Biochemical Assessment of the Mutant Sliding β-Clamp on Stimulation of Endonuclease IV from Staphylococcus aureus

Abstract

Staphylococcus aureus is a pathogenic bacterium that causes various infections in humans. The emergence of methicillin-resistant Staphylococcus aureus makes treatment more challenging. Recent research has shown that bacterial β-clamp is not only a processivity factor but can also stimulate the activity of other enzymes of DNA metabolism. This article examines the interaction between apurinic/apyrimidinic (AP) endonuclease IV (Nfo) and β-clamp from Staphylococcus aureus, which has not been previously researched. Recombinant DNA repair enzymes, beta-clamp, were cloned, expressed, and purified. Biochemical methods were employed to assess the stimulation of beta-clamp-activated AP endonuclease activity of Nfo. We demonstrated that mutations in the C-terminal conserved region led to disruption of stimulation of Nfo AP endonuclease activity. The study provides evidence of a specific interaction between Nfo and β-clamp, which suggests that β-clamp may play a more direct role in DNA repair processes than previously thought. These findings have important implications for understanding the mechanism of DNA repair, particularly in relation to the role of β-clamp. Understanding the underlying mechanisms of interaction between DNA metabolism enzymes can aid in predicting new drug targets for antibiotic resistance battle.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12088-023-01148-8.

Introduction

Staphylococcus aureus (S. aureus) is a bacterial pathogen that causes a wide range of clinical manifestations, including pneumonia, bacteremia, endocarditis, osteomyelitis, and toxic shock syndrome [1]. Infections caused by this pathogen are prevalent both in the community and in hospitals, and treatment remains a complex challenge due to the emergence of strains with multiple drug resistance, such as Methicillin-Resistant S. aureus (MRSA) [2]. S. aureus is present in the environment, as well as on the skin and mucous membranes, most commonly in the nasal area, of the majority of healthy individuals. However, when these bacteria enter the bloodstream or internal tissues, they can cause serious infections [1]. During the pathogenesis of S. aureus, the bacterium is exposed to negative effects of reactive oxygen species (ROS) generated by the “oxidative burst” Genotoxic shock induces the emergence of new mutations, which are repaired by DNA repair enzymes. Various DNA repair enzymes homologous to the mismatch repair system have been identified in S. aureus, but much of the enzymes and their roles in mutagenesis and pathogenesis remain unknown [3].

DNA clamp is a processivity factor of DNA polymerases and is essential for efficient DNA replication. It has been shown that β-clamp increases the processivity and synthesis rate of DNA polymerases 5000- and 100-fold, respectively [4].

The DNA clamp binding motif is a pattern of amino acids found in proteins that interact with DNA clamps. DNA clamps are ring-shaped proteins that encircle DNA and facilitate the binding of other proteins involved in DNA replication, DNA repair, and transcription. The DNA clamp binding motif is critical for specific interactions between these proteins and the DNA clamp, allowing them to carry out their functions efficiently.

According to bioinformatics analysis, a conserved pentapeptide sequence QL(S/D)LF was proposed as a site for the interaction of a number of proteins with the β-subunit of the holoenzyme of Escherichia coli (E. coli) DNA polymerase III [5]. Interestingly, the structure of the bacterial β-clamp is similar to eukaryotic proliferating cell nuclear antigen (PCNA), although no homology was found in the primary sequence [6]. PCNA interacts through PCNA-binding motif (PIP box, PCNA-interacting peptide) with more than 200 proteins during DNA replication, DNA repair, and cell-cycle regulation [7, 8]. This motif is represented by the sequence similar in bacteria: Qxx(I/L/M)xxF(F/Y). However, later it was demonstrated that bacterial β-clamp can also stimulate the activity of other enzymes of DNA metabolism.

López de Saro et al. [9] described the interaction of β-clamp with enzymes of DNA repair (MutS) and recombination (DNA ligase). O’Donnell reported that β-clamps from E. coli and S. aureus stimulated the activity of PolC DNA polymerase from S. aureus, increasing the processivity and rate of DNA synthesis from 80–120 nt/sec to 240–580 nt/sec. The researchers concluded that β-clamp is not just a processivity factor, but β-clamp also increases the rate of nucleotide incorporation during DNA synthesis [10]. Khanam et al. [11] reported that the β-clamp stimulated AP endonuclease XthA from Mycobacterium tuberculosis (MtbXthA). Patoli et al. determined that UmuC (the subunit of DNA polymerase V from E. coli) interacts with β-clamp via the clamp binding motif (CBM)—357QLNLF361. It was found that in E. coli CBM is located inside the protein, not at the C-terminus of DNA polymerase V [12]. Dohrmann et al. found out that mutations at the internal site (QADMF) of DNA polymerase III subunit alpha completely disrupted binding to β-clamp. Moreover, the site changing to the conserved QLDLF sequence led to > 100-fold increase in binding to β-clamp [13].

There is no information on the interaction between AP endonuclease Nfo (SaNfo) and β-clamp in S. aureus. Based on previous research, we were interested to find out if β-clamp stimulates activity of AP endonuclease SaNfo. Previously, we have demonstrated the interaction between the β-clamp and the AP endonuclease SaNfo in S. aureus [14]. From our experiments, we observed different patterns of interaction between SaNfo and β-clamp on duplex oligonucleotides containing various substrates such as tetrahydrofuran (THF) and α-2′-deoxyadenosine (αdA). We demonstrated that β-clamp stimulates SaNfo AP site cleavage activity by several folds.

Conserved sequences in partner proteins, in turn, interact with the β-clamp. The β-clamp protomer is composed of three domains and dimerizes head-to-tail to produce two structurally distinct faces that form a closed ring [15]. The N-termini of both monomers are located on one face of the ring, known as the N-terminal face, whereas the C-termini of both monomers are situated on the opposite face, referred to as the C-terminal face. These two faces exhibit asymmetry, with the C-terminal face containing more loops that extend away from the ring structure (Fig. 1) [16].

Fig. 1.

Schematic representation of the domain organization of the S. aureus β-clamp structure (RCSB: 7EVP). The N-terminal face and C-terminal face are shown

Across all clamps that have been identified, this face, commonly known as the “C-terminal face,” is responsible for interacting with other proteins [17].

In this study, our primary aim was to investigate the functional significance of specific amino acid residues, specifically the sequence 373PIR375, within the C-terminal region of the β-clamp in S. aureus. We hypothesized that mutations in this region could potentially disrupt the stimulation of AP endonuclease Nfo, a crucial enzyme involved in DNA repair.

Materials and Methods

Bacterial Strains, Plasmids, and Reagents

Amplification of genes was performed using genomic DNA from S. aureus ATCC 29213. E.coli strains DH5α (Thermo Fisher Scientific, UK) and BH110 (DE3) from the laboratory stock were used in this research. pET11a(+) and pET-28c(+) (Novagen, UK) plasmids were used for construction of expression vectors. Restriction enzymes, T4 DNA ligase, and Phusion High-Fidelity DNA Polymerase (Thermo Scientific, USA) were employed for the amplification and cloning of the target gene. All the oligodeoxyribonucleotides containing modified residues and their complementary oligonucleotides were purchased from Eurogentec (Seraing, Belgium) (Table 1).

Table 1.

Site-directed mutagenesis oligonucleotides

#	Oligonucleotide name	Sequence (5′ → 3′)
1	SaBC-Fw-PIR-373–375-ADA	TTTAGCAGACGCAACTTACTAAGGATCCGAATTCGAGC
2	SaBC-Rv-P373A/I374D/R375A	AGTTGCGTCTGCTAAAATTAATTGCGTTACCGAGTCGTCAC

Oligonucleotides

The following primers were used for site-directed mutagenesis:

The following oligonuleotides (Eurogentec, Belgium) were used to determine the substrate specificity of the AP endonucleases: 22mer THF•T d(CACTTCGGAXTGTGACTGATCC), where X—tetrahydrofuran (THF, synthetic analogue of the AP site) and complementary 22mer oligonucleotide containing 2′-deoxythymidine (dT) opposite to damage. Oligonucleotide containing tetrahydrofuran was labelled with tetramethylrodamine (TAMRA) from the 5′-end. The labeled oligonucleotides were annealed to complementary oligonucleotides in a buffer consisting of 50 mM KCl and 20 mM HEPES–KOH (pH 7.5) at + 65 °C for 5 min and cooled down to room temperature for 1 h. The sequence, schematic representation of the DNA substrates and chemical structures of DNA adducts used in this research are presented in Supplementary 1.

Cloning, Expression and Purification of Recombinant Proteins

SaNfo was expressed E. coli by BH110(DE3) cells containing pET11a-SaNfo construct as described in [14]. SaDnaN and HpXth recombinant proteins were expressed by E. coli Rosetta 2 (DE3)/pET-28c(+) cells and purified by IMAC in a 20–500 mM imidazole gradient as described in [14] and [18] respectively.

PIR-373–375-ADA mutant of β-clamp was obtained via site-directed mutagenesis using SaBC-Rv-P373A/I374D/R375A and SaBC-Fw-PIR-373–375-ADA primers on pET-28c(+)/SaDnaN construct. Purification of protein was performed as previously described [19]. Target proteins were purified by immobilized metal affinity chromatography (IMAC). The identity of the recombinant protein was confirmed using reversed-phase C18 liquid chromatography-tandem mass spectrometry (LC–MS/MS) analysis, as previously described [20].

DNA Repair Assays

To detect AP endonuclease activity of AP endonuclease, 20 nM 5′-[TAMRA]-labelled THF•T duplex oligonucleotide was incubated with different concentrations of DNA repair enzyme in buffer for SaNfo (50 mM KCl, 10 mM Hepes–KOH pH 7.5, 0.1 mg/ml BSA, 0.01% NP-40, 5 mM MgCl₂, 1 mM DTT, 5 mM EDTA), for HpXth (50 mM Tris–HCl pH 8.0, 0.01% NP-40, 25 mM KCl, 5 mM MgCl₂, 0.1 mg/ml BSA, 0.05 mM DTT) at + 37 °C for 30 min [14, 18].

Reactions were stopped by 10 µL of stop buffer (0.5% SDS, 20 mM EDTA), reaction mixture were desalted by homemade spin-down columns filled with Sephadex G25 (GE Healthcare) equilibrated in 7.5 M urea. Next, the reaction products were separated in a denaturing 20% (w/v) polyacrylamide gel (7.5 M urea, 0.5 × TBE). The gels were scanned with Molecular Imager® PharosFX™ Systems and analyzed in the Image Gauge v.4.0 software.

Statistical Analysis and Model Building

Statistical analysis was performed using a GraphPad Prism version 8.0. software (GraphPad Software Inc., San Diego, CA, USA). The structures were visualized with PyMol (Schrödinger, New York, NY).

Results and Discussion

Structural Alignment of Sliding Clamps Between Taxonomy Domains

The presence of the sliding clamp is ubiquitous across the taxonomic classification. Considering that interactions between the DNA clamp and protein partners have been elucidated in a variety of organisms, including eukaryotes, bacteria, and archaea, it is imperative to emphasize the significance of structural alignments showcasing the conservation of clamp architecture and its functional relevance across diverse domains of life. Interestingly, all three domains of life and viruses share a strikingly similar clamp architecture, consisting of six domains arranged in a dimeric form for β-clamp (bacteria) or trimeric form for Eukaryota, Archaea and Virus (PCNA, gp45) (Fig. 2).

Fig. 2.

Examples of sliding clamps in bacteria (S. aureus, RCSB: 7EVP), archaea (Thermococcus kodakaraensis, RCSB: 3LX2), eukaryotes (Homo sapiens, RCSB: 6FCM), and viruses (bacteriophage T4, RCSB: 1CZD). The figure shows that sliding clamps are present across all three taxonomic domains and viruses, and exhibit remarkably similar clamp architecture, comprising six domains arranged in either a dimer (in the case of bacteria, indicated by red and green colors) or trimer formation (in all other cases)

Moreover, the interaction between proteins and the clamp occurs at the same positions between domains of the clamps, providing further evidence that the underlying mechanism by which proteins bind to sliding clamps is conserved across diverse domains of life [21].

Functional Significance of the Beta Clamp’s C-Terminal Region

PCNA harbors two distinct sites facilitating interactions with partner proteins. The first site is situated within the interdomain connecting loop positioned between two subunits, while the second site for interaction is localized in the C-terminal region of the subunit. Notably, studies involving mutants of sliding clamps in the C-terminal region have demonstrated a disruption in the binding affinity with partner proteins. The interface between the clamp and interacting proteins primarily involves a hydrophobic pocket within the gp45 clamp of the T4 bacteriophage. Similarly, in the case of human PCNA, the C-terminal peptide of the cell regulator p21WAF1 is anchored through a hydrophobic pocket, as evidenced by the cocrystal structure. Also the p21 peptide establishes interaction with the C-terminus of human PCNA [22]. In the context of specific organisms, studies in Schizosaccharomyces pombe revealed that stimulation of polymerases Polδ and Polɛ with a mutant PCNA (P252A) was significantly reduced [23]. Likewise, in Saccharomyces cerevisiae, the C-terminal region of the PCNA protein, particularly the P252 and K253 residues, exhibited a notable decrease in stimulating the 3′ → 5′ exonuclease activity of the Apn2 protein [24]. The presence of P252A and K253A mutations in the PCNA protein (Saccharomyces cerevisiae), located near the C-terminus, is crucial for establishing a functional interaction with both DNA Polymerase δ (delta) and DNA Polymerase ε (epsilon) [25]. In addition to side chain interactions, a brief stretch of antiparallel beta-sheet is formed between the peptide backbones of Arg345–Leu347 from Pol IV and Pro363–Arg365 from the β-clamp [26]. In addition, it's noted that the RFCL peptide, containing a PIP-box sequence KQATLFDFLKK, is located on the front face, which includes the C-terminal tail of the PCNA protein (Pyrococcus furiosus) [27]. Therefore, based on the structure of PCNA with the PIP peptide (PDB: 1ISQ) available in the database, we performed the structural alignment between Staphylococcus aureus β-clamp and P. furiosus PCNA aimed at comparing their structural similarity and differences, and identifying corresponding sites within staphylococcal clamp. Remarkably, this alignment revealed a substantial level of structural conservation in the overall fold and domain architecture of both proteins, despite their significant sequence divergence (Fig. 3).

Fig. 3.

Structural alignment between the subunit of P. furiosus PCNA (RCSB: 1ISQ) and S. aureus β-clamp (RCSB: 7EVP). The magenta arrow indicates the PIP box-containing peptide that interacts with the C-terminal region (yellow color, residues 245PRV247) of P. furiosus PCNA. The blue color represents the sequence 373PIR375 of the C-terminal region of S. aureus β-clamp

As can be seen from the Fig. 3, the structural alignment underscores the conserved features and functional importance of sliding clamps. Notably, the alignment reveals a clear correspondence between the PIP peptide (depicted in magenta) and the clamp sequence—245PRV247 (highlighted in yellow).

Interestingly, our analysis identified that P. furiosus PCNA possesses a tail with a C-face characterized by the sequence 245PRV247, displaying a notable correspondence with the C-terminal region of S. aureus β-clamp, specifically 373PIR375 (blue). Thus, the beta-clamp’s potential site of interaction with the CBM motif in S. aureus is 373PIR375 sequence.

Structural Alignment of β-Clamp from M. tuberculosis and S. aureus

To further confirm the found potential site of interaction with the CBM motif in S. aureus, we also performed a structural alignment with the existing beta-clamp structure in M. tuberculosis. Khanam et al. discovered the interaction between the AP endonuclease XthA and the beta-clamp from M. tuberculosis. Specifically, they identified the sequence of the CBM motif responsible for binding to the beta-clamp [11]. In this study, a purified mutant form of the M. tuberculosis (Mtb) β-clamp was utilized, featuring three specific amino acid substitutions at the C-terminal end (P397A/V398D/R399A—subsite II). When DNA was not present, this mutant β-clamp exhibited a moderate level of physical interaction with MtbXthA, but its capacity to enhance the activities of XthA was considerably reduced compared to the wild type [11].

In this study, we conducted an amino acid sequence alignment (Fig. 4) and a structural alignment comparing the crystal structures of β-clamp proteins sourced from M. tuberculosis (RCSB: 3P16) and S. aureus (RCSB: 7EVP) (Fig. 5). The sequence alignment elucidated that the C-terminal region of the β-clamp protein from M. tuberculosis, specifically 397PVR399, corresponds to the analogous C-terminal region of the β-clamp protein found in S. aureus, denoted as 373PIR375. This alignment highlights a conserved structural motif within the C-terminal regions of the β-clamp proteins across these two bacterial species.

Fig. 4.

Alignment of C-terminal amino acids of beta-clamps from M. tuberculosis and S. aureus. Colored blocks highlight the amino acids defined in the β-clamp of M. tuberculosis [11] as a mutant region P397A/V398D/R399A, which resulted in decreased stimulation of XthA repair enzyme activity

Fig. 5.

Structural alignment of the available crystal structures between β-clamp proteins from M. tuberculosis (RCSB: 3P16) and S. aureus (RCSB: 7EVP). The blue arrow indicates the C-terminal region (245PRV247) of the M. tuberculosis β-clamp, while the red arrow indicates the sequence 373PIR375 of the C-terminal region of the S. aureus β-clamp

Indeed, as observed, the sequence 373PIR375 in beta-clamp in S. aureus is consistently present not only when compared with P. furiosus but also in the comparison with M. tuberculosis. This signifies a conserved motif in the C-terminal region of β-clamp proteins, underlining its potential functional significance and structural conservation.

Moreover, Klemperer et al. [10] investigated the mechanism of DNA polymerase interaction with the β-clamp (S. aureus) through a conserved region of the β-clamp, with a specific focus on the 363rd proline residue, which is highly conserved across gram-positive and gram-negative bacteria. The authors demonstrated that the use of a β-clamp mutant with a substitution of proline 363 with alanine (P363A) resulted in the loss of replication activity [10].

In light of the aforementioned observations, it becomes evident that the hydrophobic proline in the C-terminal region assumes a crucial role in the interaction between the clamp and its partner proteins. Therefore, we conducted comprehensive alignment involving multiple beta-clamp sequences including bacterial and archaeal homologues (Fig. 6).

Fig. 6.

Alignment of C-terminal amino acids of sliding clamps (β-clamps and PCNA) at the domain level of bacteria and archaea. The colored block indicates the position of the proline involved in the interaction with partner proteins

To assess the impact of the mutant β-clamp on the stimulation of AP endonuclease Nfo, we engineered a mutants at the relevant region, introducing amino acid substitutions P373A/I374D/R375A.

Purification of Recombinant Proteins SaNfo, SaDnaN, SaDnaN-P373A/I374D/R375A and HpXth

The recombinant beta-clamp SaDnaN protein was purified from E. coli Rosetta 2 (DE3) strain by IMAC. SDS-PAGE in a 12% gel revealed > 95% of purity of obtained proteins (Supplementary 1). The resulting SaNfo protein does not contain any additional tags, the calculated molecular weight of SaNfo is 33.2 kDa. The recombinant SaDnaN and its mutant P373A/I374D/R375A proteins contain an additional 20 amino acid domain at the N-terminus containing a six-histidine tag (the molecular weight is 44 kDa). AP endonuclease HpXth was purified as describes previously, protein contains a six-histidine tag [18].

Mutation in the C-Terminal Region of β-Clamp Leads to a Disruption of the Stimulation of AP Endonuclease Activity of Nfo

The purified mutant β-clamp was utilized to stimulate the AP endonuclease activity of SaNfo. The reaction substrate was a 22-mer double-stranded oligonucleotide, containing a synthetic AP site analog—tetrahydrofuran at the 10th position on one of the strands. The mutant protein carried substitutions at amino acid positions 373–375 (PIR/ADA) (Figs. 7 and 8).

Fig. 7.

Stimulation of AP-endonuclease activity of SaNfo (5 nM) by wild-type β-clamp and P373A/I374D/R375A mutant. The reaction substrate was a 22-mer double-stranded oligonucleotide containing a synthetic AP site analog, tetrahydrofuran, at the 10th position of one of the strands. The mutant β-clamp protein contained substitutions at positions 373–375 of the amino acids (PIR/ADA). SaNfo concentration was 5 nM. The concentration of both types of β-clamp in the gradient (lanes 4–7) was 0.25, 0.5, 1, and 2 µM, respectively

Fig. 8.

Stimulation of AP-endonuclease activity of SaNfo (10 nM) by wild-type β-clamp and P373A/I374D/R375A mutant. The reaction substrate was a 22-mer double-stranded oligonucleotide containing a synthetic AP site analog, tetrahydrofuran, at the 10th position of one of the strands. The mutant β-clamp protein contained substitutions at positions 373–375 of the amino acids (PIR/ADA). SaNfo concentration was 10 nM. The concentration of both types of β-clamp in the gradient (lanes 4–7) was 0.25, 0.5, 1, and 2 µM, respectively

The analysis of the reaction results shows that the mutant phenotype of β-clamp significantly loses its stimulating effect on AP endonuclease. It is evident that at high concentrations of wild-type β-clamp (1 and 2 μM) with 5 nM concentration of SaNfo, the 22-mer substrate is completely cleaved at the AP site (Fig. 7, lanes 6 and 7). However, when using the P373A/I374D/R375A mutant, about half of the substrate concentration remains unprocessed at the end of the reaction (Fig. 7, lane 6), and the substrate is fully processed only at 2 μM (Fig. 7, lane 7).

In the case of using a higher concentration of SaNfo (10 nM), we observe a shift in the reaction product profile to the left, where changes are also observed when using the mutant β-clamp (Fig. 8). Even at the initial concentration of wild-type β-clamp (250 nM), almost all of the substrate is processed to a 9-mer product (Fig. 8, lane 4), which is not observed when using the mutant β-clamp, even at higher concentrations (Fig. 8, lanes 4 and 5). The replacement of proline and arginine in the conservative region of the C-terminal domain with alanines may play a key role in stimulating the AP endonuclease activity of Nfo with β-clamp.

To confirm that the stimulation of Nfo by β-clamp is not merely a sliding effect of the clamp on the dsDNA substrate, but rather a result of the intrinsic interaction between the β-clamp and the partner protein, we performed a reaction stimulating the AP endonuclease activity of another AP endonuclease Xth from Helicobacter pylori (HpXth) (Fig. 9).

Fig. 9.

Stimulation of AP-endonuclease activity of HpXth by wild-type β-clamp

As demonstrated, even with the use of a high concentration of β-clamp (Fig. 9, lanes 6 and 7), there was no observable increase in substrate cleavage product at the 9-mer oligonucleotide level. If stimulation had been caused solely by the effect of clamp sliding on the double-stranded DNA substrate, an increase in the substrate cleavage product at the 9-mer oligonucleotide level would have been observed with the use of a high concentration of β-clamp for Xth from H. pylori. However, no such effect was observed, confirming the specific interaction between the Nfo endonuclease of S. aureus and the β-clamp.

Conclusion

The interaction of Nfo and β-clamp has been a subject of interest in the study of DNA repair mechanisms. The article describes experiments conducted to investigate the specificity of the interaction between the two proteins. The results showed that stimulation of staphylococcal Nfo by β-clamp was not solely due to the sliding clamp effect on the substrate DNA, but rather the result of a specific interaction between the two proteins. These results have significant implications for understanding of the mechanism of DNA repair, particularly in the context of the role of β-clamp in DNA repair. A deeper understanding of the mechanisms underlying the emergence of mutations can facilitate the prediction of unknown mechanisms of antibiotic resistance. DNA repair plays a crucial role in maintaining genome stability in microorganisms. DNA repair enzymes have enormous functional significance in bacterial defense mechanisms. There are publications emphasizing the need for research on repair enzymes as new drug targets [28–30].

Further exploration into the mechanisms that underlie the emergence of mutations holds promise for anticipating unknown mechanisms of antibiotic resistance. The potential for harnessing DNA repair pathways as novel targets for antibiotic development becomes increasingly apparent. A proactive exploration of innovative therapeutic interventions, such as targeting specific DNA repair enzymes, could pave the way for novel strategies to combat antibiotic resistance and bolster bacterial defense mechanisms. Anticipating future challenges, a proactive approach to research in this domain may lead to the development of next-generation antibiotics that are capable of mitigating resistance mechanisms and ensuring prolonged efficacy in the battle against bacterial infections.

Supplementary Information

Below is the link to the electronic supplementary material.

Author Contributions

Conceptualization, UZ, AT and SA; methodology, UZ, AT and SA; software, UZ, AT and SA; validation, UZ, AT and SA; formal analysis, UZ, AT and SA; investigation, UZ, AT and SA; resources, UZ, AT and SA; data curation, UZ, AT and SA; writing—original draft preparation, UZ, AT and SA; writing—review and editing, UZ, AT and SA; visualization, UZ, AT and SA; supervision, SA; project administration, SA; funding acquisition, SA. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Science Committee of the Ministry of Science and Higher Education of the Republic of Kazakhstan (Grant No. AP19579275 and AP19680500).

Data Availability

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Conflict of interest

All authors declare no conflict of interest associated with this publication.