.6604617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Dhar P, Ng GZ, Sutton P. How host regulation of Helicobacter pylori-induced gastritis protects against peptic ulcer disease and gastric cancer. Am J Physiol Gastrointest Liver Physiol. 2016;311:G514–G520. doi: 10.1152/ajpgi.00146.2016. [DOI] [PubMed] [Google Scholar]
- 22.Hu L, Chen W, Cheng M, et al. MUC1 and MUC5AC Acting on Helicobacter pylori-Related Deficiency and Solid Syndrome of Spleen and Stomach. Evid Based Complement Alternat Med. 2018;2018:9761919. doi: 10.1155/2018/9761919. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Li X. The multifaceted role of mucin MUC1 in bacterial infections. PhD thesis. Utrecht Univ Respo; 2021. [Google Scholar]
- 24.Saeki N, Sakamoto H, Yoshida T. Mucin 1 gene (MUC1) and gastric-cancer susceptibility. Int J Mol Sci. 2014;15:7958–73. doi: 10.3390/ijms15057958. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Liu P, Zeng M. Role of MUC1 rs4072037 polymorphism in gastric cancer: a meta-analysis. Int J Clin Exp Pathol. 2020;13:465–72. [PMC free article] [PubMed] [Google Scholar]
- 26.Voynow JA, Rubin BK. Mucins, mucus, and sputum. Chest. 2009;135:505–12. doi: 10.1378/chest.08-0412. [DOI] [PubMed] [Google Scholar]
- 27.Ma J, Rubin BK, Voynow JA. Mucins, Mucus, and Goblet Cells. Chest. 2018;154:169–76. doi: 10.1016/j.chest.2017.11.008. [DOI] [PubMed] [Google Scholar]
- 28.Kufe DW. Mucins in cancer: function, prognosis and therapy. Nat Rev Cancer. 2009;9:874–85. doi: 10.1038/nrc2761. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ligtenberg MJ, Gennissen AM, Vos HL, Hilkens J. A single nucleotide polymorphism in an exon dictates allele dependent differential splicing of episialin mRNA. Nucleic Acids Res. 1991;19:297–301. doi: 10.1093/nar/19.2.297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Imbert Y, Darling DS, Jumblatt MM, et al. MUC1 splice variants in human ocular surface tissues: possible differences between dry eye patients and normal controls. Exp Eye Res. 2006;83:493–501. doi: 10.1016/j.exer.2006.01.031. [DOI] [PubMed] [Google Scholar]
- 31.Kim BS, Lee I, Yook JH, Song K, Kim BS. Association between the MUC1 rs4072037 Polymorphism and Risk of Gastric Cancer and Clinical Outcomes. J Gastric Cancer. 2020;20:127–38. doi: 10.5230/jgc.2020.20.e11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Li M, Huang L, Qiu H, et al. Helicobacter pylori infection synergizes with three inflammation-related genetic variants in the GWASs to increase risk of gastric cancer in a Chinese population. PloS One. 2013;8:e74976. doi: 10.1371/journal.pone.0074976. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Jia Y, Persson C, Hou L, et al. A comprehensive analysis of common genetic variation in MUC1, MUC5AC, MUC6 genes and risk of stomach cancer. Cancer Causes Control. 2010;21:313–21. doi: 10.1007/s10552-009-9463-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Carvalho F, Seruca R, David L, et al. MUC1 gene polymorphism and gastric cancer–an epidemiological study. Glycoconj J. 1997;14:107–11. doi: 10.1023/a:1018573201347. [DOI] [PubMed] [Google Scholar]
- 35.Lindén SK, Sheng YH, Every AL, et al. MUC1 limits Helicobacter pylori infection both by steric hindrance and by acting as a releasable decoy. PLoS Pathog. 2009;5:e1000617. doi: 10.1371/journal.ppat.1000617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Qiu LX, Hua RX, Cheng L, et al. Genetic variant rs4072037 of MUC1 and gastric cancer risk in an Eastern Chinese population. Oncotarget. 2016;7:15930–6. doi: 10.18632/oncotarget.7527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Horita N, Kaneko T. Genetic model selection for a case–control study and a meta-analysis. Meta gene. 2015;5:1–8. doi: 10.1016/j.mgene.2015.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Alikhani R, Taravati A, Hashemi-Soteh MB. Association of MUC1 5 640G> A and PSCA 5057C> T polymorphisms with the risk of gastric cancer in Northern Iran. BMC Med Genet. 2020;21:1–8. doi: 10.1186/s12881-020-01085-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Liu X, Wang Z, Zhang X, et al. MUC1 gene polymorphism rs4072037 and susceptibility to gastric cancer: a meta-analysis. Springerplus. 2014;3:1–8. doi: 10.1186/2193-1801-3-599. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Silva F, Carvalho F, Peixoto A, et al. MUC1 polymorphism confers increased risk for intestinal metaplasia in a Colombian population with chronic gastritis. Eur J Hum Genet. 2003;11:380–4. doi: 10.1038/sj.ejhg.5200978. [DOI] [PubMed] [Google Scholar]
- 41.Vinall LE, King M, Novelli M, et al. Altered expression and allelic association of the hypervariable membrane mucin MUC1 in Helicobacter pylori gastritis. Gastroenterology. 2002;123:41–9. doi: 10.1053/gast.2002.34157. [DOI] [PubMed] [Google Scholar]
- 42.Reis CA, David L, Carvalho F, et al. Immunohistochemical study of the expression of MUC6 mucin and co-expression of other secreted mucins (MUC5AC and MUC2) in human gastric carcinomas. J Histochem Cytochem. 2000;48:377–388. doi: 10.1177/002215540004800307. [DOI] [PubMed] [Google Scholar]
- 43.Nguyen TV, Janssen MJ, Gritters P, et al. Short mucin 6 alleles are associated with H pylori infection. World J Gastroenterol. 2006;12:6021–5. doi: 10.3748/wjg.v12.i37.6021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Peleteiro B, Lunet N, Santos-Silva F, et al. Short mucin 1 alleles are associated with low virulent H pylori strains infection. World J Gastroenterol. 2007;13:1885. doi: 10.3748/wjg.v13.i12.1885. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the author for correspondence upon reasonable request