Skip to main content
PLOS One logoLink to PLOS One
. 2024 Mar 8;19(3):e0299567. doi: 10.1371/journal.pone.0299567

Novel insights into RAGE signaling pathways during the progression of amyotrophic lateral sclerosis in RAGE-deficient SOD1 G93A mice

Natalia Nowicka 1,*, Kamila Zglejc-Waszak 1,*, Judyta Juranek 1, Agnieszka Korytko 1, Krzysztof Wąsowicz 2, Małgorzata Chmielewska-Krzesińska 2, Joanna Wojtkiewicz 1
Editor: Belgin Sever3
PMCID: PMC10923448  PMID: 38457412

Abstract

Amyotrophic lateral sclerosis (ALS) is neurodegenerative disease characterized by a progressive loss of motor neurons resulting in paralysis and muscle atrophy. One of the most prospective hypothesis on the ALS pathogenesis suggests that excessive inflammation and advanced glycation end-products (AGEs) accumulation play a crucial role in the development of ALS in patients and SOD1 G93A mice. Hence, we may speculate that RAGE, receptor for advanced glycation end-products and its proinflammatory ligands such as: HMGB1, S100B and CML contribute to ALS pathogenesis. The aim of our studies was to decipher the role of RAGE as well as provide insight into RAGE signaling pathways during the progression of ALS in SOD1 G93A and RAGE-deficient SOD1 G93A mice. In our study, we observed alternations in molecular pattern of proinflammatory RAGE ligands during progression of disease in RAGE KO SOD1 G93A mice compared to SOD1 G93A mice. Moreover, we observed that the amount of beta actin (ACTB) as well as Glial fibrillary acidic protein (GFAP) was elevated in SOD1 G93A mice when compared to mice with deletion of RAGE. These data contributes to our understanding of implications of RAGE and its ligands in pathogenesis of ALS and highlight potential targeted therapeutic interventions at the early stage of this devastating disease. Moreover, inhibition of the molecular cross-talk between RAGE and its proinflammatory ligands may abolish neuroinflammation, gliosis and motor neuron damage in SOD1 G93A mice. Hence, we hypothesize that attenuated interaction of RAGE with its proinflammatory ligands may improve well-being and health status during ALS in SOD1 G93A mice. Therefore, we emphasize that the inhibition of RAGE signaling pathway may be a therapeutic target for neurodegenerative diseases.

Introduction

The latest evidence on the role of the Receptor for Advanced Glycation End-products (RAGE) in the pathogenesis of neurodegenerative diseases revealed that RAGE plays a crucial role in amyotrophic lateral sclerosis (ALS) [1–6]. ALS is a motor neuron disorder characterized by progressive motor neuron atrophy as well as muscle deterioration, leading to premature death [1–6]. The crucial etiology of ALS still remains unknown; however, it has been determined that in many cases it is related to mutations in the gene encoding Cu/Zn superoxide dismutase (SOD1). Malfunctions in the SOD1 gene impairs cellular homeostasis of motor neurons, leading to the accumulation of Advanced Glycation End-products (AGE) in these cells [1–6]. We may speculate that during progression of ALS, AGEs trigger RAGE signaling pathway. Moreover, our earlier studies indicate that active RAGE-AGE pathway leads to neuroinflammation and thus neurodegeneration in ALS [7, 8]. However, the role of RAGE-AGE axis in progression of ALS is still not clear.

RAGE as an immunoglobulin receptor is a part of the innate immune system and may interact with proinflammatory ligands, such as: high mobility group box 1/amphoterin (HMGB1) and S calcium-binding protein B (S100B) and carboxymethyl-lysine-Advanced Glycation End-product (CML-AGE) [1–8]. Our previous studies revealed that RAGE and its proinflammatory ligands, such as: HMGB1, S100B as well as CML were elevated in the spinal cord of ALS mice and patients [3, 5, 6].

Furthermore, studies indicated that not only neuroinflammation proteins are observed during progression of ALS but also hyperactivation of glial cells were present in ALS patients and mice [1, 3, 8]. We observed elevated levels of astrocytes and microglia with a simultaneous disappearance of motor neurons in ALS spinal cord [1, 3, 8]. We explain that in ALS astrocytes may lose their physiological functions and release proinflammatory cytokines and chemokines and thus trigger motor neuron degeneration in the spinal cord [1, 3, 7, 9, 10]. Studies showed that hyperactive astrocytes were found in the ventral horn of ALS patients and mice [1, 9, 10]. Moreover, the results indicated that Glial Fibrillary Acidic Protein (GFAP) positive astrocytes revealed proinflammatory factors, such as: cytokines as well as RAGE proinflammatory ligands [1, 9, 10]. Elevated expression of proinflammatory proteins may trigger RAGE signaling pathway and thus motor neurons degeneration during progression of ALS [1–7].

Hence, the aim of the present study is to demonstrate the effect of RAGE signaling inhibition in SOD1 G93A transgenic mice. It is associated with decreased level of RAGE proinflammatory ligands as well as astrocyte markers in the lumbar spinal cord. We emphasize that RAGE plays a key role in ALS and may be a therapeutic target for neurodegenerative diseases.

Materials and methods

Animals

All procedures were performed according to the Local Ethical Committee of Experiments on Animals guidelines in Olsztyn, Poland (decision number 64/2018). Transgenic animals (B6.Cg-Tg(SOD1*G93A)1Gur/J) were purchased from The Jackson Laboratory (stock number 004435; Jackson Laboratories, Bar Harbor, ME, USA) and breed with RAGE knockout mice created by CRISPR-Cas9 method at the International Institute of Molecular and Cell Biology in Warsaw, Poland as described previously [6, 7]. The transgene copy number for SOD1 G93A and RAGE KO SOD1 G93A was examined as described (https://www.jax.org/strain/004435) [7]. To verify the knock-out of AGER (RAGE encoding gene), genotyping was performed using specific RAGE primers (Forward: TTGCTCTATGGGGTGAGACA, Reverse: GTAGACTCGGACTCGGTAG). Two RAGE products at 380 bp and 278 bp confirmed RAGE knock-out. Due to the estrogen protective effect, only male mice were used in the study. Male mice were housed in ventilated rooms under a 12:12 h light-dark period, lights on from 700 to 1900 h at 21°C in with free access to food (Labofeed B standard) and water [6]. Experimental time points were defined at 90 and 150 days of age corresponding to the initial and final signs of motor deficits, respectively [6] (Fig 1). Mice (controls, SOD1 G93A, RAGE KO SOD1 G93A) from two time point groups, i.e. 90 and 150, were sacrificed independently at each of these time points regardless of their health status. As described in Nowicka et al. [6], the final time points were determined by 20% weight loss, or the mice’s loss of self-righting ability (in mice SOD1 G93A). Mice were anesthetized with a mixture of ketamine (300 mg/kg) and xylazine (30 mg/kg) as described previously [3, 4, 6]. Next, mouse lumbar spinal cord tissue samples were frozen in liquid nitrogen and stored at −80°C for WB and RNA analysis as described previously in Nowicka et al. [6]. Samples for immunofluorescence staining were stored in appropriate buffers [3, 4].

Fig 1. Schematic diagram.

Fig 1

The diagram demonstrating subsequent stages of the experiment and showing the area of the spinal cord being examined; for the purpose of the study we examined lumbar motor spinal cord ventral horn lamina. The red line indicates the spinal cord. The figure is created by ourselves. Figure may be similar but not identical to the original image and is therefore for illustrative purposes only.

RNA and protein extraction

Total RNA (Wild type (WT, control) 90: n = 6; SOD1 90: n = 6; RAGE KO SOD1 90: n = 5)and protein (WT 90 and 150: n = 3; SOD1 90 and 150: n = 3; RAGE KO SOD1 90 and 150: n = 4) from the same lumbar spinal cord neuromere in each animal studied was isolated using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The quantity and quality of RNA was verified spectrophotometrically using Thermo ScientificTM NanoDrop TM 2000/2000c Spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA). The protein concentration was determined using Direct Detect® Infrared Spectrometer for Total Protein Quantitation (Merck Millipore, Darmstadt, Germany).

Reverse transcription and quantitative PCR

One microgram of RNA was transcribed into cDNA by The QuantiNova Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The obtained cDNA was used for quantitative PCR analysis (Table 1). The expressions of mRNA transcripts of genes encoding HMGB1, S100B [6], ras homolog family member J (RHOJ) [10] were investigated in duplicate by SYBR® Green PCR Master Mix (Qiagen, Hilden, Germany) and a LightCycler® 480 Instrument II (Roche Molecular Systems, Inc., Switzerland). The initial denaturation at 95°C for 10 min was followed by 40 cycles of denaturation at 95°C for 5 s, primer annealing at 62°C for 10 s, and elongation at 72°C for 10 second. All amplifications were followed by dissociation curve analysis of the amplified products. The relative expression of mRNAs was calculated by ΔΔCt method and normalized using the geometric mean of expression levels of housekeeping genes, i.e. importin 8 (IPO8) [6] and 18S ribosomal RNA (18S rRNA) [10, 11].

Table 1. Primers used for real-time PCR analysis.

Gene Symbol (Official) Primer Sequences Target Sequence Accession Number Amplicon Length
RHOJ F: 5′-TGTGTTTCTCATCTGCTTCTC -3′ NM_023275.2 128 nt
R:5′-GATCAATCTGGGTTCCGATG -3′
HMGB1 F: 5′-GAGAAGGATATTGCTGCCTAC-3′ U00431.1 160 nt
R: 5′-CTTCATCTTCGTCTTCCTCTTC-3′
S100B F: 5′-GTCAGAACTGAAGGAGCTTATC-3′ NM_009115.3 185 nt
R: 5′-CATGTTCAAAGAACTCATGGC-3′
IPO8 F: 5′-CTATGCTCTCGTTCAGTATGC-3′ NM_001081113.1 173 nt
R: 5′-GAGCCCACTTCTTACACTTC-3′
18S rRNA F: 5′-GGGAGCCTGAGAAACGGC -3′ NR_003278.3 68 nt
R: 5′-GGGTCGGGAGTGGGTAATTT -3′

Western blot analysis

Proteins (40μg, WT 90 and 150: n = 3; SOD1 90 and 150: n = 3; RAGE KO SOD1 90 and 150: n = 4) were separated on 15-well 4–15% Mini-PROTEAN® TGX™ Precast Protein Gels (Bio-Rad, Hercules, CA, USA) and transferred onto nitrocellulose membrane using semi-dry system (Trans-Blot Turbo Transfer System, Bio-Rad). Prior to antibody incubation the blotting membrane was blocked in EveryBlot Blocking Buffer (Bio-Rad) for 5 min at room temperature (RT). Primary antibody solutions were diluted in SignalBoost™ Immunoreaction Enhancer solution for primary antibodies (Merck Millipore, Darmstadt, Germany) and left for overnight incubation at 4°C. The list of all primary antibodies is presented in Table 2. After four washes in PBS with 0.1% Tween-20, the membrane was incubated for one hour at RT with the corresponding fluorescence-labeled secondary antibody diluted in SignalBoost™ Immunoreaction Enhancer solution for secondary antibodies (Merck Millipore, Darmstadt, Germany). The bands were visualized with ChemiDoc Imaging Systems (Bio-Rad Hercules, CA, USA). Images were quantified densitometrically with ImageJ Software 1.50i (Wayne Rasband, National Institutes of Health, Bethesda, MD, USA) and compared between and within each group—control versus experimental, after normalization to the total amount of protein loaded in the gel. Detailed description in Nowicka et al. [6].

Table 2. Antibodies used for Western Blot analysis and immunofluoresence staining.

Primary Antibodies
Antigen Code Species Working Dilution Supplier
NeuN ab177487 Rabbit 1:100 Abcam, Cambridge, UK
HMGB1 ab18256 1:1 000
S100b ab52642 1:1 000
CML ab27684 1:5 000
ACTB ab6276 1: 1 000
GFAP 173006 Chicken 1:500 Synaptic System
Secondary Antibody
Reagents Code Working Dilution Supplier
StarBright Blue 700 Goat Anti-Rabbit IgG 12004158 1:10 000 BioRad Hercules, CA, USA
StarBright Blue 700 Goat Anti-Rabbit IgG 12004162 1:10 000
IgG (H + L), Alexa Fluor Plus 594 A11039 1: 2 000 ThermoFisher
IgY (H + L), Alexa Fluor 488 A-32740
Fluoroshield™ with DAPI F6057-20ML 3–4 drops of mounting medium directly on top of the specimen Sigma-Aldrich, St. Louis, MO, USA

Immunofluorescence

The nine-micron sections of lumbar spinal cord tissues (n = 4 per groups) were subjected into routine immunofluorescence technique according to the method described previously by [12]. Sections were dried at room temperature (RT) for 45 min and blocked with a solution containing goat serum for 1 hour at room temperature. Afterwards, the sections were rinsed three times by PBS and incubated overnight at RT in humid chamber with combinations of appropriate antibodies against GFAP (glial fibrillary acidic protein) and NeuN (neuronal nuclei). The next day, the tissues were rinsed by PBS and incubated with species-specific secondary antibodies detailed in Table 2. Negative control confirmed antibody specificity (S1 Fig).

DAPI is a dye that can be used as a tool to visualize nuclear morphological changes. Slides with tissues were mounted with DAPI (4′,6-diamidino-2-phenylindole, Sigma-Aldrich, USA) to visualize nuclei of stained cells and subsequently, examined under fluorescent microscope. Cells with damaged nuclei stained with DAPI may show noticeable nuclear blebbing (fragmented nuclei) which may help differentiate morphological changes compared to cells without nuclear changes. Morphological changes were defined as the proportion of noticeable nuclear blebbing to normal nuclei in each group.

Immunostained tissues were photographed using a fluorescence microscope (Olympus IX83) and analyzed with NIH open source Image J software. Subsequently, the areas of immunofluorescent staining were measured in four similar regions (ROI) of interest for each tissue slice (ventral horn). Four technical replicates were used per each of four biological replicates within one studied group. From these values, the mean area of fluorescent signal, representing the amount of GFAP and NeuN proteins and thus positive cells in each group, was calculated as described in Zglejc-Waszak et al. [10].

Statistical analysis

All analyses were performed using GraphPad Prism (San Diego, CA, USA) as described previously [6, 10, 13]. Data are presented as means ± S.E.M. The normality and lognormality test (Shapiro-Wilk test) was performed before the statistical analysis. The mRNA expression of HMGB1, S100B and RHOJ was compared using Kruskal–Wallis one-way analysis of variance. The amount of proteins in WB as well as immunofluorescence were compared by one-way ANOVA with Tuckey’s post-hoc test or non-parametric equivalent, i.e. Kruskal–Wallis test. P ≤ 0.05 value was considered as statistical significance.

Results

Three groups of mice (wild type, SOD1 and RAGE KO SOD1, Fig 1) were compared in terms of coping with the disease. Mice from all groups were constantly monitored as described in Nowicka et al. [6].

Gene expression levels of HMGB1, S100B as well as RHOJ

At 90 day time point no significant changes were observed for HMGB1, S100B and RHOJ mRNAs (P > 0.05, Fig 2A–2C). However, the highest expression of HMGB1 as well as S100B mRNAs was observed in spinal cord harvested from SOD1 mice (Fig 2A) and the lowest expression of mentioned mRNAs was observed in RAGE KO mice (Fig 2A and 2B), indicating that the deletion of RAGE may reduce, without statistical significance (P > 0.05), the expression of major proinflammatory RAGE ligands in the spinal cord of SOD1 G93A mice. GTPAses may play a central role in motor neuron damage during ALS. The activation of GTPases is altered in the G93A mutant hSOD1 mouse model of ALS [14, 15]. Moreover, RHOJ as another GTPase may activate RAGE signalling pathway in neurodegenerative diseases. Nevertheless, GTPAses may interact also with cytoskeleton proteins and thus play role in polymerization of actin cytoskeleton in cells. RHOJ, as a member of Rho proteins, regulates the dynamic assembly of cytoskeletal components and thus may influence synaptic degeneration in ALS. However, the role of GTPAses as well as RHOJ in the regulation of motor neuron survival is unclear [14]. Hence, we investigated whether genetic deletion of RAGE in SOD1 G93A mice altered the expression of RHOJ mRNA in the lumbar spinal cord. We identified a reduction, without statistical significance (P > 0.05), in mRNA expression of RHOJ in spinal cord of SOD1 G93A mice when compared with mice RAGE KO SOD1 (Fig 2C).

Fig 2.

Fig 2

The relative expression of HMGB1 (A), S100B (B) and RHOJ (C) mRNAs in the lumbar spinal cord harvested from SOD1 transgenic mice with congenital, ALS RAGE knockout SOD1 transgenic mice with congenital ALS, and wild type mice at 90 days’ time points. Data are presented as means ± S.E.M. relative to the geometric mean of the expression level of IPO8 and 18SrRNA. Abbreviation: WT–wild type group, n = 6; SOD1 group, n = 6; RAGE KO SOD1, n = 5.

Immunoblot levels of HMGB1, S100B, CML as well as ACTB proteins in mouse lumbar spinal cord

We did not observe significant changes in expression of inflammatory proteins as well as in ACTB in our groups of animals at the terminal time point (P ≥ 0.05; Fig 3A–3D). Nevertheless, the highest amount of HMGB1 as well as ACTB was observed in spinal cord harvested from SOD1 G93A mice (Fig 3A and 3D).

Fig 3.

Fig 3

The relative amount of proteins: HMGB1 (A), S100B (B), CML (C), ACTB (D) in the lumbar spinal cord harvested from SOD1 transgenic mice with congenital ALS, RAGE knockout SOD1 transgenic mice with congenital ALS, and wild type mice at terminal time point quantified by western blot. Figure panels are indicated above the corresponding western blot set. Data are presented as means ± S.E.M. There are no statistical differences in relative amount of proteins. Abbreviation: WT–wild type group, n = 3; SOD1 transgenic mice with congenital ALS, n = 3; RAGE KO SOD1 –RAGE knockout SOD1 transgenic mice with congenital ALS, n = 4, at terminal endpoints.

Next, we investigated whether time point of experiment and RAGE deletion in SOD1 G93A mice altered the amount of HMGB1, S100B, CML as well as ACTB proteins in lumbar spinal cord (S1 Raw images). Our results showed alternations in proteins abundant in RAGE knockout SOD1 G93A mice over the duration of the disease/experiment (P ≤ 0.05; Fig 4A–4C). Proinflammatory ligands of RAGE as HMGB1 and S100B were significantly decreased in terminal group compared to 90 day time points (Fig 4A and 4B; P ≤ 0.001, P ≤ 0.05; respectively). However, we observed increasing trend of CML and decreasing trend of ACTB at the terminal point in RAGE knockout SOD1 G93A mice (Figs 3C and 4C). This suggests that while RAGE deficiency and duration of illness did not impact CML and ACTB levels, the amount of proinflammatory ligands, HMGB1 and S100B was reduced in affected SOD1 G93A spinal cord (Fig 4A–4C).

Fig 4.

Fig 4

The relative amount of proteins: HMGB1 (A), S100B(B), CML(C), ACTB (D) in the lumbar spinal cord harvested from SOD1 transgenic mice with congenital ALS, RAGE knockout SOD1 transgenic mice with congenital ALS, and wild type mice at 90 and terminal time points quantified by western blot. Figure panels are indicated above the corresponding western blot set. Data are presented as means ± S.E.M. Statistical differences in relative amount of protein respectively * 0.01 ≤ P ≤ 0.05; ** 0.001 ≤ P≤ 0.01. Abbreviation: RAGE KO SOD1 90 –RAGE knockout SOD1 transgenic mice with congenital ALS n = 4 at 90 time point, RAGE KO SOD1 T–RAGE knock out SOD1 transgenic mice with congenital ALS n = 4, at terminal endpoints.

Glia and neuronal immunostaining in mouse lumbar spinal cord

We examined the percentage of damaged nuclei, microglia and astrocyte accumulation in ventral horn of murine spinal cord. Numerous studies demonstrated motor neuron damage as well as elevated level of microglia and astrocytes in ALS lumbar spinal cord. We first studied whether the deletion of RAGE in SOD1 G93A mice affect the structure of neuronal nuclei in murine lumbar spinal cord. Results showed elevated level of nuclear pathological changes in SOD1 mice compare to wild type group (Fig 5A and 5B; P ≤ 0.05) however we did not see any changes in RAGE KO SOD1 group. Moreover, we did not find any differences in nuclear morphology between SOD1 G93A mice with genetic deletion of RAGE and control group (Fig 5A and 5B, P ≥ 0.05). Next, we investigated the level of GFAP (marker of astrocytes) in ventral horn of lumbar spinal cord at the terminal stage of the disease in all three groups of animals. Similar to nuclear damage, GFAP protein was also increased in SOD1 G93A mice when compared with RAGE KO SOD1 G93A and control mice (Fig 5A and 5C; P ≤ 0.0001; P ≤ 0.001). Surprisingly, the level of GFAP was decreased in RAGE KO SOD1 G93A compared to control mice (Fig 5A and 5C, P ≤ 0.001). Thus, the lowest level of astrocyte was observed in ventral horn of lumbar spinal cord harvested from RAGE KO SOD1 G93A mice. Contrary to the observed alternations in glial marker expression, the immunoreactive area of NeuN as a Neuronal Nuclear Antigen and Neuron Differentiation Marker, did not change between RAGE KO SOD1 G93A and SOD1 G93A mice (Fig 5A–5C, P ≥ 0.05). Moreover, we observed that NeuN is expressed in GFAP-positive cells of lumbar spinal cord (Fig 5A). Darlington et al. [15] compared widespread immunoreactivity for NeuN that would correspond to our observation. Our results showed that genetic deletion of RAGE reduces astrocyte accumulation in the spinal cord of SOD1 G93A mice (Fig 5A–5D).

Fig 5. Neuronal count and GFAP as well as NeuN expression in terminal-stage SOD1 transgenic mouse ventral horn of spinal cord.

Fig 5

A. DAPI positive nuclei (blue), GFAP protein showed (green), NeuN neurons showed (red). Co-localization (yellow staining) of GFAP-NeuN in mice spinal cord. Images were taken under 20× objective with 0.7 numerical aperture (20× /0.7). Scale bar  =  20 μm. For the purpose of the study we examined lumbar motor spinal cord ventral horn lamina. B. Effect of RAGE knockout on nuclear changes and assess apoptosis in ALS mice. Arrows indicated alternations in nuclei. C. Genetic deletion of RAGE effects on glial marker (GFAP protein, green colour) in the spinal cord of SOD1 mice. D. SOD1 mice lacking RAGE have the same level of NeuN in spinal cord (motor neurons–red). Statistical differences in relative amount of protein respectively * 0.01 ≤ P ≤ 0.05; ** 0.001 ≤ P≤ 0.01.

Discussion

Our studies indicated that inhibition/lack of RAGE signaling pathway in spinal cord of ALS mice exerts an anti-inflammatory effect. Moreover, genetic deletion of RAGE reduces astrocyte accumulation in the spinal cord of SOD1 G93A mice. This effect was associated with a reduction expression of proinflammatory RAGE ligands and less pronounced damage of nuclei in lumbar spinal cord of ALS mice.

It is well documented that RAGE signaling pathway is involved in ALS progression [1, 3, 5, 6]. Our previous studies revealed elevated level of RAGE in the lumbar spinal cord of SOD1 G93A mice [1, 3–6]. Moreover, we observed altered expression of HMGB1, S100B as well as CML in mice with ALS [1, 3–6]. Our current results support the prior hypothesis that inhibition/lack of RAGE signaling pathway in ALS mice exerts an anti-inflammatory effect (Fig 6).

Fig 6. Summary of the study.

Fig 6

Genetic deletion of RAGE reduces glial marker and major inflammatory proteins in the spinal cord of SOD1 G93A mice. The figure is created by ourselves. Figure may be similar but not identical to the original image and is therefore for illustrative purposes only.

We revealed that genetic deletion of RAGE may reduce expression of HMGB1 and S100B mRNAs in the lumbar spinal cord of SOD1 G93A mice at 90 days of disease. However, our previous studies indicated that the highest expression of HMGB1 mRNA in spinal cord harvested from mice at 60 days of disease [6]. Lee et al. [15] indicated that SOD1 G93A mice lacking RAGE have decreased spinal cord levels of HMGB1 and other key proinflammatory markers. Nevertheless, we observed the elevated level of S100B mRNA in spinal cord harvested from mice at 90 days of disease [6]. These data revealed that RAGE signaling pathway plays an inflammatory role in the SOD1 G93A mice. Proinflammatory RAGE ligands, such as HMGB1, S100B as well as CML, bind to RAGE and trigger production of inflammatory cytokines, leading to motor neuronal loss [1–6, 16]. However, further studies are necessary to explain the phenomenon that SOD1 G93A mice lacking RAGE have decreased spinal cord level of key inflammatory markers (Fig 6).Our studies revealed that the highest amount of HMGB1 protein was in SOD1 mice. Our data corroborate the premise that enhanced RAGE signaling plays a key role in neuronal inflamed and thus ALS progression [6]. Previous studies revealed the highest activity of RAGE signaling pathway at the terminal stage of ALS compared to control [6]. However, our previous studies revealed the highest amount of HMGB1 as well as S100B at the beginning of the study [6]. Therefore, we hypothesize that enhanced HMGB1 activity in SOD1 G93A mice and thus RAGE signaling pathway could drive neuroinflammatory responses that trigger motor neuron loss in spinal cord [17–20].

Schmidt research team [21, 22] found ten small molecules that inhibit ligand-stimulated RAGE signal transduction. Their studies revealed that interactions these small molecules with RAGE may decrease inflammation score during cardiac ischemia-reperfusion injury [21, 22]. Hence, we may hypothesize that genetic deletion of RAGE may attenuate inflammation in spinal cord harvested from SOD1 G93A mice and thus motor neuron destroyed in ALS SOD1 G93A mice. Lee et al. [18] revealed that therapeutic blockade of HMGB1 attenuates interaction with RAGE reduces early motor deficits, but not survival in SOD1 G93A mouse model of ALS. Thus, we may speculate that the attenuated activity of HMGB1 may be beneficial during the progression of ALS. We observed decreased amount HMGB1, S100B as well as CML (proinflammatory RAGE ligands) in spinal cord of RAGE KO SOD1 G93A mice [1, 3, 5–7, 15, 16, 23]. Moreover, the studies indicated that RAGE KO SOD1 G93A mice are characterized by extended survival time, improved motor performance and slowed disease progression [18]. Absence of RAGE reduces inflammation, improves the quality of life and extends survival in the SOD1 G93A mouse. Interestingly, the genetic deletion of RAGE during the duration of the disease resulted in a deepening of attenuated downregulation of RAGE signaling pathway components [15, 23]. Hence, it is possible that the deletion of RAGE could reduce inflammation and motor neuron damage. Alterations in the pattern of protein amount of proinflammatory RAGE ligands during ALS in RAGE KO SOD1 G93A mice may trigger regeneration of motor neurons in lumbar spinal cord [20]. However, further studies are needed to explain this phenomenon (Fig 6).

New studies have revealed that anti-ACTB antibody may be a new biomarker for progression of ALS and may mark the disease severity [24]. ACTB is the most important key component of the cytoskeleton of cells, including neuronal cells. Beta actin plays a crucial role in controls cell growth, movement as well as migration. Moreover, it controls formation of new synaptic connections as well as a new branch formation of neurons [25, 26]. Our data indicated that increased amount of ACTB was present in SOD1 G93A mice. Therefore, we may speculate that the amount of protein correlated with the progression of the disease, indicating that the formation of new synaptic connections as well as new branch formation of neurons were malfunctioning during the progression of the neurodegenerative disease [16, 25, 26]. Our data confirm that ACTB may be a new biomarker of ALS in patients and also in SOD1 G93A mice. However, mechanism of the elevated amount of ACTB in SOD1 G93A mice is unknow. We can speculate that during the progression of ALS when motor neurons are damaged, ACTB may be excessively released and also reconstructed resulting in the increased amount of this protein in spinal cord harvested from SOD1 G93A mice as well as in serum of patients with ALS [24–26]. Nevertheless, the question of the proportionality of ACTB levels in serum and spinal cord harvested from ALS mice in not straightforward. The serum/blood analysis may reflect certain alterations in gene expression and thus protein amount within the spinal cord [24–26]. However, further studies are necessary to clarify this phenomenon.

Further, our results showed that in ALS mice the percentage of damaged nuclei is higher than in control group. However, we did not observe alternations in nuclear number between RAGE KO SOD1 G93A mice and control animals. DNA damage is a mechanism of neurodegeneration in ALS and contributes to astrocyte toxicity [9, 27]. Although deletion of RAGE did not affect neuronal nuclear morphology in lumbar spinal cord, surprisingly, GFAP protein expression was altered. We observed decreased level of GFAP, astrocyte marker, in RAGE KO SOD1 G93A mice compared to SOD1 G93A and control mice. It is well documented that the increased level of GFAP accelerate astroglial activation and gliosis during neurodegeneration [9, 17, 28–34]. Lee and co-workers [7] indicated that astorcyte marker within lumbar spinal cord was not altered. Thus, we may speculate that during the progression of ALS different pathological mechanisms are active [20, 21, 27–29]. Our data showed the same level of NeuN in RAGE KO SOD1 G93A mice and control animals. Moreover, we did not find differences in the amount of neuronal marker between RAGE KO SOD1 G93A and SOD1 G93A mice. It is therefore likely that amelioration of spinal cord gliosis following the deletion of RAGE in ALS mice led to decreased motor neuron loss, subsequently reducing neurodegeneration [9, 21, 22, 32, 35, 36]. However, our thesis needs further experimental validation.

Further, studies demonstrated that GFAP-positive cells may also express NeuN [24]. Darlington and co-workers [24] revealed that NeuN positive cells might also present as astrocytes harvested from primary in vitro neuronal culture. We did not observe any double staining (GFAP/NeuN) in spinal cord harvested from RAGE KO SOD1 G93A and SOD1 G93A mice. Nevertheless, Zwirner et al. [25] observed GFAP positivity in neurons following traumatic brain injuries. However, the results of these studies are not clear. Darlington et al. [24] pointed to the possibility of artifacts or antibody cross-reaction during immunofluorescence staining. Further studies are required to confirm the global effect of neurodegenerative diseases on the double staining (GFAP/NeuN) of nervous tissues. We did not observe such a phenomenon in our studies.

We can speculate that the deletion of RAGE in ALS mice may inhibit progression of astroglia activation and gliosis during disease [32]. Moreover, we can hypothesize that the deletion of RAGE in ALS mice may inhibit progression of neurodegeneration and motor neuron damage (Fig 6) [7, 15, 23, 32, 37]. However, pathological mechanism of ALS is still not well known and poorly understood [1, 6, 21, 22, 35, 36, 26, 38–41].

Conclusions

Our data demonstrated that HMGB1, S100B, CML as well as ACTB are elevated in the spinal cord harvested from ALS mice. However, deletion of RAGE decreased the level of proinflammatory RAGE ligands in ALS spinal cord. Moreover, absence of RAGE decreased the level of GFAP in ALS spinal cord and thus inhibited nucleus malfunctions as well as loss of motor neurons. We confirmed pathological effect of RAGE signaling pathway in lumbar spinal cord of ALS mice. We observed alternations in molecular pattern of proinflammatory RAGE ligands expression/amount during progression of the disease in RAGE KO SOD1 G93A mice. Our research confirmed that the neglected protein, ACTB may be an important marker in the progression of ALS in SOD1 G93A mice. However, our results need further confirmations.

Supporting information

S1 Fig. Immunofluorescence staining–negative control.

No primary antibodies, only secondary antibodies were used (Table 2). Images were taken under 20× objective with 0.7 numerical aperture (20× /0.7). Scale bar  =  20 μm.

(TIF)

pone.0299567.s001.tif (10.4MB, tif)
S1 Raw images. Western blot raw data.

(PDF)

pone.0299567.s002.pdf (575.3KB, pdf)

Acknowledgments

Authors would like to thank Staff at the Department of Histology and Embryology, University of Warmia and Mazury in Olsztyn, for letting us use the laboratory space and equipment.

Data Availability

All relevant data are within the manuscript and its Supporting Information files as well as in the raw images.

Funding Statement

The work was financially supported by the National Science Centre (NCN), Poland (No. OPUS/2017/25/B/NZ4/00435). The publication fee was funded by the Minister of Science under “the Regional Initiative of Excellence Program”.

References

  • 1.Juranek J, Mukherjee K, Kordas B, Załęcki M, Korytko A, Zglejc-Waszak K, et al. Role of RAGE in the Pathogenesis of Neurological Disorders. Neurosci Bull. 2022. Oct;38(10):1248–1262. doi: 10.1007/s12264-022-00878-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ray R, Juranek JK, Rai V. RAGE axis in neuroinflammation, neurodegeneration and its emerging role in the pathogenesis of amyotrophic lateral sclerosis. Neurosci Biobehav Rev. 2016. Mar;62:48–55. doi: 10.1016/j.neubiorev.2015.12.006 [DOI] [PubMed] [Google Scholar]
  • 3.Juranek JK, Daffu GK, Wojtkiewicz J, Lacomis D, Kofler J, Schmidt AM. Receptor for Advanced Glycation End Products and its Inflammatory Ligands are Upregulated in Amyotrophic Lateral Sclerosis. Front Cell Neurosci. 2015. Dec 22;9:485. doi: 10.3389/fncel.2015.00485 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Juranek JK, Daffu GK, Geddis MS, Li H, Rosario R, Kaplan BJ, et al. Soluble RAGE Treatment Delays Progression of Amyotrophic Lateral Sclerosis in SOD1 Mice. Front Cell Neurosci. 2016. May 9;10:117. doi: 10.3389/fncel.2016.00117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Nowicka N, Juranek J, Juranek JK, Wojtkiewicz J. Risk Factors and Emerging Therapies in Amyotrophic Lateral Sclerosis. Int J Mol Sci. 2019. May 28;20(11):2616. doi: 10.3390/ijms20112616 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Nowicka N, Szymańska K, Juranek J, Zglejc-Waszak K, Korytko A, Załęcki M, et al. The Involvement of RAGE and Its Ligands during Progression of ALS in SOD1 G93A Transgenic Mice. Int J Mol Sci. 2022. Feb 16;23(4):2184. doi: 10.3390/ijms23042184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lee JD, McDonald TS, Fung JNT, Woodruff TM. Absence of Receptor for Advanced Glycation End Product (RAGE) Reduces Inflammation and Extends Survival in the hSOD1G93A Mouse Model of Amyotrophic Lateral Sclerosis. Mol Neurobiol. 2020. Oct;57(10):4143–4155. doi: 10.1007/s12035-020-02019-9 [DOI] [PubMed] [Google Scholar]
  • 8.Derk J, MacLean M, Juranek J, Schmidt AM. The Receptor for Advanced Glycation Endproducts (RAGE) and Mediation of Inflammatory Neurodegeneration. J Alzheimers Dis Parkinsonism. 2018;8(1):421. doi: 10.4172/2161-0460.1000421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.MacLean M, Juranek J, Cuddapah S, López-Díez R, Ruiz HH, Hu J, et al. Microglia RAGE exacerbates the progression of neurodegeneration within the SOD1G93A murine model of amyotrophic lateral sclerosis in a sex-dependent manner. J Neuroinflammation. 2021. Jun 15;18(1):139. doi: 10.1186/s12974-021-02191-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Zglejc-Waszak K, Mukherjee K, Korytko A, Lewczuk B, Pomianowski A, Wojtkiewicz J, et al. Novel insights into the nervous system affected by prolonged hyperglycemia. J Mol Med (Berl). 2023. Aug;101(8):1015–1028. doi: 10.1007/s00109-023-02347-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Espíndola S, Vilches-Flores A, Hernández-Echeagaray E. 3-Nitropropionic acid modifies neurotrophin mRNA expression in the mouse striatum: 18S-rRNA is a reliable control gene for studies of the striatum. Neurosci Bull. 2012. Oct;28(5):517–31. doi: 10.1007/s12264-012-1259-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Szymanska K, Gonkowski S. Bisphenol A-Induced changes in the enteric nervous system of the porcine duodenum. Neurotoxicology. 2018. May;66:78–86. doi: 10.1016/j.neuro.2018.03.008 [DOI] [PubMed] [Google Scholar]
  • 13.Janusonis S. Comparing two small samples with an unstable, treatment-independent baseline. J Neurosci Methods. 2009. May 15;179(2):173–8. doi: 10.1016/j.jneumeth.2009.01.017 [DOI] [PubMed] [Google Scholar]
  • 14.Stankiewicz TR, Pena C, Bouchard RJ, Linseman DA. Dysregulation of Rac or Rho elicits death of motor neurons and activation of these GTPases is altered in the G93A mutant hSOD1 mouse model of amyotrophic lateral sclerosis. Neurobiol Dis. 2020. Mar;136:104743. doi: 10.1016/j.nbd.2020.104743 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Darlington PJ, Goldman JS, Cui QL, Antel JP, Kennedy TE. Widespread immunoreactivity for neuronal nuclei in cultured human and rodent astrocytes. J Neurochem. 2008. Mar;104(5):1201–9. doi: 10.1111/j.1471-4159.2007.05043.x [DOI] [PubMed] [Google Scholar]
  • 16.Jaroslawska J, Korytko A, Zglejc-Waszak K, Antonowski T, Pomianowski AS, Wasowicz K, et al. Peripheral Neuropathy Presents Similar Symptoms and Pathological Changes in Both High-Fat Diet and Pharmacologically Induced Pre- and Diabetic Mouse Models. Life (Basel). 2021. Nov 19;11(11):1267. doi: 10.3390/life11111267 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.MacLean M, López-Díez R, Vasquez C, Gugger PF, Schmidt AM. Neuronal-glial communication perturbations in murine SOD1G93A spinal cord. Commun Biol. 2022. Feb 28;5(1):177. doi: 10.1038/s42003-022-03128-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lee JD, Liu N, Levin SC, Ottosson L, Andersson U, Harris HE, et al. Therapeutic blockade of HMGB1 reduces early motor deficits, but not survival in the SOD1G93A mouse model of amyotrophic lateral sclerosis. J Neuroinflammation. 2019. Feb 19;16(1):45. doi: 10.1186/s12974-019-1435-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lee JY, Lee JD, Phipps S, Noakes PG, Woodruff TM. Absence of toll-like receptor 4 (TLR4) extends survival in the hSOD1 G93A mouse model of amyotrophic lateral sclerosis. J Neuroinflammation. 2015. May 13;12:90. doi: 10.1186/s12974-015-0310-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Serrano A, Donno C, Giannetti S, Perić M, Andjus P, D’Ambrosi N, et al. The Astrocytic S100B Protein with Its Receptor RAGE Is Aberrantly Expressed in SOD1G93A Models, and Its Inhibition Decreases the Expression of Proinflammatory Genes. Mediators Inflamm. 2017;2017:1626204. doi: 10.1155/2017/1626204 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Manigrasso MB, Rabbani P, Egaña-Gorroño L, Quadri N, Frye L, Zhou B, et al. Small-molecule antagonism of the interaction of the RAGE cytoplasmic domain with DIAPH1 reduces diabetic complications in mice. Sci Transl Med. 2021. Nov 24;13(621):eabf7084. doi: 10.1126/scitranslmed.abf7084 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Manigrasso MB, Pan J, Rai V, Zhang J, Reverdatto S, Quadri N, et al. Small Molecule Inhibition of Ligand-Stimulated RAGE-DIAPH1 Signal Transduction. Sci Rep. 2016. Mar 3;6:22450. doi: 10.1038/srep22450 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Liu L, Killoy KM, Vargas MR, Yamamoto Y, Pehar M. Effects of RAGE inhibition on the progression of the disease in hSOD1G93A ALS mice. Pharmacol Res Perspect. 2020. Aug;8(4):e00636. doi: 10.1002/prp2.636 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Darlington PJ, Goldman JS, Cui QL, Antel JP, Kennedy TE. Widespread immunoreactivity for neuronal nuclei in cultured human and rodent astrocytes. J Neurochem. 2008. Mar;104(5):1201–1209. doi: 10.1111/j.1471-4159.2007.05043.x [DOI] [PubMed] [Google Scholar]
  • 25.Zwirner J, Lier J, Franke H, Hammer N, Matschke J, Trautz F, et al. GFAP positivity in neurons following traumatic brain injuries. Int J Legal Med. 2021. Nov;135(6):2323–2333. doi: 10.1007/s00414-021-02568-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sugimoto K, Mori M, Liu J, Shibuya K, Isose S, Koide M, et al. Novel serum autoantibodies against ß-actin (ACTB) in amyotrophic lateral sclerosis. Amyotroph Lateral Scler Frontotemporal Degener. 2021. Aug;22(5–6):388–394. doi: 10.1080/21678421.2021.1885448 [DOI] [PubMed] [Google Scholar]
  • 27.Kok JR, Palminha NM, Dos Santos Souza C, El-Khamisy SF, Ferraiuolo L. DNA damage as a mechanism of neurodegeneration in ALS and a contributor to astrocyte toxicity. Cell Mol Life Sci. 2021. Aug;78(15):5707–5729. doi: 10.1007/s00018-021-03872-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Brahmachari S, Fung YK, Pahan K. Induction of glial fibrillary acidic protein expression in astrocytes by nitric oxide. J Neurosci. 2006. May 3;26(18):4930–9. doi: 10.1523/JNEUROSCI.5480-05.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kruminis-Kaszkiel E, Juranek J, Maksymowicz W, Wojtkiewicz J. CRISPR/Cas9 Technology as an Emerging Tool for Targeting Amyotrophic Lateral Sclerosis (ALS). Int J Mol Sci. 2018. Mar 19;19(3):906. doi: 10.3390/ijms19030906 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lasiene J, Yamanaka K. Glial cells in amyotrophic lateral sclerosis. Neurol Res Int. 2011;2011:718987. doi: 10.1155/2011/718987 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lee J, Hyeon SJ, Im H, Ryu H, Kim Y, Ryu H. Astrocytes and Microglia as Non-cell Autonomous Players in the Pathogenesis of ALS. Exp Neurobiol. 2016. Oct;25(5):233–240. doi: 10.5607/en.2016.25.5.233 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Alexander GM, Erwin KL, Byers N, Deitch JS, Augelli BJ, Blankenhorn EP, et al. Effect of transgene copy number on survival in the G93A SOD1 transgenic mouse model of ALS. Brain Res Mol Brain Res. 2004. Nov 4;130(1–2):7–15. doi: 10.1016/j.molbrainres.2004.07.002 [DOI] [PubMed] [Google Scholar]
  • 33.Brites D, Vaz AR. Microglia centered pathogenesis in ALS: insights in cell interconnectivity. Front Cell Neurosci. 2014. May 22;8:117. doi: 10.3389/fncel.2014.00117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ransohoff RM, Perry VH. Microglial physiology: unique stimuli, specialized responses. Annu Rev Immunol. 2009;27:119–45. doi: 10.1146/annurev.immunol.021908.132528 [DOI] [PubMed] [Google Scholar]
  • 35.Kruminis-Kaszkiel E, Wojtkiewicz J, Maksymowicz W. Glial-restricted precursors as potential candidates for ALS cell-replacement therapy. Acta Neurobiol Exp (Wars). 2014;74(3):233–41. doi: 10.55782/ane-2014-1989 [DOI] [PubMed] [Google Scholar]
  • 36.Czarzasta J, Habich A, Siwek T, Czapliński A, Maksymowicz W, Wojtkiewicz J. Stem cells for ALS: An overview of possible therapeutic approaches. Int J Dev Neurosci. 2017. Apr;57:46–55. doi: 10.1016/j.ijdevneu.2017.01.003 [DOI] [PubMed] [Google Scholar]
  • 37.Zglejc-Waszak K, Schmidt AM, Juranek JK. The receptor for advanced glycation end products and its ligands’ expression in OVE26 diabetic sciatic nerve during the development of length-dependent neuropathy. Neuropathology. 2023. Feb;43(1):84–94. doi: 10.1111/neup.12852 [DOI] [PubMed] [Google Scholar]
  • 38.Bunnell TM, Burbach BJ, Shimizu Y, Ervasti JM. β-Actin specifically controls cell growth, migration, and the G-actin pool. Mol Biol Cell. 2011. Nov;22(21):4047–58. doi: 10.1091/mbc.E11-06-0582 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Moradi M, Sivadasan R, Saal L, Lüningschrör P, Dombert B, Rathod RJ, et al. Differential roles of α-, β-, and γ-actin in axon growth and collateral branch formation in motoneurons. J Cell Biol. 2017. Mar 6;216(3):793–814. doi: 10.1083/jcb.201604117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Tomiyama ALMR, Cartarozzi LP, de Oliveira Coser L, Chiarotto GB, Oliveira ALR. Neuroprotection by upregulation of the major histocompatibility complex class I (MHC I) in SOD1G93A mice. Front Cell Neurosci. 2023. Aug 30;17:1211486. doi: 10.3389/fncel.2023.1211486 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chiarotto GB, Cartarozzi LP, Perez M, Tomiyama ALMR, de Castro MV, Duarte ASS, et al. Delayed onset, immunomodulation, and lifespan improvement of SOD1G93A mice after intravenous injection of human mesenchymal stem cells derived from adipose tissue. Brain Res Bull. 2022. Aug 186;153–164. doi: 10.1016/j.brainresbull.2022.06.008 [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Belgin Sever

10 Jan 2024

PONE-D-23-34768Novel insights into RAGE signaling pathways during the progression of amyotrophic lateral sclerosis in RAGE-deficient SOD1 G93A micePLOS ONE

Dear Dr. Zglejc-Waszak,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Feb 24 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Belgin Sever, Ph.D.

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Note from Emily Chenette, Editor in Chief of PLOS ONE, and Iain Hrynaszkiewicz, Director of Open Research Solutions at PLOS: Did you know that depositing data in a repository is associated with up to a 25% citation advantage (https://doi.org/10.1371/journal.pone.0230416)? If you’ve not already done so, consider depositing your raw data in a repository to ensure your work is read, appreciated and cited by the largest possible audience. You’ll also earn an Accessible Data icon on your published paper if you deposit your data in any participating repository (https://plos.org/open-science/open-data/#accessible-data).

3. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.

4. Thank you for stating the following financial disclosure:

“This work was supported by the National Science Centre (NCN), Poland, grant No. 2017/25/B/NZ4/00435.”

Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

5. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“Authors would like to thank Staff at the Department of Histology and Embryology, University of Warmia and Mazury in Olsztyn, for letting us use the laboratory space and equipment. This work was supported by the National Science Centre (NCN), Poland (No. OPUS/2017/25/B/NZ4/00435).”

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“This work was supported by the National Science Centre (NCN), Poland, grant No. 2017/25/B/NZ4/00435.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

6. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

7. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

8. We note that Figures 1 and 6 in your submission contain copyrighted images. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

1. You may seek permission from the original copyright holder of Figures 1 and 8 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

2. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In the present manuscript, the authors have detailed the consequences of genetically deleting RAGE receptors in SOD1G93A mice. While the research concept is intriguing, certain matters warrant attention and resolution of the following which, once addressed these points, the manuscript should provide a more comprehensive and accurate representation of the research findings.

1) Methods Section:

- Experimental Groups and Sample Size: In the methods section, provide a detailed description of the experimental groups, including the number of mice in each group, the specific techniques employed, and the time points of assessment. Additionally, elaborate on the perfusion method used, specimen collection, and processing procedures.

- Quantification of Damaged Neuronal Nuclei: Define the criteria that characterize a damaged nucleus in the context of immunofluorescence analysis. Provide a detailed description of how this analysis was conducted, including the methods and tools used for quantification.

- Method Description for Quantification of NeuN and GFAP: In the manuscript, thoroughly describe the method used for the quantification of NeuN and GFAP in the immunofluorescence images of the spinal cord. Specify the tools and techniques employed for accurate quantification.

- NeuN Quantification; Motoneuron Counting: Elaborate on the method used to quantify NeuN and address the statement about no differences between RAGE-KO-SOD1 and SOD1 mice. Consider performing a detailed motoneuron counting to validate and support this result.

- Statistical Analysis: Statistical Analysis: Kindly elucidate the specific statistical tests and post-tests employed, along with the corresponding significance levels.

3) Results Section:

- Statistical Significance: Review and revise instances where the text suggests a correlation between increased marker levels and experimental conditions without statistically significant differences. Clearly present the statistical outcomes or reconsider the language to accurately reflect the results.

4) Additional Experiments or data:

- Microglial reaction: Include additional experiments assessing microglia reaction to the deletion of RAGE in the ALS model. Provide a comprehensive analysis to complement the findings related to NeuN and GFAP.

- Serum vs. Spinal Cord Levels of beta-Actin: Address the potential discrepancy between measuring beta-Actin levels in the serum (as cited) and the spinal cord. Discuss the proportionality of beta-Actin levels in these two contexts. Consider the feasibility of using anti-synaptophysin antibody for immunofluorescence to confirm synaptic loss.

- Numerous mice were used until reaching the terminal stage of the disease. Have the authors assessed and recorded the symptoms in these mice to identify the potential occurrence of delayed symptom onset? If so, please include such data.

6) GFAP-Positive Cells Expressing NeuN:

- Explanation: Offer a hypothesis or explanation for the observed phenomenon where GFAP-positive cells also express NeuN. Discuss potential biological implications and cite relevant literature if applicable.

7) HMGB1 Protein Activity:

Correction: Correct the statement regarding HMGB1 protein activity. Clarify that the study assessed the quantity of HMGB1 protein rather than its biological activity.

Reviewer #2: For western blot data (fig 3 and 4), recommend including a loading control for quantitative comparison of protein expression of interests, instead of normalizing based on the total protein loaded into the gel. your Western blots showed variations within the same group so better control should be used to compare protein expression levels between groups. without an adequate control, your conclusion would be weak and not fully convincing.

typo: in the abstract, there is a typo in the sentence: Moreover, inhibition of the molecular cross-talk between RAGE and its pro inflammatory ligand "my" abolish neuroinflammation.... Should be 'may'

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Luciana Politti Cartarozzi

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Mar 8;19(3):e0299567. doi: 10.1371/journal.pone.0299567.r002

Author response to Decision Letter 0


2 Feb 2024

Reviewers' comments:

Reviewer #1:

In the present manuscript, the authors have detailed the consequences of genetically deleting RAGE receptors in SOD1G93A mice. While the research concept is intriguing, certain matters warrant attention and resolution of the following which, once addressed these points, the manuscript should provide a more comprehensive and accurate representation of the research findings.

Response: We would like to thank you for the very thorough reading of our manuscript, below point-by-point response to your comments and suggestions.

Reviewer #1:

1) Methods Section:

- Experimental Groups and Sample Size: In the methods section, provide a detailed description of the experimental groups, including the number of mice in each group, the specific techniques employed, and the time points of assessment. Additionally, elaborate on the perfusion method used, specimen collection, and processing procedures.

Response: We apologize for not being very clear. It was our oversight. We have now restructured the text in the revised version of our manuscript as per the suggestion.

Lines: 77-87, 93-94, 114, 131.

Reviewer #1:

- Quantification of Damaged Neuronal Nuclei: Define the criteria that characterize a damaged nucleus in the context of immunofluorescence analysis. Provide a detailed description of how this analysis was conducted, including the methods and tools used for quantification.

Response: Thank you for this comment. We hope that the additional information about damaged nucleus in the context of immunofluorescence analysis (lines: 138-149), has improved our manuscript.

Reviewer #1:

- Method Description for Quantification of NeuN and GFAP: In the manuscript, thoroughly describe the method used for the quantification of NeuN and GFAP in the immunofluorescence images of the spinal cord. Specify the tools and techniques employed for accurate quantification.

Response: Immunostained tissues were photographed using a fluorescence microscope (Olympus IX83) and analyzed with NIH open source Image J software. Subsequently, the areas of immunofluorescent staining were measured in four similar regions (ROI) of interest for each tissue slice (ventral horn). Four technical replicates were used per each of four biological replicates within one group. From these values, the mean area of fluorescent signal, representing the amount of GFAP and NeuN proteins and thus positive cells in each group, was calculated.

We have now restructured the text in the revised version of our manuscript as per your suggestion. Lines: 144-149.

Reviewer #1:

- NeuN Quantification; Motoneuron Counting: Elaborate on the method used to quantify NeuN and address the statement about no differences between RAGE-KO-SOD1 and SOD1 mice. Consider performing a detailed motoneuron counting to validate and support this result.

Response: Thank you for this comment. The mean area of fluorescent signal, representing the amount of NeuN protein and thus NeuN-positive cells in each group, was calculated. We speculate that our data and hypothesis are real/true. MacLean, Juranek et al. (2021) performed quantification of overlap of NeuN+ RAGE+ area. They observed the tendency to elevated amount of NeuN (without statistical significance) in the spinal cord harvested from ALS patients with high AGER (gene encoding RAGE) compared to low AGER ALS patients. Previous results described in MacLean, Juranek et al. (2021) are similar to our present data. Hence, we assume that no differences between RAGE-KO-SOD1 and SOD1 mice are desired and proper in our studies. However, studies revealed the elevated level of NeuN/ChAT/DAPI-positive cells in the spinal cord harvested from ALS mice with AGER deletion of microglia (120th day of the disease, MacLean, et al. 2021). The slight discrepancy in the results may be due to the fact that in present MS we counted a single protein (only NeuN) and not several proteins simultaneously. Moreover, in the present studies SOD1 G93A mice were breed with RAGE knockout mice created by CRISPR-Cas9 method. We did not use tamoxifen as in MacLean et al. (2021). Additionally, we analyzed other time points (150th day of the disease) than MacLean et al. (2021). More likely, this discrepancy may be a result of the dynamic changes occurring in the spinal cord during progression of ALS. The negative control confirmed the specificity of the antibodies used during immunofluorescence staining (S1 Fig.). We are considering Cresyl Violet staining in future studies as described in the following papers (Chiarotto, Cartarozzi et al. 2019, Juranek et al. 2016). For the purposes of the review, we have performed additional analysis such as a quantification of NeuN and DAPI cells in the ALS spinal cord. Even though we followed the protocol used by MacLean et al (2021) for counting NeuN-positive cells, we did not obtain a higher amount of protein in the spinal cord harvested from ALS mice with RAGE deletion. Thus, subsequent analysis confirmed our results.

MacLean, M., Juranek, J., Cuddapah, S. et al. Microglia RAGE exacerbates the progression of neurodegeneration within the SOD1G93A murine model of amyotrophic lateral sclerosis in a sex-dependent manner. J Neuroinflammation 18, 139 (2021). https://doi.org/10.1186/s12974-021-02191-2

Juranek, J. K., Daffu, G. K., Geddis, M. S., Li, H., Rosario, R., Kaplan, B. J., Kelly, L., & Schmidt, A. M. (2016). Soluble RAGE Treatment Delays Progression of Amyotrophic Lateral Sclerosis in SOD1 Mice. Frontiers in cellular neuroscience, 10, 117. https://doi.org/10.3389/fncel.2016.00117

Chiarotto, G.B., Cartarozzi, L.P., Perez, M. et al. Tempol improves neuroinflammation and delays motor dysfunction in a mouse model (SOD1G93A) of ALS. J Neuroinflammation 16, 218 (2019). https://doi.org/10.1186/s12974-019-1598-x

Reviewer #1:

- Statistical Analysis: Kindly elucidate the specific statistical tests and post-tests employed, along with the corresponding significance levels.

Response: We apologize for the lack of clarity. It was an oversight on our part. We have now restructured the text in the revised version of our manuscript as per your suggestion. Lines: 152-156.

3) Reviewer #1:

Results Section:

- Statistical Significance: Review and revise instances where the text suggests a correlation between increased marker levels and experimental conditions without statistically significant differences. Clearly present the statistical outcomes or reconsider the language to accurately reflect the results.

Response: We apologize for the lack of clarity. This is very important information that should be included in our manuscript. We have now restructured the text in the revised version of our manuscript. As suggested, we have added information about statistical significance. Lines: 164-165, 173-174.

4)

Reviewer #1:

Additional Experiments or data:

- Microglial reaction: Include additional experiments assessing microglia reaction to the deletion of RAGE in the ALS model. Provide a comprehensive analysis to complement the findings related to NeuN and GFAP.

Response: We have been conducting research on ALS for several years. We were members of the team that conducted the following research: Microglia RAGE exacerbates the progression of neurodegeneration within the SOD1G93A murine model of amyotrophic lateral sclerosis in a sex-dependent manner (MacLean, M., Juranek, J., Cuddapah, S. et al. 2021). The results of these studies revealed that microglia display increased RAGE immunoreactivity in the spinal cords of high AGER (gene encoding RAGE) expressing patients and in the SOD1 G93A murine model of ALS vs. respective controls. We demonstrate that microglia AGER deletion at the age of symptomatic onset, day 90, in SOD1 G93A mice extends survival in male but not female mice. Critically, many of the pathways identified in human ALS patients that accompanied increased AGER expression were significantly ameliorated by microglia AGER deletion in male SOD1 G93A mice. Results indicate that microglia RAGE disrupts communications with cell types including astrocytes and neurons, intercellular communication pathways that divert microglia from a homeostatic to an inflammatory and tissue-injurious program. Microglia RAGE contributes to the progression of SOD1 G93A murine pathology in male mice and may be relevant in human disease.

We can speculate that the decreased amount of GFAP in the spinal cord harvested from ALS mice with RAGE gene deletion indicates that deletion/inhibition of RAGE may have therapeutic/beneficial effect in mice with ALS. MacLean, Juranek et al. (2021) revealed that male ALS mice bearing microglia AGER deficiency from the age of 3 months exhibited reduced gliosis, neuronal and motor function loss, and reduced dysfunctional transcriptomic signatures in lumbar spinal cord tissue. However, we should perform further studies to confirm our theory and results related to NeuN and GFAP proteins in the spinal cord of ALS mice with RAGE gene deletion.

In the future studies, we would like to focus on assessing microglia reaction to global deletion of RAGE in the ALS mice model. However, we have tried here to limit the scope of our MS to the abnormal RAGE mediated signaling in the ALS mouse model with the global deletion of RAGE, which help us formulate new hypothesis and scientific goals. We believe that our previous and current studies complement each other and provide a comprehensive landscape of the role of RAGE in the mouse model of ALS.

MacLean, M., Juranek, J., Cuddapah, S. et al. Microglia RAGE exacerbates the progression of neurodegeneration within the SOD1G93A murine model of amyotrophic lateral sclerosis in a sex-dependent manner. J Neuroinflammation 18, 139 (2021). https://doi.org/10.1186/s12974-021-02191-2

MacLean, M., López-Díez, R., Vasquez, C. et al. Neuronal–glial communication perturbations in murine SOD1G93A spinal cord. Commun Biol 5, 177 (2022). https://doi.org/10.1038/s42003-022-03128-y

Reviewer #1:

- Serum vs. Spinal Cord Levels of beta-Actin: Address the potential discrepancy between measuring beta-Actin levels in the serum (as cited) and the spinal cord. Discuss the proportionality of beta-Actin levels in these two contexts.

Response: Thank you for this comment. We agree with you that we should have discussed the proportionality of beta-Actin levels in the context of serum levels and the amount in the spinal cord. We have added a new information in Discussion section (lines: 299-303). Nevertheless, we have performed immunofluorescence (green color) and immunohistochemistry (brown color) staining of ACTB protein in spinal cord harvested from mice with ALS and control adult mice. Our studies confirmed expression of ACTB in spinal cord (ventral horn).

Moreover, cytoskeleton genes or proteins are neglected molecules in ALS studies. Kubinski and Claus (2022) revealed, that proteins involved in ALS are connected with actin cytoskeletal proteins, therein: ACTA1. We examined the expression of ACTA1 mRNA in mice model of ALS. We observed that in the spinal cord the expression of ACTA1 mRNA was increased in the terminal group of SOD1 mice compared to the control group (WT) (P=0.024). Our data showed that actin molecules, ACTA1, ACTB, may be putative targets in ALS diagnosis and therapy. In the future studies, we would like to focus on the actin cytoskeleton protein in the spinal cord harvested from ALS mice.

Kubinski S, Claus P. Protein Network Analysis Reveals a Functional Connectivity of Dysregulated Processes in ALS and SMA. Neurosci Insights. 2022;17:26331055221087740

Reviewer #1:

Consider the feasibility of using anti-synaptophysin antibody for immunofluorescence to confirm synaptic loss.

Response: The studies revealed that ALS is caused by the progressive degeneration of motor neurons in the spinal cord which causes a reduction in the number of motor neuron synapses (Tomiyama, Cartarozzi et al. 2023). Davis (2008) revealed decreased amount of synaptophysin (SYP) protein in spinal cord harvested from ALS model of mice compared to control group. However, Tomiyama, Cartarozzi et al. (2023) revealed that the amount of SYP in the lumbar ventral horn of ALS mice was maintained during IFNβ treatment. Hence, we can speculate that in RAGE KO SOD1 mouse the amount of SYP in the ventral horn of the spinal cord may be similar to that in the control group (WT).

Moreover, Davis (2008) revealed that the amount of VAChT was similar in ALS mice and control mice at the terminal stage of experiment. However, Davis (2008) in his thesis observed that width of VAChT-immunoreactive synapses of ALS mice were elevated than control group at terminal stage. For the purposes of the review, we have performed immunohistochemical analysis vesicular acetylcholine transporter (VAChT) protein in order to cholinergic synapse frequency.

We analyzed the amount of VAChT protein in the spinal cord harvested from mice in the terminal groups, i.e. WT and SOD1 (150 days of ALS). Based on the amount of protein, we can estimate the number of synapses in the spinal cord ventral horns during ALS. Immunohistochemistry revealed the amount of VAChT protein in spinal cord harvested from ALS model of mice was similar with control group of mice (WT). Moreover, our data and Davis (2008) results confirm synaptic VAChT-immunoreactive in terminal stage ALS mice. However, in future we plan to expand the studies and check the amount of VAChT as well as SYP proteins in spinal cord harvested from ALS mice with RAGE deletion. We will remember to perform these analyzes in the future studies.

Davis, K; (2008) Evidence of disease resistance in cholinergic synapses on spinal motor neurons in a mouse model of amyotrophic lateral sclerosis. Doctoral thesis , UCL (University College London) https://discovery.ucl.ac.uk/id/eprint/1568415

Tomiyama ALMR, Cartarozzi LP, de Oliveira Coser L, Chiarotto GB, Oliveira ALR. Neuroprotection by upregulation of the major histocompatibility complex class I (MHC I) in SOD1G93A mice. Front Cell Neurosci. 2023 Aug 30;17:1211486. doi: 10.3389/fncel.2023.1211486

Reviewer #1:

- Numerous mice were used until reaching the terminal stage of the disease. Have the authors assessed and recorded the symptoms in these mice to identify the potential occurrence of delayed symptom onset? If so, please include such data.

Response: The role of RAGE in the progression of ALS is well documented but still not fully understood. The presented publication is a continuation of our many years of research on the role of RAGE signaling in the mouse model of ALS (Nowicka et al. 2022, 2019, Juranek et al. 2022, 2016, 2015). As described in Nowicka et al. (2022) experimental and control animals were randomly divided into studied groups per defined time points: 90 and the terminal stage of the disease (about 150 days, primary endpoint, natural demise). All mice were carefully weighted starting from the eighth week of age. The weight was recorded three times per week. Mice from two time point groups, i.e. 90 and 150, were sacrificed independently at each of these time points regardless of their health status. The onset of the disease was determined when observed weight loss. RAGE KO SOD1 G93A mice and controls were sacrificed at the same time points as SOD1 G93A mice. Results from motor function test, i.e. results of hanging cage test are deposited in the earlier publication (Nowicka et al. 2022). Moreover, results from Kaplan–Meier curves showing survival probability of experimental terminal group as well as Life Quality, Mobility and Lifespan of Mice with Congenital ALS are described in (Nowicka et al. 2022). Lee and co-workers (2020) revealed that absence of RAGE increased survival as well as muscle strength in the SOD1 G93A mouse model of ALS. In the presented studies, we continued our previous assumptions and hypothesis, that RAGE signaling pathway plays a crucial role in progression of ALS in mice. The aim of the present study is to demonstrate the molecular effect of inhibiting RAGE signaling in SOD1 G93A transgenic mice. Therefore, in this study, we focused exclusively on RAGE signaling pathways and thus on the protein abundance. Please, respect our approach and research methods.

Reviewer #1:

6) GFAP-Positive Cells Expressing NeuN:

- Explanation: Offer a hypothesis or explanation for the observed phenomenon where GFAP-positive cells also express NeuN. Discuss potential biological implications and cite relevant literature if applicable.

Response: This is a very interesting question. The studies indicated that GFAP is one of the major intermediate filament proteins in mature astrocytes. NeuN is a widely expressed labels in nuclei of mature neurons. However, we fully agree with your hypothesis that GFAP-positive cells of spinal cord may also express NeuN. Darlington et al. (2008) revealed that NeuN is expressed not only in motor neuron nuclei but also in primary astrocytes from mouse, rat and human brain. Moreover, Darlington et al (2008) indicated that NeuN may label the nuclei of astrocytes cultured in vitro from human fetus, human adult, newborn rat, and embryonic mouse brain. Unlike these findings in vitro, but consistent with previous studies in vivo, astrocytes in sections of postnatal day 10 rat brain did not express NeuN (Darlington et al 2008). However, we did not find any information about double staining (GFAP/NeuN) of the spinal cord harvested from adult mice (Tomiyama, Cartarozzi et al. 2023). Therefore, we assume that we do not observe positive double staining (GFAP/NeuN) of the spinal cord in adult mice. In summary, we hypothesize/assume that the NeuN antibody selectively stains mice neurons in vivo, i.e. in a tissue section. However, the label of NeuN in in vitro experiments is more widespread that the specification states. When staining cells from in vitro cultures, we should remember about the possibility of double staining (GFAP/NeuN) of astrocytes (Darlington et al 2008).

With this in mind, experiments with staining neuronal cells harvested from in vitro primary neuronal cultures should be additionally stained with another neuronal marker such as MAP2.

However, we assume that positive double staining (GFAP/NeuN) of the spinal cord in adult mice may take place during traumatic spinal cord injury. The similar phenomenon takes place during traumatic brain injury in Alzheimer patients (Zwirner et al. 2021). However, further studies revealed that this phenomenon may be an artefact or potential neuronal immunopositivity for GFAP either cross-reactivity of antibodies. Further studies are necessary to confirm the double staining theory (GFAP/NeuN) as a consequence of traumatic spinal cord/brain injury or even peripheral injury (Victório, Cartarozzi et al. 2012). We decided to add information about this phenomenon in the discussion section. Lines: 318-325.

Darlington, P. J., Goldman, J. S., Cui, Q. L., Antel, J. P., & Kennedy, T. E. (2008). Widespread immunoreactivity for neuronal nuclei in cultured human and rodent astrocytes. Journal of neurochemistry, 104(5), 1201–1209. https://doi.org/10.1111/j.1471-4159.2007.05043.x

Tomiyama ALMR, Cartarozzi LP, de Oliveira Coser L, Chiarotto GB, Oliveira ALR. Neuroprotection by upregulation of the major histocompatibility complex class I (MHC I) in SOD1G93A mice. Front Cell Neurosci. 2023 Aug 30;17:1211486. doi: 10.3389/fncel.2023.1211486

Zwirner, Johann et al. “GFAP positivity in neurons following traumatic brain injuries.” International journal of legal medicine vol. 135,6 (2021): 2323-2333. doi:10.1007/s00414-021-02568-1

Victório SC, Cartarozzi LP, Hell RC, Oliveira AL. Decreased MHC I expression in IFN γ mutant mice alters synaptic elimination in the spinal cord after peripheral injury. J Neuroinflammation. 2012 May 7;9:88. doi: 10.1186/1742-2094-9-88

Reviewer #1:

7) HMGB1 Protein Activity: Correction: Correct the statement regarding HMGB1 protein activity. Clarify that the study assessed the quantity of HMGB1 protein rather than its biological activity.

Response: We apologize for not being very clear. We have now restructured the text in the revised version of our manuscript as per your suggestion.

Reviewer #2: 1. For western blot data (fig 3 and 4), recommend including a loading control for quantitative comparison of protein expression of interests, instead of normalizing based on the total protein loaded into the gel. your Western blots showed variations within the same group so better control should be used to compare protein expression levels between groups. without an adequate control, your conclusion would be weak and not fully convincing.

Response: We thank you for noting that our manuscript has generated new and potentially important information about the mouse model of ALS. We appreciate the investment of time such careful reviews take. Please find our point-by-point response below.

Western blot (WB) is an excellent molecular technique for determining protein expression. In our previous papers (Zglejc-Waszak et al. 2023, Nowicka et al. 2022, Jaroslawska et al. 2021), we used total protein analysis as a reliable loading control for quantitative fluorescent Western blotting. We choose this method of analysis because we study protein expression during neurodegenerative diseases. To our knowledge, common controls, including β-actin, GAPDH and tubulin, are differentially expressed in tissues from a wide range of animal models of neurodegeneration (Aldridge et al. 2008, Eaton et al. 2013). We demonstrated variable expression of β-actin in the spinal cord harvested from mice from the study groups (Fig. 3 and Fig. 4). Moreover, Eaton et al. (2013) revealed that expression of these “control” proteins was not consistent between different portions of the same tissue, highlighting the importance of careful and consistent tissue sampling for WB experiments. Therefore, normalizing WB data to control for a protein such as β-actin in such circumstances may result in ‘skewing’ of all data in ALS research. Consequently, we propose it would be prudent to use total protein analysis to save time, resources, increase sensitivity and accuracy as well as the working range of protein load for quantitative Western blotting. In our opinion, total protein analysis should be considered as an alternative reference standard for data normalization in modern quantitative fluorescent Western blotting, particularly during neurodegenerative studies where control expression may be variable (https://www.bio-rad.com/en-pl/applications-technologies/total-protein-normalization?ID=PODYJQRT8IG9). Stain-Free Western Blotting does not require the housekeeping gene because all calculations were performed automatically by the software including the Normalization Factor and Normalized Volume. The target protein band intensity values were adjusted for variation in the protein load. This method allowed for accurate comparison of target proteins among the samples (https://www.bio-rad.com/webroot/web/pdf/lsr/literature/Bulletin_6390.pdf). Please, respect our approach and research methods. In our opinion, choosing total protein analysis as a reliable loading control for quantitative fluorescent Western blotting is the best choice.

Aldridge GM, Podrebarac DM, Greenough WT, Weiler IJ. The use of total protein stains as loading controls: an alternative to high-abundance single-protein controls in semi-quantitative immunoblotting. J Neurosci Methods. 2008;172(2):250-254. doi:10.1016/j.jneumeth.2008.05.003

Eaton SL, Roche SL, Llavero Hurtado M, et al. Total protein analysis as a reliable loading control for quantitative fluorescent Western blotting. PLoS One. 2013;8(8):e72457. Published 2013 Aug 30. doi:10.1371/journal.pone.0072457

Jaroslawska J, Korytko A, Zglejc-Waszak K, et al. Peripheral Neuropathy Presents Similar Symptoms and Pathological Changes in Both High-Fat Diet and Pharmacologically Induced Pre- and Diabetic Mouse Models. Life (Basel). 2021;11(11):1267. Published 2021 Nov 19. doi:10.3390/life11111267

Nowicka N, Szymańska K, Juranek J, et al. The Involvement of RAGE and Its Ligands during Progression of ALS in SOD1 G93A Transgenic Mice. Int J Mol Sci. 2022;23(4):2184. Published 2022 Feb 16. doi:10.3390/ijms23042184

Zglejc-Waszak K, Mukherjee K, Korytko A, et al. Novel insights into the nervous system affected by prolonged hyperglycemia. J Mol Med (Berl). 2023;101(8):1015-1028. doi:10.1007/s00109-023-02347- y

Reviewer #2: 2. typo: in the abstract, there is a typo in the sentence: Moreover, inhibition of the molecular cross-talk between RAGE and its pro inflammatory ligand "my" abolish neuroinflammation.... Should be 'may'

Response: Thank you for this comment. We have corrected our typing mistake.

Attachment

Submitted filename: Response to Reviewers.doc

pone.0299567.s003.doc (5.7MB, doc)

Decision Letter 1

Belgin Sever

13 Feb 2024

Novel insights into RAGE signaling pathways during the progression of amyotrophic lateral sclerosis in RAGE-deficient SOD1 G93A mice

PONE-D-23-34768R1

Dear Dr. Zglejc-Waszak,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Belgin Sever, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Belgin Sever

29 Feb 2024

PONE-D-23-34768R1

PLOS ONE

Dear Dr. Zglejc-Waszak,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Assoc. Prof. Dr. Belgin Sever

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Immunofluorescence staining–negative control.

    No primary antibodies, only secondary antibodies were used (Table 2). Images were taken under 20× objective with 0.7 numerical aperture (20× /0.7). Scale bar  =  20 μm.

    (TIF)

    pone.0299567.s001.tif (10.4MB, tif)
    S1 Raw images. Western blot raw data.

    (PDF)

    pone.0299567.s002.pdf (575.3KB, pdf)
    Attachment

    Submitted filename: Response to Reviewers.doc

    pone.0299567.s003.doc (5.7MB, doc)

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files as well as in the raw images.


    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES